20k human chip

Arnoud van den Heuvel
March 31st 2006

20k human chip

AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT
Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes in tens of thousands of genes can be evaluated at once. Every color represents a different kind of change to a cell. It's all about measuring energy and classifying structures, f.e. to eventually be able to mutate our building blocks into their NEXT NATURE.

cell scanning

Share your thoughts and join the technology debate!

 

Comments are members only. Login to your account and join the technology debate.

LOGIN
Not a member? Join us

=A=
Posted 01/04/2006 – 15:13

The title? --> the activity of cellular information made visual by this scanning technology can be read out from a chip no greater than 20k of data-space. The technology CANNOT be used to alter or mutate cells, but would we be able to... then this could be the map to use.

Rolf
Posted 31/03/2006 – 14:52

euh?
can you explain that?

Should men be able to give birth to children?


Lisa Mandemaker: Using an artificial womb could lead to more equality between sexes, but also between different family layouts. If men would be able to give birth to children, it would maybe be easier for male same-sex couples to have a child together.

Join us!
Already a member? Login.