Search results for humane technology

Visual of Humane Technology #1: Feels Natural

Humane Technology #1: Feels Natural

All too often, technology frustrates us. It forces our behavior into constrained pathways. Even more insidious, technology can knock us out of alignment with our values, goals or …

Visual of Humane Technology #6: Improve the Human Condition

Humane Technology #6: Improve the Human Condition

And now for the sixth and final principle: Humane technology improves the human condition and helps people realize the dreams they have of themselves. No matter what your …

Visual of Humane Technology #2: Revive Human Intuitions

Humane Technology #2: Revive Human Intuitions

Our second principle: Humane technology revives human intuitions, in particular those we might have forgotten about. 'Conventional' technology aims to overcome our hominid …

Visual of Humane Technology #3: Take Human Values as a Cornerstone

Humane Technology #3: Take Human Values as a Cornerstone

The third principle of humane technology: It should take human values as a cornerstone of its development. Technology doesn't have to be expensive or electronic to be humane. …

Visual of Humane Technology #4: Resonate with human senses

Humane Technology #4: Resonate with human senses

Principle number four: Humane technology should resonate with the human senses, rather than numbing them. If you're an office worker or a video game fanatic , you may spend most …

Visual of Humane Technology #5: Empower People

Humane Technology #5: Empower People

Principle number five: Humane technology doesn't outsource people, but instead empowers them. How healthy or humane is it to have an escalator to the gym? Humane technology should …

Visual of On inhumane technology

On inhumane technology

Stick-on shoes, wakeup lights, bionic limbs: these are examples of humane technology. But what exactly does this mean? It can best be explained in contrast with its opposite. …

Visual of The six principles of humane technology

The six principles of humane technology

We must be mindful about how we engage with technology: what we use it for, why, and whether it helps or hinders us. Sometimes our tech seems to be flowing in inhumane directions, …

Visual of A path to humane technology

A path to humane technology

In 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …

Visual of Pyramid of Technology: How technology becomes nature in seven steps

Pyramid of Technology: How technology becomes nature in seven steps

How technology becomes nature in seven steps

Visual of Can technology be humane?

Can technology be humane?

We must be mindful about how we engage with technology: what we use it for, why, and whether it helps us or hinders us. Sometimes our tech seems to be flowing in inhumane …

Visual of The Pyramid of Technology: How will we co-evolve with technology?

The Pyramid of Technology: How will we co-evolve with technology?

This question is an excerpt from the Pyramid of Technology toolkit Cooking is a process through which humans outsource part of their bodily functions to technology (think …

Visual of The Pyramid of Technology: How will a technology enter the human habitat?

The Pyramid of Technology: How will a technology enter the human habitat?

This question is an excerpt from the Pyramid of Technology toolkit In the late nineties, the Tamagotchi egg was released. A small egg-shaped device that contained a digital …

Visual of The Pyramid of Technology: Could a technology establish new routines?

The Pyramid of Technology: Could a technology establish new routines?

This question is an excerpt from the Pyramid of Technology toolkit Imagine asking your grandparents if they ‘have googled anything lately?’ Chances are they actually did, …

Visual of The Pyramid of Technology: How will technology enchant us?

The Pyramid of Technology: How will technology enchant us?

This question is an excerpt from the Pyramid of Technology toolkit Take a mundane object from your house. Now ask yourself: How will this particular technology enchant me? …

Visual of The Pyramid of Technology: Is the technology outside or inside your body?

The Pyramid of Technology: Is the technology outside or inside your body?

This question is an excerpt from the Pyramid of Technology toolkit The first computers barely fit in your living room. This all changed with the introduction of the desktop …

Visual of A new mythology of technology

A new mythology of technology

In conversation with architect Julia Watson, a leading expert on Indigenous technologies and author of 'Lo-TEK, Design by Radical Indigenism'.

Visual of The World Without Technology

The World Without Technology

I remember the smoke the most. That pungent smell permeating the camps of tribal people. Everything they touch is infused with the lingering perfume of smoke – their food, …

Visual of Moral Shortcomings in the Technology Debate

Moral Shortcomings in the Technology Debate

Digital and genetic techniques increasingly influence life. Our belief in progress through technology stands in the way of a moral debate on this development. By Rinie van Est We …

Visual of Nature Loves Technology

Nature Loves Technology

We interviewed William Myers and Emma van der Leest, curators of Nature Loves Technology, our exhibition at Floriade 2022

Visual of Intimate Technology: the Battle for Our Body and Behaviour

Intimate Technology: the Battle for Our Body and Behaviour

Technology is nestling itself within us and between us, has knowledge about us and can act just like us.

Visual of (Nano)technology imitating Nature

(Nano)technology imitating Nature

Over the coming years, nanotechnology will invade our everyday lives. Nanotechnology, usually defined as the control and manipulation of matter at the nanoscale, will be …

Visual of Humans Are the Sex Organs of Technology

Humans Are the Sex Organs of Technology

Written by Kevin Kelly , published in The Technium .  I claim that technology has its own agenda. What is the evidence that technology as a whole, or the technium as I call it, is …

Visual of Pre-Order the Pyramid of Technology Toolkit

Pre-Order the Pyramid of Technology Toolkit

The Pyramid of Technology toolkit is a workshop-in-a-box that helps you better understand technology and catalyze innovative processes.

Visual of Can Life Be a Technology?

Can Life Be a Technology?

In 2009 the Initiative for Science, Society and Policy coined the phrase ‘living technology’ [1] to draw attention to a group of emerging technologies that are useful because they …

Visual of Reimagining popular apps with the Pyramid of Technology

Reimagining popular apps with the Pyramid of Technology

Today, there's an app for everything. They help us satisfy our cravings, allow us to communicate at all times and make it easier to share special moments. But the dark, cold …

Visual of How to bingewatch the Intimate Technology series

How to bingewatch the Intimate Technology series

Technology is coming closer to us. In the form of decades old headphones or state-of-art devices. It has always been a part of our lives and this only seems to develop further: …

Visual of Next Generation: Designing ecosystems of technology with Maike Gebker

Next Generation: Designing ecosystems of technology with Maike Gebker

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of How technology bridges the generational communication gap

How technology bridges the generational communication gap

Emoji, Skype, Selfies - can these communication technologies close the generation gap? In part, yes! Young people are teaching senior citizens how to use technology, and it’s …

Visual of How technology keeps us connected

How technology keeps us connected

At this moment in time, many people are staying at home in order to flatten the curve . It is times like these that we realize how vital technology is to us and our societies. It …

Visual of Changing your Mood on Demand with Brain-Altering Wearable Technology

Changing your Mood on Demand with Brain-Altering Wearable Technology

Thync, is a new brain-altering wearable technology that promises to “shift your state of mind and conquer life” by allowing its users to change their mood whenever they need it.

Visual of How Technology becomes Nature

How Technology becomes Nature

In this talk at TEDxGhent, our own Dr. Van Mensvoort shows how technology becomes nature in seven steps and what engineers, inventors, designers and entrepreneurs can learn from that.

Visual of Wearing Technology Under the Skin

Wearing Technology Under the Skin

UnderSkin is a device that would be implanted beneath the skin on your hand and charge off your body’s energy.

Visual of Technology and Emotions

Technology and Emotions

A wearable lighting device that changes color and shade according to movement, facial expressions, weather and mood.

Visual of Intimate Technology Series on NNN

Intimate Technology Series on NNN

We called upon artists, filmmakers and film enthusiasts around the world to create a one-minute videos for the intimate technology series.

Visual of Technology and Sports: Nutrigenomics

Technology and Sports: Nutrigenomics

We’ve been told since grade school that what we eat is important, but we’ve all been told to eat the same sort of healthy things. This isn’t bad, but with the up-and-coming …

Visual of Technology vs Football: 4-4

Technology vs Football: 4-4

Some matches remain interesting, even though they're predictable. Take the continuous battle between technology and football. Every time the stakes get high, such as at the World …

Visual of Call for Videos: Intimate Technology

Call for Videos: Intimate Technology

Next Nature Network is curating the One Minutes series for September 2017.

Visual of The City as Technology in Tokyo

The City as Technology in Tokyo

Are cities in their current form really the future of the human habitat? What is a next nature version of the city and how would it look like? In line with this perspective, NNN designer Hendrik-Jan Grievink led two workshops in Tokyo.

Visual of Intimate Technology S01E07: Our Selves

Intimate Technology S01E07: Our Selves

We think of selfhood as residing in our everyday stream of consciousness. But could we possibly have a second digital self in our online behaviors? Watch episode 3 of our Intimate Technology series.

Visual of Intimate Technology Series: Watch the Trailer

Intimate Technology Series: Watch the Trailer

We are happy to announce our new upcoming weekly video-series on the 'Intimate Technology' theme.

Visual of Bio textiles: meet three designers reimagining materials using biotechnology

Bio textiles: meet three designers reimagining materials using biotechnology

The world needs interdisciplinary creators who are designing not just for humans, but for the rest of the living planet. To foster this thinking, Biodesign Challenge (BDC) pairs …

Visual of Intimate Technology Evening at Droog

Intimate Technology Evening at Droog

Droog Foundation and Next Nature Network invites you to join the conversation about Intimate Technology: April 23, in Amsterdam.

Visual of How Technology is Becoming More and More Sensitive

How Technology is Becoming More and More Sensitive

Over the past decade scientists have tried to get technology surfaces to be as sensitive as our skin, especially as our fingertips. Human tact is a very sophisticate interface …

Visual of Intimate Technology S01E01: All My Clothes

Intimate Technology S01E01: All My Clothes

This movie titled "All My Clothes" reminds us of a more straightforward example of intimate technology: the clothes we wear every day.

Visual of Haptic technology

Haptic technology

Haptic technology refers to technology which interfaces the user via the sense of touch by applying forces, vibrations and/or motions to the user (Just think of the Wii ). At the …

Visual of Blaming Car Technology for Dumb Drivers

Blaming Car Technology for Dumb Drivers

Cars increasingly rely on technology designed to make driving easier and safer. But are these improvements creating less-skilled drivers?

Visual of Technology Reflexology

Technology Reflexology

People have complex relationships with their own (and other’s) bodies. In Traditional Chinese Medicine (TCM), it is believed that your feet are a map of your body and can provide …

Visual of Intimate Technology S01E06: Also, the Dichotomy of Pragmatism and Perversion

Intimate Technology S01E06: Also, the Dichotomy of Pragmatism and Perversion

Do we treat our technologies with more care and sentimentality these days than we did in the past?

Visual of Technology: The 7th Kingdom of Life

Technology: The 7th Kingdom of Life

Kevin Kelly, Senior Maverick at Wired Magazine talks about the nature of technology and propose to define technology as the 7th Kingdom of Life.

Visual of Googles Natural Tracking Technology

Googles Natural Tracking Technology

We may soon all be making natural gestures to interact with our digital devices.

Visual of The prehistoric importance of trading technology

The prehistoric importance of trading technology

Then, as now, one person could literally change the course of history, with nothing more than an idea.

Visual of Technology behind Google's results

Technology behind Google's results

As a Google user, you're familiar with the speed and accuracy of a Google search. How exactly does Google manage to find the right results for every query as quickly as it does? …

Visual of Technology Costs Evolution

Technology Costs Evolution

Producing an iPhone in 1991 would have cost 3,56 million of dollars.

Visual of Design on the Border of Technology and Biology Demands Us to 'Mother' Nature

Design on the Border of Technology and Biology Demands Us to 'Mother' Nature

Designer and architect Neri Oxman explores how digital fabrication technologies can interact with the biological world. Watch the TED talk.

Visual of Intimate Technology S01E04: So Happy Together

Intimate Technology S01E04: So Happy Together

What if you could upload your fondest memories to the cloud? Watch episode 4 of our Intimate Technology video series.

Visual of Intimate Technology S01E02: Misbehaving (Ro)bots

Intimate Technology S01E02: Misbehaving (Ro)bots

"Misbehaving (Ro)bots" asks whether technology could hope to replicate these small bothersome quirks that instill a feeling of intimacy.

Visual of Intimate Technology S01E05: The Modular Body

Intimate Technology S01E05: The Modular Body

The body, like any technology, is made up of countless individual components. Yet, apart from dire medical emergency, have you ever thought about mixing and matching these …

Visual of Intimate Technology S01E08: Scroll

Intimate Technology S01E08: Scroll

The last episode of our Intimate Technology series follows a minute in the life of a hyperconnected family in the digital era.

Visual of Nanotechnology Crashcourse

Nanotechnology Crashcourse

This mashup video project integrates various video clips that ask: What is nanotechnology? Via Posthumanblues , via Futureblogger . See also: Small Talks , Bacteria Bots , …

Visual of Tribal Communication Technology

Tribal Communication Technology

Mobile phones are nextnature: Twenty years ago they didn't exist, now everyone has one and when you leave your house without it, you feel amputated. Like you are missing a limb …

Visual of Co-Evolving with Technology

Co-Evolving with Technology

Looking at this nextnatural comic, our co-evolutionary relationship with technology might need some work.

Visual of Sexual Fetishes Evolve with Technology

Sexual Fetishes Evolve with Technology

Once common, statue-loving has disappeared from the sexual landscape.

Visual of Intimate Technology S01E03: A iReal

Intimate Technology S01E03: A iReal

What if your devices had a life of their own? Guy Farber’s playful short movie "An iReal" explores this very possibility.

Visual of How modern technology is inspired by the natural world

How modern technology is inspired by the natural world

What do a kingfisher, cocklebur pods and a Namibian beetle have in common? Besides being living organisms, they have all served as inspiration for creative human technologies to …

Visual of What does Technology want?

What does Technology want?

Technologist, environmentalist and nextnature thinker avant la lettre Kevin Kelly , muses on what technology means in our lives – from its impact at the personal level to its …

Visual of Screw Technology

Screw Technology

In this particular piece of video art, loyal readers of nextnature.net might recognise the building as Zeche Zollverein in Germany, where we organized the Biggest Visual Power …

Visual of All This Technology Makes Us Anti-Social

All This Technology Makes Us Anti-Social

Peculiar image of the week.

Visual of All This Technology Makes Us Anti-Social

All This Technology Makes Us Anti-Social

Then and now.

Visual of Animals Love Technology

Animals Love Technology

A macaque stole a tourist's iPhone and fiddled around with it like a human would.

Visual of Technology Is Our Next Nature

Technology Is Our Next Nature

Video testimonial for our Next Nature Appzine, all the way from India!

Visual of Technology Made us Human

Technology Made us Human

Buckle up for a cinematic espresso shot from performance philosopher and NNN ambassador Jason Silva.

Visual of The New Technology in Agriculture: Trees

The New Technology in Agriculture: Trees

New technologies are changing the landscape, but the latest trend reshaping rural environments and agriculture is agroforestry: the art of planting trees.

Visual of Interview: Pauline Van Dongen, Designer Merging Fashion and Technology

Interview: Pauline Van Dongen, Designer Merging Fashion and Technology

Dutch fashion designer specialized in wearable technology, Pauline van Dongen researches the human body in relation to its surroundings.

Visual of How biotechnology could shape the future of product design

How biotechnology could shape the future of product design

Humans have been manipulating living things for thousands of years. Examples of early biotechnologies include domesticating plants and animals and then selectively breeding them …

Visual of Our Relationship with Tech Is Growing Stronger

Our Relationship with Tech Is Growing Stronger

It's getting difficult to discern what's technology and what's not.With wearable technology becoming more and more integrated into society, our lives become infused with more technology.

Visual of These Next Senses allow you to augment your senses with technology

These Next Senses allow you to augment your senses with technology

Imagine you could communicate telepathically with a whale, listen to the WiFi networks in your environment, or experience smells through seeing color. Developments in technology …

Visual of Technology: Intrusive or Supportive?

Technology: Intrusive or Supportive?

Is the use of personal devices becoming a replacement for the spectrum of emotions that make us all humans?

Visual of With this technology we can shake hands during the pandemic

With this technology we can shake hands during the pandemic

“Please refrain from hand shaking" is a common sign we now see as a result of public health organizations advising people to avoid shaking hands as a greeting. As people still …

Visual of Fermenting Futures and the beauty of biotechnology

Fermenting Futures and the beauty of biotechnology

Exploring the co-evolution of yeast and humans, while discovering the aesthetic value of yeast biotechnology, is what designers Anna Dumitriu and Alex May have been concocting. …

Visual of Meat & Greet Workshop Report

Meat & Greet Workshop Report

Last week, Next Nature Lab had the first Meat & Greet to explore the future of in vitro meet.

Visual of This bin transforms household waste into chicken food

This bin transforms household waste into chicken food

Imagine a trash can that matches the size of your ordinary bin, yet it scoffs at weeks' worth of discarded food before even considering fullness. You're off the hook, as there's …

Visual of The future infrastructure of the blockchain might be green and humane

The future infrastructure of the blockchain might be green and humane

The connection we share through the Internet has laid the foundation for a whole new digital infrastructure, in which blockchain technology is heralded by many believers for being …

Visual of The Biofabricate Summit '24 is coming to Paris!

The Biofabricate Summit '24 is coming to Paris!

Biosequin, seaweed textiles, and microbe sunscreen: these ideas and more are marking the next wave of bio-innovators during the Biofabricate Summit 2024.

Visual of Next Generation: Growing technology with Prosthetic X

Next Generation: Growing technology with Prosthetic X

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of The next sexual revolution is going to be all about technology

The next sexual revolution is going to be all about technology

Sex is one of the most powerful, fundamental human drives. It’s caused wars, and built and destroyed kingdoms. It occupies a significant percentage of most people’s thoughts. As …

Visual of THRIVE: an expo in designing nature and growing technology

THRIVE: an expo in designing nature and growing technology

THRIVE expo showcases the latest works at the convergence of art, design, and biology, which examine current and future uses of biotechnology.

Visual of Close to skin technology

Close to skin technology

Wearable Interfaces, Smart Materials and Living Fabrics. V2_, Institute for the Unstable Media, Rotterdam, and Amsterdam-based Virtueel Platform, the expertise centre for …

Visual of Smartphones Will Soon Be a Thing of the Past

Smartphones Will Soon Be a Thing of the Past

Smartphones have become almost a part of who we are. According to tech industry experts, however, the smartphone's days are numbered and that number is lower than you might expect.

Visual of Exploring speculative developments of reproductive technology

Exploring speculative developments of reproductive technology

What if women of childbearing age no longer had to interrupt their careers for a pregnancy? In Kuang-Yi Ku ’s project Grandmom Mom, we take a look into the future. In 2050, the …

Visual of How technology will help us adapt to climate change

How technology will help us adapt to climate change

Climate change will transform how we live, but these tech and policy experts see reason for optimism

Visual of With this sound recognition technology scientists can eavesdrop on nature

With this sound recognition technology scientists can eavesdrop on nature

What if humans would be able to listen to what nature has to say? Conservationists are trying to grasp non-human sounds , which might help us to better understand environmental …

Visual of Body hair helps animals stay clean – and could inspire self-cleaning technologies

Body hair helps animals stay clean – and could inspire self-cleaning technologies

Watch a fly land on the kitchen table, and the first thing it does is clean itself, very, very carefully. Although we can’t see it, the animal’s surface is covered with dust, …

Visual of How blockchain technology is changing the agriculture industry

How blockchain technology is changing the agriculture industry

Blockchain is useful for more than cryptocurrency. It’s revolutionizing industry after industry. Next, it may change the way we get our food. The agriculture industry is complex. …

Visual of The return of trade: Blockchain technology is enabling trade to make a fierce comeback

The return of trade: Blockchain technology is enabling trade to make a fierce comeback

Before money came into existence, trading was all we knew. Farmers in China traded their spades for food and other goods, and this continued up until a point where most spades …

Visual of Why human enhancement requires technological citizenship

Why human enhancement requires technological citizenship

New technologies – from artificial intelligence to synthetic biology – are set to alter the world, the human condition, and our very being in ways that are hard to imagine. The …

Visual of The Playboy Interview

The Playboy Interview

In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …

Visual of In Conversation with Marleen Hartjes: Introducing a digital door to the museum

In Conversation with Marleen Hartjes: Introducing a digital door to the museum

Don’t be surprised when you catch a human face on a screen strolling through the Van Abbe museum for contemporary art in Eindhoven, as these are Europe’s very first robotic …

Visual of Letter to Humanity

Letter to Humanity

NNN director Koert van Mensvoort writes a letter to humanity.

Visual of Artifice Earth: Adam Rutherford on the Promises of Synthetic Biology

Artifice Earth: Adam Rutherford on the Promises of Synthetic Biology

An interview about the history and promises of synthetic biology, and the problem with the word "nature".

Visual of Face the future of intimacy with Kiiroo

Face the future of intimacy with Kiiroo

Meet the teledildonics, an ingenious species of bi-directionally controlled sextoys from the future, available today. These touch emulating vibrators find each other on social sex …

Visual of Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture

Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture

Rachel Armstrong discusses living buildings, Venice's foundations, millennial nature and how to improve our future.

Visual of Next Generation: Shaping intimacy through objects with Pleun van Dijk

Next Generation: Shaping intimacy through objects with Pleun van Dijk

Pleun van Dijk is a speculative artist/designer who investigates the intimate relationship between human and technology.

Visual of What we can learn from The Social Dilemma

What we can learn from The Social Dilemma

Is social media ruining the world? Dramatic political polarization. Rising anxiety and depression. An uptick in teen suicide rates. Misinformation that spreads like wildfire. The …

Visual of Next Nature Academy presents: A workshop-in-a-box for your team

Next Nature Academy presents: A workshop-in-a-box for your team

Are you working on projects where technology and human interaction are involved, and are you looking for a new approach? As of today, we offer a brand new workshop concept for you …

Visual of Check your technoprivilege!

Check your technoprivilege!

Technology is not neutral; the same tech might empower some and disempower others. It is time to check our Technoprivilege, argues author Hendrik-Jan Grievink.

Visual of An Ecstatic Dialogue with Richard Doyle

An Ecstatic Dialogue with Richard Doyle

When techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …

Visual of Next What?

Next What?

In this essay, anti-civilization, anarchist philosopher John Zerzan critiques the concept of 'next nature.' He argues that rather than freeing us, our self-domestication through …

Visual of Interview: Liam Young on Speculative Architecture and Engineering the Future

Interview: Liam Young on Speculative Architecture and Engineering the Future

Interview with Liam Young on his work in speculative architecture, the future, and our role in nature as humans.

Visual of I Want Wings!!!!!!!!!!!!!!

I Want Wings!!!!!!!!!!!!!!

Read Nicholas Carr's essay on the transhumanist dream of having wings.

Visual of Love your monsters

Love your monsters

Why we must care for our technologies as we do our children.

Visual of Next Nature and the Curse of Oil

Next Nature and the Curse of Oil

The next step is to embrace and celebrate how cultural artifacts are escaping control, becoming autonomous, and forming the “next nature”.

Visual of Browse the Catalog For The Post-Human

Browse the Catalog For The Post-Human

Augment your physiology. Enhance your prospects. From neuro-electronics, to robotic-prosthetics and mind-altering pharmaceuticals.

Visual of Next Nature's must reads

Next Nature's must reads

Ten books that continue to inspire the next nature philosophy—gathered for you to read this summer.

Visual of Why digital detoxes are a solution looking for a problem

Why digital detoxes are a solution looking for a problem

With New Year’s resolutions in full swing, many people may have chosen to cut down on their tech use – or even give it up altogether. The  growing popularity of such “digital …

Visual of The Embassy of Health is designing a chronically healthy society

The Embassy of Health is designing a chronically healthy society

How will we stay healthy in the future? Can we utilize the power of design to move towards a more healthy society?

Visual of Designer Anouk Wipprecht combines fashion with robotics

Designer Anouk Wipprecht combines fashion with robotics

We met Anouk Wipprecht and talked about smart fabrics and accessories that can listen to our body, therapeutic fashion and the future of dressmaking.

Visual of Smart homes could help dementia patients live independently

Smart homes could help dementia patients live independently

You might already have what’s often called a “smart home”, with your lights or music connected to voice-controlled technology such as Alexa or Siri. But when researchers talk …

Visual of ‘Optimism is our duty’: in conversation with Koert van Mensvoort

‘Optimism is our duty’: in conversation with Koert van Mensvoort

We live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …

Visual of Reproducing robots

Reproducing robots

When we think of robots, we typically do not think of small cellular organisms made with embryonic cells from frogs. However, this is exactly what the joint teams at University of …

Visual of Next Generation: Experiencing neo-robophilia with Hye Hyun Song

Next Generation: Experiencing neo-robophilia with Hye Hyun Song

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Entryparadise

Entryparadise

Written by Werner Lippert & Peter Wippermann, Curators of the Entryparadise exhibition (26/8 until 3/12, 2006, at Kohlenwäsche, Zollverein) Design is about to undergo a …

Visual of “Everything Is Already Invented”

“Everything Is Already Invented”

Robert Gordon says all the major inventions have been made, but that's only true for our limited knowledge of future possibilities.

Visual of Fly like a Bird? Get Human Birdwings

Fly like a Bird? Get Human Birdwings

Dutch mechanical-engineer Jarnos Smeets dreams of flying like bird. Nothing new really, many people have had this dream for ages. Yet being an engineer and all, Jarnos is seriously propelling his dream towards a reality.

Visual of Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society

Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society

We recently talk to Nadine Bongaerts about the role and impact of synthetic biology, the gap between bio­sciences and society and the importance of communication to overcome the fear of new technologies.

Visual of Seeing in 3D

Seeing in 3D

If you are a regular reader of content from Next Nature, then you know that 3D printing can be used in all sorts of technological developments, such as organ printing , food waste …

Visual of This electronic skin enhances our virtual tactile perception

This electronic skin enhances our virtual tactile perception

From mouse, to stylus, to finger: our virtual tactile perception has changed a lot over the years, just like our overall virtual experience. With new developments our virtual …

Visual of When will the first baby be born in space?

When will the first baby be born in space?

When the first baby is born off-Earth, it will be a milestone as momentous as humanity’s first steps out of Africa . Such a birth would mark the beginning of a multi–planet …

Visual of Reconnecting with wildlife through biodiverse meditations

Reconnecting with wildlife through biodiverse meditations

Sleep and dream like a koala, relax under biodiversity and feel the meditative effect of artificial wildlife.

Visual of How to design a digital democracy

How to design a digital democracy

10 design requirements to fully immerse ourselves into the 21st Century—in which technology makes our world richer, not poorer.

Visual of Study finds humans still evolving and quickly

Study finds humans still evolving and quickly

By Karen Kaplan, Los Angeles Times , December 11, 2007 The pace of human evolution has been increasing at a stunning rate since our ancestors began spreading through Europe, Asia …

Visual of Beyond the Possible with Floris Kaayk

Beyond the Possible with Floris Kaayk

Floris Kaayk, artist and fictive documentaries maker, confronts us with the impossible.

Visual of Ectogenesis, Artificial Womb, Human Egg?

Ectogenesis, Artificial Womb, Human Egg?

The artificial womb is on the verge of becoming a reality, but how it will affect our culture is for us to decide.

Visual of HUBOT: Meet the Singing Package Deliverer

HUBOT: Meet the Singing Package Deliverer

You did not make it to the Idols final, but you can sing very well and you love to make people happy. As a singing package deliverer, you deliver packages with a personal song. …

Visual of Getting rid of that bit of unspoiled green

Getting rid of that bit of unspoiled green

There it is. A hefty hen, with its head up high and its beak out. And a gigantic VR headset over its beady little eyes. What does this battery hen see? ‘An experience of a free …

Visual of If you could have another sense, which sense would you choose?

If you could have another sense, which sense would you choose?

Color-blind artist Neil Harbisson designed a brain-implanted antenna that converts colors into sound. This enables him to hear colors he cannot see, and extends his vision to …

Visual of Team Human is a manifesto for humankind

Team Human is a manifesto for humankind

' Team Human ' is a manifesto—a fiery distillation of media theorist Douglas Rushkoff’s most urgent thoughts on civilization and human nature. In one hundred lean and incisive …

Visual of Sónar Lisboa: a festival for body and brain

Sónar Lisboa: a festival for body and brain

Sometimes a festival can be so much more. Tapping into arts, design, and electronic and experimental music festival, Sónar Lisboa (8-10 April) is one for the body and for the …

Visual of Innovative Nostalgia

Innovative Nostalgia

We humans simply feel more comfortable with technological change when it comes in a familiar form that refers to an existing and accepted object, habit, value, tradition or intuition.

Visual of Welcome to Chanel Data Center

Welcome to Chanel Data Center

Two robots opened the show of Chanel during the Paris Fashion Week of 2017. Well robots, two models dressed up like humanoid robots entered the catwalk. Is Chanel going Next Nature?

Visual of Pay with Your Face

Pay with Your Face

Face-detecting systems in China now authorize payments, provide access to facilities, and track down criminals.

Visual of Why in the future, we will all wear one piece of garment

Why in the future, we will all wear one piece of garment

It's not an easy task to define the practice of designer Jasna Rok . Fashtech pioneer? Radical innovator? Visionary designer? ‘All of the above’ seems only appropriate. In fact, …

Visual of The beginner's guide to biohacking

The beginner's guide to biohacking

What is the first thing that comes to mind when you hear the term 'biohacking'? Perhaps you are now thinking of a bunch of kids sitting in their kitchen with a DNA kit, (wannabe) …

Visual of Smart cities could give the visually impaired a new outlook on urban life

Smart cities could give the visually impaired a new outlook on urban life

Travelling to work, meeting friends for a catch up or just doing some shopping are often taken for granted by people with no known disabilities. For the visually impaired, these …

Visual of Implanting Chips into Employees

Implanting Chips into Employees

An he hi-tech Swedish office block implanted a microchip under the employees’ hand skin.

Visual of Interview: Mike Thompson and Susana Cámara Leret, Designers Exploring Alternative Ways of Thinking & Doing

Interview: Mike Thompson and Susana Cámara Leret, Designers Exploring Alternative Ways of Thinking & Doing

Interview with Mike Thompson and Susana Cámara Leret.

Visual of Here’s how the Dutch are embracing blockchain in the polder

Here’s how the Dutch are embracing blockchain in the polder

Smiling broadly and rattling with enthusiasm, the 33-year-old Rylana Doesburg shows off a QR-code on her phone: an angular pattern of black and white squares. “Thanks to this …

Visual of The artificial womb: dream or nightmare?

The artificial womb: dream or nightmare?

The emerging technology of the artificial womb confronts us with a series of moral and societal questions. How to cope with that? Join us on 29 March at Eindhoven University of …

Visual of In conversation with Studio Drift

In conversation with Studio Drift

A flock of drones that fly like birds, drifting blocks of concrete, a choreography of opening and closing flowers. The work of Studio Drift is challenging the distinction between …

Visual of Nano Supermarket – Jury Report

Nano Supermarket – Jury Report

Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …

Visual of Illiterate Kids Learn to Hack Tablet Computers with No Outside Help

Illiterate Kids Learn to Hack Tablet Computers with No Outside Help

The One Laptop Per Child program is experimenting with what at first seems to be the lazy way to philanthropy: dropping off tablet computers in remote Ethiopian villages  and then …

Visual of Apple Watch Evolution

Apple Watch Evolution

In 1992, decades before the era of wearable technology, Apple produced its first watch: no apps and vintage design.

Visual of Google's Smart Interactive Clothing

Google's Smart Interactive Clothing

Project Jacquard makes it possible to weave touch and gesture interactivity into any textile.

Visual of Bio-Printer Creates Living Body Parts

Bio-Printer Creates Living Body Parts

Bioprinter creates bespoke lab-grown body parts for transplant.

Visual of Why there is a new urgency for speculative design

Why there is a new urgency for speculative design

Pink chickens, synthesized tiger penises and salads grown from bodily fluids - how could they shape our future? In a Next Nature collaboration with the Gogbot Festival, the …

Visual of Next Senses

Next Senses

Next Senses explores the unchartered territory of how we could experience the world with technology

Visual of The Food Pill

The Food Pill

Sweet, sour, salty, science: Food Technology!

Visual of A Tiny Trackpad That Fits on Your Nail

A Tiny Trackpad That Fits on Your Nail

Researchers from the Massachusetts Institute of Technology have developed a tiny wireless trackpad that could easily fit on your finger nail.

Visual of Ingestible Device to Monitor Vital Signs

Ingestible Device to Monitor Vital Signs

Biomaterials researchers at MIT came up with a very tiny device able to monitor vital signs from deep inside the body.

Visual of Bye Bye BlackBerry

Bye Bye BlackBerry

BlackBerry has just confirmed that it will no longer create its own phones, marking the end of an era for the once dominant leader of the smartphone market.

Visual of From Homo Sapiens to Homo Optimus

From Homo Sapiens to Homo Optimus

We are entering an age of technological singularity, in which artificial intelligence and biological enhancement are combined in order to construct the next stages of human evolution.

Visual of A Temporary Tattoo That Heals

A Temporary Tattoo That Heals

Moving tattoos from purely aesthetic crave to a healing method thanks to nanotechnology.

Visual of Facial Recognition Replaces Passports

Facial Recognition Replaces Passports

Biometric technology replaces passports in Australian airports.

Visual of Happy Earth Day!

Happy Earth Day!

Today we celebrate Earth day, here is why.

Visual of Smart Fabric Might Be the Key to the Future

Smart Fabric Might Be the Key to the Future

Researchers designed a smart fabric able to encode data readable by a magnetometer, like the one in your phone, without electronics or batteries.

Visual of Stay Young with Millennial Blood

Stay Young with Millennial Blood

A clinical startup sells millennial blood to reverse aging.

Visual of The artificial womb: are we ready?

The artificial womb: are we ready?

“Within a few years it will be possible for a premature baby to continue to mature in an artificial womb,” says gynecologist Guid Oei. It is therefore that the Artificial Womb: …

Visual of The Artificial Womb project receives funding to develop a prototype

The Artificial Womb project receives funding to develop a prototype

Hooray! The team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …

Visual of Exploring body architecture with Lucy McRae

Exploring body architecture with Lucy McRae

As evolution goes on, the human body is evolving too. What does it mean to be human in times of advanced biotechnology and genetic engineering? Are our bodies ready for our …

Visual of Five ways AI could make your car as smart as a human passenger

Five ways AI could make your car as smart as a human passenger

Driving long distances without a passenger can be lonely. If you’ve ever done it, you might have wished for a companion to talk to – someone emotionally intelligent who can …

Visual of Self–Repairing Architecture

Self–Repairing Architecture

All buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …

Visual of The Technological Sublime

The Technological Sublime

The sublime is an aesthetic concept of 'the exalted,' of beauty that is grand and dangerous. Through 17th and 18th century European intellectual tradition, the sublime became …

Visual of Interview: Alexandra Daisy Ginsberg, Designer and Synthetic Biology Expert

Interview: Alexandra Daisy Ginsberg, Designer and Synthetic Biology Expert

An interview with Daisy Ginsberg, artist and synthetic biologist.

Visual of Nanotech Shots Take Mice from Drunk to Sober in Minutes

Nanotech Shots Take Mice from Drunk to Sober in Minutes

Ever curse the fact that you have to wait hours to sober up after a night at the bar? Now, you can sober up almost instantly  – that is, if you're a mouse. Researchers at  MIT …

Visual of Which Device Are You Wearing Today?

Which Device Are You Wearing Today?

2014 is the year of wearable technology.

Visual of Archaeology of Media

Archaeology of Media

The Archéologies des Medias exposition turns archaic technology that was once cutting-edge into art.

Visual of Ear-Free Headphones

Ear-Free Headphones

Using bone conduction, this device allows to hear the sound directly in the head, keeping the ears free.

Visual of See Through the Skin with Your Smartphone

See Through the Skin with Your Smartphone

In the near future he ability to see through things won’t be a dream anymore with this infrared smartphone camera.

Visual of Which Technologies will 2016 Bring?

Which Technologies will 2016 Bring?

The new year is right around the corner, let’s forget about long-term future for a while to check out what new tech trends will hit it big in 2016. At the end of every year, …

Visual of Looking into the Artificial Eye

Looking into the Artificial Eye

Sensor specialists recently developed a sensor that mimics the mammalian eye.

Visual of Next Nature Gift Guide 2017

Next Nature Gift Guide 2017

The gift giving season is once again upon us and to help out those who are struggling to find that perfect gift for that special someone we have brought together a collection of Next Nature inspired gifts.

Visual of Do a Next Nature Workshop!

Do a Next Nature Workshop!

NNN organizes workshops using a physical Pyramid of Technology as conceptual tool.

Visual of 3D Printed Capsule Replaces Needle Injection

3D Printed Capsule Replaces Needle Injection

A needle free oral delivery system might in the future dissolve the old way of vacancies injected by syringes.

Visual of What an artificial womb may look like in the future

What an artificial womb may look like in the future

In the future, artificial wombs could replace incubators as they mimic the natural environment of the female uterus. But what will these devices look like?

Visual of ISEA 2010: Artists addressing NextNature

ISEA 2010: Artists addressing NextNature

At ISEA 2010 , the International Symposium on Electronic Arts, media artists and media researchers from all over the world present their work in Dortmund (Germany). This year, …

Visual of Human Nature Forecast

Human Nature Forecast

Interview witth TEDx on how people are technological by nature, yet how we also need humane technology to remain human, or become even more human than we are today.

Visual of Swallowable Parfum

Swallowable Parfum

Swallowable Parfum is a digestible scented capsule that works through your own perspiration. Once absorbed, fragrance molecules are excreted through the skin’s surface. A unique …

Visual of Nano Product: Energy Belt

Nano Product: Energy Belt

With Energy Belt, stop treating your excess fat like a liability, and instead embrace its untapped potential. Artificial protocells in the belt mimic natural  brown fat, taking …

Visual of Nano Product: Lungless

Nano Product: Lungless

350 million years after crawling from the sea, the Lungless suit will bring us back. Inspired by fish gills, the Lungless Aquatic Respiration Suit uses millions of cascading …

Visual of In Vitro Meat: Animal Liberation?

In Vitro Meat: Animal Liberation?

Many people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.

Visual of Making the Skin your New Touchscreen

Making the Skin your New Touchscreen

A tool that could turn the arm into a touch screen display.

Visual of The Moon will Become a WiFi Zone

The Moon will Become a WiFi Zone

Researchers proved it is possible to provide the Moon with the wireless connectivity we have on Earth.

Visual of After In Vitro Burger, Chicken is the Next

After In Vitro Burger, Chicken is the Next

Soon, we might be getting a taste of the first lab-grown chicken meat.

Visual of Meet the Band Aid of the Future

Meet the Band Aid of the Future

This potentially revolutionary device includes LED lights and temperature sensors to provide medication directly to the wounded section of the skin.

Visual of Our Bodies, Our Fuel

Our Bodies, Our Fuel

This piece from Ars Technica details the breadth in the variety of energy sources emitting from our every day interactions.

Visual of Are These the Headphones of the Future?

Are These the Headphones of the Future?

No matter which brand is going to rule the wireless headphones scene, it's time to get used to have a computer in our ear that we never need to take out. Until it may grow into it someday!

Visual of Facebook Provides a Suicide Prevention Tool

Facebook Provides a Suicide Prevention Tool

Facebook provides a new tool for suicide prevention

Visual of Future of Feelings: Emotion Reading Radio

Future of Feelings: Emotion Reading Radio

Researchers have the developed the EQ-Radio: a tool to read people emotions from a distance.

Visual of Payment by Thumb

Payment by Thumb

Australian biohacker Meow-Ludo Meow Meow implanted a chip in his thumb to make contactless payments.

Visual of A Tablet for the Visually Impaired People

A Tablet for the Visually Impaired People

U.S. researchers are working on an affordable braille tablet for blind people.

Visual of Talking Contact Lenses

Talking Contact Lenses

Researchers at University of Washington have introduced a new wireless communication method that allows small wearable devices to ‘talk’ to everyday devices.

Visual of 3D Printed Ovaries

3D Printed Ovaries

3D printed ovaries help infertile mice to have a healthy offspring.

Visual of Longest Lived Human Embryo in a Lab

Longest Lived Human Embryo in a Lab

Scientists keeping a human embryo alive in lab for 13 days for the first time.

Visual of Gene Therapy Cures Chronic Disease

Gene Therapy Cures Chronic Disease

Gene therapy can cure up to 200 different diseases and the list is growing.

Visual of Google Cars Can Now Sniff Out Pollution

Google Cars Can Now Sniff Out Pollution

Google cars can now measure urban air quality and collect data to create interactive maps with the most detailed views of pollution patterns ever created.

Visual of Van Mensvoort Writes a Letter to Humanity

Van Mensvoort Writes a Letter to Humanity

On the occasion of the Earth Day, 22 April 2017, philosopher Koert van Mensvoort wrote his Letter to Humanity.

Visual of HUBOT: Meet the Digital Detox Dietitian

HUBOT: Meet the Digital Detox Dietitian

As a digital detox dietitian, you know exactly how much digital technology your client needs and you give professional advice with a personal approach.

Visual of Interview Mark Wigley:

Interview Mark Wigley: "We are living in an ecology of antenna"

With the invention of the radio antenna in the late 19th century, we became a different species: Introducing the human insect. A species, able to communicate across oceans using …

Visual of Should men be able to give birth to children?

Should men be able to give birth to children?

Within a few years, it may be possible for premature babies to grow inside an artificial womb. And when that day arrives, should men be able to give birth to children? Should we …

Visual of Suzanne Lee wants to live in a world that uses only sustainable materials

Suzanne Lee wants to live in a world that uses only sustainable materials

Biotechnology is nearly as old as humanity itself. The food you eat and the pets you love? You can thank our ancestors for kickstarting the agricultural revolution, using …

Visual of Cyborg artist Moon Ribas feels earthquakes

Cyborg artist Moon Ribas feels earthquakes

Imagine waking in the night, and feeling the vibrations of an earthquake on the other side of the world pulsing through your body. This is a reality for Catalan-born artist Moon …

Visual of This exhibition explores love in the internet age

This exhibition explores love in the internet age

Data Dating is an exhibition that explores what it means to find romance in the internet age. Love it or hate it, technology has transformed the way we date. So, how are digital …

Visual of Cyborg mythologies #2: Jesus was a cyborg

Cyborg mythologies #2: Jesus was a cyborg

This is #2 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …

Visual of Evolving In Vitro with Yuval Yancovitch

Evolving In Vitro with Yuval Yancovitch

With 7.9 billion people and counting, the Food and Agricultural Organisation of the United Nations predicts that by 2050, food supply needs to grow by 70% in order to accommodate …

Visual of Exploring Next Nature (2004)

Exploring Next Nature (2004)

The first essay ever written on Next Nature, published in Next Nature Pocket and in Entry Paradise, New Design Worlds . ( download pdf ) (German version: Erkundungen im Nächste …

Visual of Next Nature Interview

Next Nature Interview

For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …

Visual of Faustian Bargains and Pineapple Shampoo

Faustian Bargains and Pineapple Shampoo

Since the early days of the net, the electronic pastoral has lent itself to all sorts of dubious agendas pushed by science, the military and even libertarian tendencies. In the …

Visual of There is not enough Africa in Computers

There is not enough Africa in Computers

Brian Eno - artist, composer, inventor, thinker - spoke to Kevin Kelly about the meaning of Africa for music and technology. "Africa is everything that something like classical …

Visual of Huggable Vending Machine

Huggable Vending Machine

Finally a vending machine that doesn't want you money, it wants hugs. Embrace it to get a free can of coke. Might give you rushes of anthropomorphobia too though. Via The Pop-Up …

Visual of Ice Cream Cones Made from Ice Cream, and Other Wikicells

Ice Cream Cones Made from Ice Cream, and Other Wikicells

Plastic is a part of the earth's ecosystem , but it's a part that no one wants. At Harvard, scientists are looking to replace single-use plastic bottles, plates, and cups with …

Visual of Rural Energy: From Kerosine to LED

Rural Energy: From Kerosine to LED

While for most of us, happy blog readers, access to electricity is taken for granted, things are quite different in developing regions of the world. In India for example, over 65% …

Visual of Cow Poower! Bacteria Turn Poo into Fuel

Cow Poower! Bacteria Turn Poo into Fuel

Farmers in the US are producing fuel and high-quality fertilizer from their cows' manure.

Visual of Sony's Smart Wig: Top or Flop?

Sony's Smart Wig: Top or Flop?

Sensors, a communication interface and an actuator for tactile feedback all hidden ina wig.

Visual of The Artificial Touch-Sensitive Hand

The Artificial Touch-Sensitive Hand

Restoring the sense of touch with an artificial hand, using a brain interface.

Visual of Retro-Futuristic Smartwatch

Retro-Futuristic Smartwatch

In 1981 the idea of what we call smartwatch was nothing more than a funny joke.

Visual of Smart Contact Lens Can Monitor Glucose

Smart Contact Lens Can Monitor Glucose

Smart contact lens project to monitor glucose.

Visual of Controlling Smart Devices with the Skin

Controlling Smart Devices with the Skin

iSkin is a flexible, stretchable and visually customizable on-body touch sensor for mobile computing.

Visual of Modafinil Boosts Your Brain

Modafinil Boosts Your Brain

A pill that makes you smarter without causing harmful side-effects? Modafinil might be this “smart-drug”.

Visual of Algorithm Tells You How to Dress

Algorithm Tells You How to Dress

What should I wear today? The answer to one of life’s big questions could came from an algorithm created to solve all your fashion problems.

Visual of Save The Humans – Submit your Quote

Save The Humans – Submit your Quote

We call upon you, dear readers, to participate in a new publication from the Next Nature Network: SAVE THE HUMANS!.

Visual of Transfigurations: Let's Design People

Transfigurations: Let's Design People

Plastic artist Agi Haines explores hypothetical scenarios for surgically implanted body enhancements in babies.

Visual of Turning Poop Back Into Food

Turning Poop Back Into Food

Nasa funded a program to turn astronauts’ poop into food.

Visual of Creating a Second Skin to Look Younger

Creating a Second Skin to Look Younger

Scientists managed to create what every woman has been dreaming of: a second skin to reduce wrinkles and tighten the skin.

Visual of Doctors Used VR to Save a Baby's Life

Doctors Used VR to Save a Baby's Life

Google Cardboard was used by a cardiologist to train for a very risky heart surgery on a four months baby.

Visual of The First Baby with Three Genetic Parents

The First Baby with Three Genetic Parents

This year, on April 6th, a baby was born with three genetic parents: two mothers and one father.

Visual of The Lightest Solar Cell Ever Made

The Lightest Solar Cell Ever Made

Researchers created solar cells as light as a soap bubble.

Visual of A Step Further in the Race Against AI

A Step Further in the Race Against AI

Today, we all have superpowers. It may not seem like it because we are attached to our physical devices to use our powers, but with a Neural Lace that may soon change.

Visual of The Modular Body

The Modular Body

The Modular Body is an online science fiction story by Floris Kaayk about the creation of OSCAR, a living organism built from human cells.

Visual of The New Way to Boost Creativity

The New Way to Boost Creativity

Danish company develops device to stimulate creativity.

Visual of Brainwaves as Password

Brainwaves as Password

Researchers have found a way to use our brainwave as a verification of our identity.

Visual of App Activates Cells That Manage Diabetes

App Activates Cells That Manage Diabetes

Scientists develop engineered cells to be implanted in patients with diabetes to regulate blood sugar levels, controlled with a smartphone app.

Visual of HUBOT: Meet the Remote Savior

HUBOT: Meet the Remote Savior

When giving first aid, all kinds of emotions are in play. Thus it is important for the victim of an accident to receive emotional assistance and to be mentally supported during an …

Visual of The New Male Birth Control

The New Male Birth Control

A new contraceptive has appeared on the horizon, bringing the prospect of an alternative form of male birth control one step closer.

Visual of Sleep and Dream Controller

Sleep and Dream Controller

Developers at Dutch-based company Arenar have designed a device that not only claims to improve the quality of sleep, but also induces lucid dreams.

Visual of The Posthuman Farm

The Posthuman Farm

Wu Tzu-ning presents a posthuman reality from genetic engineering to digital afterlife.

Visual of A Voice Mask to Protect Your Privacy

A Voice Mask to Protect Your Privacy

Introducing world's first voice mask designed to protect your privacy.

Visual of E-Skin Makes You Control Objects Without Touching Them

E-Skin Makes You Control Objects Without Touching Them

Scientists developed an e-skin that lets the wearer manipulate virtual objects without touching them, by using magnetic fields.

Visual of Edible packaging: Seaweed could replace plastic in disposable packaging

Edible packaging: Seaweed could replace plastic in disposable packaging

What to do about the plastic planet ? The seas are steadily filling up with plastic , and it's vital to find ways to address the problem . One way to do this is to move away from …

Visual of HUBOT: Meet the Shiva Therapist

HUBOT: Meet the Shiva Therapist

Meet the Shiva Therapist fro HUBOT. She massages with her own hands, but for the heavy work, she has four additional robotic arms at her disposal.

Visual of The path towards solar democracy with Marjan van Aubel

The path towards solar democracy with Marjan van Aubel

Solar cells are often considered an eyesore, used for their sustainability yet not for their beauty. Installed on roofs or in solar parks, they take up precious space. Well that’s …

Visual of Watch the BBC report on world's first artificial womb

Watch the BBC report on world's first artificial womb

Now that the team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …

Visual of POND is a symphony of lights and water

POND is a symphony of lights and water

Have you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …

Visual of How future fashion could help us cope with isolation

How future fashion could help us cope with isolation

Today we cannot meet, touch or hug our loved ones. And while we all like the feeling of the touch of another human being, physical contact does not just feel nice, it is crucial …

Visual of The new Next Nature book is here!

The new Next Nature book is here!

We live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …

Visual of This app allows you to talk to quarantined people around the world

This app allows you to talk to quarantined people around the world

Loneliness is one of the silent serial killers during the pandemic. Therefore Next Nature provides you the tip to pick up your phone.  Artists Danielle Baskin and Max Hawkin …

Visual of Blind woman sees with new implant and plays video game sent straight to her brain

Blind woman sees with new implant and plays video game sent straight to her brain

It’s been over a decade since artificial retinas first began helping the blind see. But for many people, whose blindness originates beyond the retina, the technology falls short. …

Visual of The Institute of Digital Fashion explores what's next in the industry

The Institute of Digital Fashion explores what's next in the industry

Trading animal skins for pixels, our digital selves call for a digital wardrobe. The Institute of Digital Fashion , led by CommuneEast founder Leanne Elliott Young and Digi-Gxl …

Visual of The 21th Century Paradigm

The 21th Century Paradigm

The history of art through the ages reveals a constancy that, by conscious or unconscious applications, provides us with an omnipresent correlation dealing with the …

Visual of Live a happy life!

Live a happy life!

Remember the movie Eternal Sunshine of the Spotless Mind, where Jim Carrey removes his memories of a relationship with Kate Winslet? According to researchers at the University of …

Visual of Dolphin Wannabe

Dolphin Wannabe

Same article , different example: Water Powered JetPack by Jetlev . (Thanks: Marlies Peeters)

Visual of GM Bacteria Turn Carbon Dioxide into Biofuel

GM Bacteria Turn Carbon Dioxide into Biofuel

In a twist on the classic " microbes that turn shit into petrol ", researchers at MIT have developed a bacterium that turns carbon dioxide into a direct substitute for gasoline. …

Visual of 3Doodler, a Pen for Drawing in the Air

3Doodler, a Pen for Drawing in the Air

Draw in midair with a portable 3D printer.

Visual of Get Your One Way Ticket to Mars

Get Your One Way Ticket to Mars

What to do when earth is not enough? Thousands of people, tired of their life on Earth, are ready to emigrate to Mars. Since subscriptions opened on April 22, 80,000 people have …

Visual of Moving From Password to Biometric Data

Moving From Password to Biometric Data

Unlock our devices with our fingerprint, this technology for security represents a change in our digital life.

Visual of Sticky Notes Are The

Sticky Notes Are The "New" USB Drives

The next generation of data portability.

Visual of The (Almost) Invisible Dancing Wheelchair

The (Almost) Invisible Dancing Wheelchair

Designed by a dancer, a new wheelchair moves intuitively with the user's movements.

Visual of BrainDriver: the Mind Controlled Car

BrainDriver: the Mind Controlled Car

Imagine you could drive your car using only your thoughts. It is now possible!

Visual of Hemihelix: A New Geometric Shape

Hemihelix: A New Geometric Shape

Rubber band distortions lead to discovery of a new shape called hemihelix.

Visual of Solaris: Mind-Controlled Magnets

Solaris: Mind-Controlled Magnets

Solaris gives participants the power to control a pool of magnetic fluids with their brainwaves.

Visual of Technological Suntan

Technological Suntan

Contemporary epidermal woes.

Visual of The Anthropocene Explosion

The Anthropocene Explosion

We have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.

Visual of Speculative Sensing at WDCD 2015

Speculative Sensing at WDCD 2015

On may 21st, Next Nature Network art director Hendrik-Jan Grievink  will host a workshop around the idea of Speculative Sensing: exploring the potential of senses found in nature …

Visual of The Sketchbook Made Of Artificial Skin

The Sketchbook Made Of Artificial Skin

The SkinBook is made of synthetic skin that allows beginner tattooists to practice their skills.

Visual of EcoHelmet: Foldable, Recyclable and Cheap

EcoHelmet: Foldable, Recyclable and Cheap

The new recyclable, foldable and affordable bike helmet can change city bike sharing for good.

Visual of Good Air Quality? You Get Free WiFi

Good Air Quality? You Get Free WiFi

These birdhouses in Amsterdam share free Internet whenever the air quality improves.

Visual of Traffic Lights for Smartphone Zombies

Traffic Lights for Smartphone Zombies

Ground Level Traffic Lights For Smartphone Zombies

Visual of Making King's Day More Sustainable

Making King's Day More Sustainable

On King's Day the water board of Amsterdam wants to collect urine and use it as fertilizer.

Visual of Scientists Connected a Brain to a Tablet

Scientists Connected a Brain to a Tablet

Severely paralyzed woman controls a tablet with her brain.

Visual of Air Pollution Mask for Kids

Air Pollution Mask for Kids

Danish design studio Kilo created an air pollution mask suitable for kids aged six and up.

Visual of HUBOT: Meet the Focused Assembly Worker

HUBOT: Meet the Focused Assembly Worker

As a focused assembly worker, you are a real go-getter thanks to your smart tools. Wearing smart factory goggles and using a transparent LED screen, these give you direct …

Visual of HUBOT: Meet the Exoskeleton Mover

HUBOT: Meet the Exoskeleton Mover

A job from HUBOT: as an exoskeleton mover, you wear a motorized exoskeleton suit that gives you the muscular power of a gorilla.

Visual of HUBOT: Meet the Blind Traffic Regulator

HUBOT: Meet the Blind Traffic Regulator

A visual impairment does not have to be confining and futile when it comes to traffic control. As a blind traffic regulator, you wear a haptic suit that translates the traffic …

Visual of HUBOT: Meet the Data Waiter

HUBOT: Meet the Data Waiter

As a data waiter you are working at the Tinder restaurant. Upon arrival, visitors log in with their social media account. An intelligent algorithm matches the guests based on …

Visual of HUBOT: Meet the Farm Director

HUBOT: Meet the Farm Director

Games are often played to escape a boring daily reality, but they can also teach us to take control over the land as farmers do. As a farm director you work in a gamified …

Visual of HUBOT: Meet the Supersmart Handyman

HUBOT: Meet the Supersmart Handyman

Don’t worry, a handyman doesn’t have to be a bookworm. You rather work with your hands than sitting in the library. And yet, you often need to read the manuals of the broken …

Visual of Interview: Curator Ilari Laamanen on Momentum9, the Nordic Biennial

Interview: Curator Ilari Laamanen on Momentum9, the Nordic Biennial

We recently spoke to Ilari Laamanen, to peel the outcrops of Momemtum9, and unveil the overlapping themes to the next nature philosophy.

Visual of iPhones Are Happy to See Us

iPhones Are Happy to See Us

What if you could unlock your phone by simply looking at the camera? According to Apple, this is precisely how the iPhone X will work. But how secure is it?

Visual of The age of cyborgs has arrived

The age of cyborgs has arrived

How many cyborgs did you see during your morning commute today? I would guess at least five. Did they make you nervous? Probably not; you likely didn’t even realize they were …

Visual of Next Nature Network x Border Sessions: <br> Calling for festival bloggers!

Next Nature Network x Border Sessions:
Calling for festival bloggers!

Calling all bloggers! We’d love to have you on board for the 2018 Border Sessions festival in The Hague (NL). Join our team for behind-the-scenes access to festival events. To …

Visual of HUBOT: Meet the Walker Inspector

HUBOT: Meet the Walker Inspector

While many people consider a rollator as a sign of decay, you as a rollator inspector are just part of the headway! The walker inspector measures air quality, particulate matter …

Visual of HUBOT: Meet the Street Knitter

HUBOT: Meet the Street Knitter

Bricklayer, a physically heavy occupation, becomes a lot more bearable with the street-knitting robot. The street knitter is a job from HUBOT.

Visual of Next Generation: Writing a design manifesto with Pleun Wilting

Next Generation: Writing a design manifesto with Pleun Wilting

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Oil Price Threatens Biofuel Firms

Oil Price Threatens Biofuel Firms

Economy is ecology? Technology Review writes the price of oil has dipped to levels that could be far too low for many advanced-biofuel startups to succeed, especially those that …

Visual of Scientists Extract Images Directly from Brain

Scientists Extract Images Directly from Brain

(Extracted directly from Pink Tentacle , thanks!): Researchers from Japan’s ATR Computational Neuroscience Laboratories have developed new brain analysis technology that can …

Visual of NANO Supermarket Jury Report 2012

NANO Supermarket Jury Report 2012

After the successful introduction of the NANO Supermarket in 2010 it became even more clear that the contest and the presented results produced discussions and many challenges to …

Visual of Nature through the Windshield

Nature through the Windshield

Volume magazine interviews Next Nature founder Koert van Mensvoort.

Visual of The Prefuture of Synthetic Biology

The Prefuture of Synthetic Biology

Alexandra Daisy Ginsberg discusses the promises and realities of synthetic biology.

Visual of Growing the Future of Meat

Growing the Future of Meat

Outside of the limits imposed by the edges of an animal’s body, the cells can reproduce and multiply until they exhaust the nutrients and space provided, filling petri dishes and vats to grow the future of meat.

Visual of Converting Gestures into Concrete Action

Converting Gestures into Concrete Action

Francesca Barchiesi's glove concept allows the user to translate hand gestures into images and information.

Visual of Hearing Colors

Hearing Colors

Thanks to the antenna implanted in his skull, Neil Harbisson can hear images and paint sounds.

Visual of Sharing Your Newborn's Heartbeat

Sharing Your Newborn's Heartbeat

These parents use the Apple Watch to share their newborn child's heartbeats with friends and family.

Visual of Goodbye Password, Hello Selfie!

Goodbye Password, Hello Selfie!

Companies try a new, more secure payment system using selfies.

Visual of A Virtual Counselor for Mental Health

A Virtual Counselor for Mental Health

A Facebook chatbot that offers interactive cognitive behavioral therapy. It’s called Woebot and it's your personal virtual counselor.

Visual of How will the artificial womb affect society?

How will the artificial womb affect society?

Where contraceptives such as the pill disconnect sex from reproduction, in vitro fertilisation disconnects contraception from sex, and the artificial womb would disconnect the …

Visual of Interview: Huub Ehlhardt on the evolution of products

Interview: Huub Ehlhardt on the evolution of products

"To understand why a product is the way it is today, you need to learn about its evolutionary background." Meet Huub Ehlhardt, an engineer with a PhD in product design . Huub …

Visual of Smart Ring Turns Thumb Gestures into Words and Numbers

Smart Ring Turns Thumb Gestures into Words and Numbers

From the Georgia Institute of Technology arrives FingerSound, a smart ring that recognizes thumb gestures and converts them into words and numbers.

Visual of Welcome to the CRISPR baby world—here’s what you should know

Welcome to the CRISPR baby world—here’s what you should know

Last week, the gene editing world was hit by news the equivalent of a nuclear bomb. In a video on YouTube , Dr. Jiankui He at Southern University of Science and Technology in …

Visual of How AI is reshaping electronic music

How AI is reshaping electronic music

The idea that AI can compose electronic music may sound a little off to people. It raises essential questions about creativity as a product exclusive to humans: can an AI be …

Visual of Hello, superorganism

Hello, superorganism

When I was a kid, my parents took me to the beach every summer. We’d swim in the ocean and play on our inflatable raft in the surf. When the tide was low, I’d build a sand castle …

Visual of Nadine Bongaerts: 'We’re attempting to make foie gras based on stem cells'

Nadine Bongaerts: 'We’re attempting to make foie gras based on stem cells'

Biosensors, cultivated meat and spider’s silk. For synthetic biologist and Next Nature ambassador Nadine Bongaerts, these are all advances towards a new world, where polluting …

Visual of On the prehistoric origins of modern sexuality

On the prehistoric origins of modern sexuality

Let’s talk about the most controversial of "m words"—monogamy. And let’s have this conversation with in mind its prehistoric origins. Our modern picture of prehistoric societies …

Visual of Track freshness and reduce food waste with Rui Xu

Track freshness and reduce food waste with Rui Xu

Imagine this: you wake up on a lazy Sunday morning, trudging your way to the fridge only to be welcomed with the smell of something rotting. Did the meat expire sooner than …

Visual of Next Generation: Exploring cybernetic ecologies with Marie Walker-Smith

Next Generation: Exploring cybernetic ecologies with Marie Walker-Smith

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Billionaire space race: the ultimate symbol of capitalism's obsession with growth

Billionaire space race: the ultimate symbol of capitalism's obsession with growth

Mars ain’t the kind of place to raise your kids, laments the Rocket Man in Elton John’s timeless classic. In fact, it’s cold as hell. But that doesn’t seem to worry a new …

Visual of How to control electronic devices with your mind

How to control electronic devices with your mind

Controlling devices with your mind. Unreal? Think again. Brain-computer interfaces have been changing the game in healthcare, gaming, and accessibility lately.

Visual of Call for Proposals: Designing for Next Nature

Call for Proposals: Designing for Next Nature

Nowadays, children know more corporate logo's and brands than bird or tree species. The average Western person has more worries about the instability of financial markets and …

Visual of Evolution in the Bedroom

Evolution in the Bedroom

Good morning anywhere in the world! Waking up is a problem (at least for 50% of the population). That's why alarm clocks exist; machines and devices are invented to solve …

Visual of The mobile evolution

The mobile evolution

In our NextNature event BVPS (May 2008), Kevin Kelly spoke of technology as the 7th kingdom of life : a form of evolution whithout the nasty side–effect of dying (Every object …

Visual of Blood Cells 2.0

Blood Cells 2.0

Unlike many people fear that computers will overtake humans, Ray Kurzweil states that robots will merge with humans, robots the size of cells which can do the job way more …

Visual of Razorius Gilletus – On the Origin of a Next Species

Razorius Gilletus – On the Origin of a Next Species

Is the evolution of the single bladed razor into an exorbitant five–bladed vibrating gizmo the outcome of human needs, or is there another force in play? Say hello to Razorius …

Visual of End of Life Care Machine

End of Life Care Machine

Designer, artist and engineer  Dan Chen has developed the ' End of Life Care Machine ', a machine designed to guide and comfort dying patients with a carefully scripted message. …

Visual of Time Between Emergence and Design

Time Between Emergence and Design

Previously, experiences of time emerged from nature as given – offering seasons, the rhythm of humans, plants and animals. Nowadays, people integrate nature-time, body-time, inner-time, clock-time, and global 24/7 systems-time. Human beings, in past, current and next natures, have to deal with emergence and design of time in order to survive.

Visual of Man Flies Like a Bird

Man Flies Like a Bird

Some months ago we wrote about the dream of mechanical-engineer Jarno Smeets to fly like bird . Over the last few months Jarno worked steadily to materialize his dream. Today …

Visual of Nanotech Water Bottle Harvests Water from the Air

Nanotech Water Bottle Harvests Water from the Air

The Namib desert gets less than a half an inch of rain per year, yet the stenocara beetle manages to survive in these punishing conditions. The beetle's secret lies in an array of …

Visual of 3D Print a New House in One Day

3D Print a New House in One Day

3D printers using concrete can now create complete houses from the ground-up.

Visual of Seven Future Visions on In-Vitro Meat

Seven Future Visions on In-Vitro Meat

Before we can decide if we will ever be willing to eat in-vitro, we need to explore the food culture it will bring us.

Visual of Exploring the Offline World, if It Still Exists

Exploring the Offline World, if It Still Exists

The surprising results of a year offline in the "real" world.

Visual of Killing Cancer Cells, Arcade-Style

Killing Cancer Cells, Arcade-Style

A speculative nanotech pill that lets you virtually rove your body, zapping cancer cells as you go.

Visual of What You Feel Is What You Get - Smartphone for the Blind

What You Feel Is What You Get - Smartphone for the Blind

A revolutionary new smartphone for the blind uses a completely tactile interface.

Visual of 3D Holography: the Future of Medicine

3D Holography: the Future of Medicine

A new technology aims to provide doctors with a true hologram of organs.

Visual of Electronic Skin can Detect Magnetic Fields

Electronic Skin can Detect Magnetic Fields

There is a new artificial skin technology that could give humans magnetoception in the future.

Visual of Organs Could Self-Heal with Nanoneedles

Organs Could Self-Heal with Nanoneedles

An international team of scientists used nano-sized needles in order to promote production of new blood cells.

Visual of Wasps Inspire Robotic Needle for Surgery

Wasps Inspire Robotic Needle for Surgery

The Wood-Boring Wasp inspired scientists to create a new robotic needle which will be used in brain surgery.

Visual of The Enlightenment Is Dead, Long Live the Entanglement

The Enlightenment Is Dead, Long Live the Entanglement

We humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.

Visual of Evolution Will Change the Way We Sleep

Evolution Will Change the Way We Sleep

A group of researchers is working to optimize the way we sleep, increasing our relaxation, and therefore reducing the time devoted to our naps.

Visual of Human Cloning Now Possible in China

Human Cloning Now Possible in China

Is human cloning here? Chinese scientist is ready to clone people at his ‘replication factory’.

Visual of The Idea for Lab-Grown Meat Was Born in a Prisoner-of-War Camp

The Idea for Lab-Grown Meat Was Born in a Prisoner-of-War Camp

The phone call was as unexpected as the American accent at the other end of the line. And when she hung up a few moments later, Ira van Eelen had to stop to catch her breath. More …

Visual of Robotic Pillow Breathes to Help You Sleep

Robotic Pillow Breathes to Help You Sleep

A smart, huggable bed partner, who also improves your sleep quality. Sounds great, right? Soon, you might be able to order one yourself: Somnox is a soft robotic pillow that gently breathes as you hold it.

Visual of The Future of Dating

The Future of Dating

Introducing Tinder VR: dating technology from the future.

Visual of The future of the ECO Coin

The future of the ECO Coin

How can we design a cryptocurrency for the better of humanity and ecology? In this last chapter of the crypto deep dive series , we will dissect two kinds of blockchain …

Visual of In conversation with Teresa van Dongen, biodesigner exploring natural forms of artificial light

In conversation with Teresa van Dongen, biodesigner exploring natural forms of artificial light

There was a time when flipping the switch, and seeing a glass bulb light up, was magical to anyone in the world. Today, the presence of a light switch in a room, is something …

Visual of Next Nature is hiring an army of bots

Next Nature is hiring an army of bots

As we showed with HUBOT , we can use new technologies and robotics to make our work more enjoyable, interesting and humane. Aside from our speculative jobs, a lot of robotic …

Visual of This brain-controlled exoskeleton allows a paralyzed man to walk again

This brain-controlled exoskeleton allows a paralyzed man to walk again

A breakthrough technology that responds to signals from the brain has transformed the life of a paralyzed 28-year-old man called Thibault. Four years after the initial incident …

Visual of Towards collective standpoints on the future of babymaking

Towards collective standpoints on the future of babymaking

For the closing event of Reprodutopia , a true meeting of minds took place as we discussed the social implications surrounding the future of reproductive technologies. Multiple …

Visual of Why superhuman technologies will affect us all

Why superhuman technologies will affect us all

When you look through a super-telescope, you can still see the planet Earth. Once called the blue planet, she now looks red and parched. We had no choice but to abandon her… On a …

Visual of Why I'm turning my son into a cyborg

Why I'm turning my son into a cyborg

Imagine if everyone spoke a language that you don’t understand. It’s not a foreign language–it’s been spoken around you since the day you were born–but where as everyone else …

Visual of 5 Dutch exhibitions you cannot miss this summer

5 Dutch exhibitions you cannot miss this summer

Interior based on bacteria, spaces morphing perception and the merging of man, animal and machine. These five must see exhibitions in the Netherlands explore the intersection of …

Visual of Cyborgnest: redefining human senses

Cyborgnest: redefining human senses

Nature provided humans with an extensive set of sensory modalities, allowing our brain to constantly gather sundry inputs from the outer world. These sensory inputs help us …

Visual of Screen mutations and reframing perspectives with Louisa Zahareas

Screen mutations and reframing perspectives with Louisa Zahareas

In the digital era of a globalized world, our screens have become a second set of eyes. Communication has advanced leaps and bounds, to a point where we cannot imagine a world …

Visual of Inverting the energy paradigm with Charles Eisenstein

Inverting the energy paradigm with Charles Eisenstein

Energy policy blah blah blah, life cycle analysis blah blah blah, energy return on energy invested, peak oil, carbon footprint, renewables, hydro, nuclear, blah blah blah blah …

Visual of Jurassic World scientists still haven’t learned

Jurassic World scientists still haven’t learned

Just because you can doesn’t mean you should – real-world genetic engineers can learn from the cautionary tale. “ Jurassic World: Dominion ” is hyperbolic Hollywood entertainment …

Visual of Breaking Point?

Breaking Point?

John Zerzan, published in Green Anarchy issue #24 - Spring/Summer 2007 The rapidly mounting toll of modern life is worse than we could have imagined. A metamorphosis rushes …

Visual of True Knowledge beats Google

True Knowledge beats Google

What you are looking at, is the logo of perhaps the (in idea) biggest competitor on the search-engine market. It is beta-testing right now, but its demo video looks promising. Why …

Visual of Peer-to-Peer Immigration

Peer-to-Peer Immigration

At the beginning of the computer era, many objects and experiences from everyday life were transferred to the digital environment in order to make technology understandable (think …

Visual of Voyage of the Bacteria Bots

Voyage of the Bacteria Bots

The 1966 science-fiction movie Fantastic Voyage famously imagined using a tiny ship to combat disease inside the body. With the advent of nanotechnology, researchers are inching …

Visual of Think Hello

Think Hello

Remember Asimo ? Honda has now developped a new Brain-Machine Interface technology that allows humans to control the humanoid robot simply by thinking certain thoughts. The BMI …

Visual of First man infected with computer virus

First man infected with computer virus

Doctor gets chip. Chip gets virus. Virus infects other devices... Dalek shoots doctor? Dr. Mark Gasson of Reading University implanted a RFID chip under his skin last year. It is …

Visual of Intimacy Dress

Intimacy Dress

The Intimacy dress takes our notion personal space to a next level: the closer someone approaches, the more transparent the dress becomes. As such, the garment becomes a sort of …

Visual of Next Nature Introduction

Next Nature Introduction

This project - the Next Nature Network - is about Nature's brand image. One might surmise that "Nature," being 100 percent all-natural, can't have any brand image.  The facts …

Visual of Anthropomorphobia

Anthropomorphobia

Are you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …

Visual of Morphing Cutlery

Morphing Cutlery

Imagine a world where the shapes of all objects around you would be able to change on the fly. Envision a future where nanotechnology and morphing become ubiquitous and blend in …

Visual of Goats Replace Lawnmowers in San Francisco

Goats Replace Lawnmowers in San Francisco

They might not be as fast, but goats offer several advantages over diesel-powered lawnmowers. They're quieter, they emit fewer greenhouse gases, and they fertilize soil as they go …

Visual of A Stroll Through the Bubbles of Chemicals and Men

A Stroll Through the Bubbles of Chemicals and Men

A stunning pre-history of the anthropocene

Visual of Control Your Mobile Phone or Tablet Directly from Your Brain

Control Your Mobile Phone or Tablet Directly from Your Brain

Samsung is working on a brain interface that lets you go truly hands-free with your phone.

Visual of Binary Code Able to Act Like DNA

Binary Code Able to Act Like DNA

There is a similarity between strings of binary and strands of organic DNA: they both carry actionable information encoded into reconfigurable symbols. Using nature’s biodiversity …

Visual of My Device is in the Sky

My Device is in the Sky

Truly advanced technology will be light as sunshine and indistinguishable from nature.

Visual of The Ideal Phone Might Be The noPhone

The Ideal Phone Might Be The noPhone

Your next phone could be the noPhone: a technology-free alternative to any smart mobile device.

Visual of Dynamic Exoskeleton Chair

Dynamic Exoskeleton Chair

An exoskeleton chair that allows the body to move freely.

Visual of Intelligent Bikini Tells You How to Tan

Intelligent Bikini Tells You How to Tan

Think you've had enough sun? Ask your bikini!

Visual of Interview: Suzanne Lee, Fashion Innovator Who Grows Clothing in the Laboratory

Interview: Suzanne Lee, Fashion Innovator Who Grows Clothing in the Laboratory

We recently talked with Suzanne Lee about the textile industry and technology, growing leather in the lab, and the use of new alternative materials in the future of fashion.

Visual of Ocumetrics Bionic Lenses can Triple Your Eyesight Capability

Ocumetrics Bionic Lenses can Triple Your Eyesight Capability

Dr. Garth Webb, an optometrist from British Columbia, has invented the Ocumetics Bionic Lens : lenses that after being implanted through an eight minute surgery, improve eyesight …

Visual of The Biosphere Code Manifesto

The Biosphere Code Manifesto

During the event The Biosphere Code, Stockholm University researcher Victor Galaz and colleagues outlined a manifesto for algorithms in the environment.

Visual of How Is Hi-Tech Changing Sports?

How Is Hi-Tech Changing Sports?

Hitech is changing sports, but what are the consequences?

Visual of Turning Contact Lenses into Screens

Turning Contact Lenses into Screens

A polymer film coating can turn contact lenses into computer screens.

Visual of Fellow Day: Next Senses

Fellow Day: Next Senses

On June 17th a NNN Fellow Day was organized to explore the future project: Next Senses.

Visual of Using Nanobots to Treat Depression

Using Nanobots to Treat Depression

A team of scientists has developed a way to deliver drugs into our body using nanobots as vehicles and our toughts as controllers.

Visual of Will We Share .thought Files?

Will We Share .thought Files?

With the evolving technique called EEG, electroencephalography, we can measure brain activity and ultimately even read the brain.

Visual of Storing Knowledge for Eternity

Storing Knowledge for Eternity

Researchers discovered a way to store data in five dimensions on a nano structured glass able to survive for billion of years.

Visual of Designer babies: the kids of the future?

Designer babies: the kids of the future?

What if you had the choice of sparing your child from diseases and disorders such as Alzheimer’s disease, heart disease or autism?

Visual of Helix, the App Store for Your Genome

Helix, the App Store for Your Genome

Startup Helix launched an online hub where you can digitally explore your genetic code by downloading different apps on your computer or smartphone.

Visual of Robotization Makes Work More Human

Robotization Makes Work More Human

Imagine being 16 and studying for a job that soon won't exist. What kind of future is that? New occupations will come thanks to robotization.

Visual of Bacteria Are the New Hard Drives

Bacteria Are the New Hard Drives

DNA is the densest known storage medium in the universe - and Harvard University researchers have managed to use it to store GIFs inside bacteria.

Visual of Gamers are the new athletes: Sports in video games from Pong to VR

Gamers are the new athletes: Sports in video games from Pong to VR

Sports have always had an important place in human societies, providing entertainment, exercise, and a demonstration of the exceptional things the human body can achieve. But in a …

Visual of Next hospitals: How virtual reality is shaping the future of medicine

Next hospitals: How virtual reality is shaping the future of medicine

And it’s already showing incredible results. VR transports us to faraway worlds without even asking us to leave our chairs. Yet we usually hear about it in the context of video …

Visual of Robo Wunderkind is a modular robot even a five-year-old can program

Robo Wunderkind is a modular robot even a five-year-old can program

Meet the Robo Wunderkind, a new breed of smart toys that introduces children to the basics of coding and robotics in a playful way. Advanced technologies are increasingly embedded …

Visual of Artificial bones for the natural meat experience

Artificial bones for the natural meat experience

The world is developing, climate change is happening and it's time for us to do something. Now. One strategy would be to simply stop eating meat — or at least reduce the amount of …

Visual of Next Nature went to China!

Next Nature went to China!

We are proud to invite you to our largest showcase (so far), currently on display at OCT Art & Design in Shenzhen, China. Spanning across three floors, with a total surface of …

Visual of In conversation with cyborg musician Kai Landre

In conversation with cyborg musician Kai Landre

What does the merge of bodies and technology mean for the human? For cyborg Kai Landre, cybernetic extensions become body parts and not technology. Kai began his transition to a …

Visual of Welcome to new Evoluon

Welcome to new Evoluon

Today our human impact on Earth is humongous. Climate change, plastic oceans, mass urbanization and deforestation. Scientist recently calculated the technosphere now outweighs the …

Visual of Next Generation: Sensing the critical zone with Menno Brouwer

Next Generation: Sensing the critical zone with Menno Brouwer

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of Next Generation: Launching the Eva Biodesign Lab with Carlos Silveira

Next Generation: Launching the Eva Biodesign Lab with Carlos Silveira

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Artist refuses photography prize after admitting his image was AI-generated

Artist refuses photography prize after admitting his image was AI-generated

A German artist refused a photography prize after admitting his image was AI-generated.

Visual of How to calculate your biological age

How to calculate your biological age

Computational Biologist Jing-Dong (Jackie) Han and her team uncovered a technology to interpret signs of biological aging directly from facial characteristics.

Visual of Designing for Next Nature (workshop report)

Designing for Next Nature (workshop report)

The extent to which new technologies are intervening with everyday life can hardly be underestimated. Virtual realities, nano- and biotechnology are increasingly providing new …

Visual of Do you

Do you "MIND"?

NeuroSky (founded in 2004) innovator in "wearable" bio-sensor/signal processing systems and SEGA TOYS are developing mind-controlled computer games and next generation consumer …

Visual of Magical Interaction

Magical Interaction

Man's ability to control illumination is magical in itself but is seldom experienced as such because light switches are purely functional and generally don't stir up imagination. …

Visual of Philips Vibe Emotion Sensor

Philips Vibe Emotion Sensor

The VIBE - emotional sensing necklace combines conductive ink and textile sensors. The necklace can read multiple biometric signals of the wearer and communicates them to other …

Visual of Biomechanical Energy Harvesting

Biomechanical Energy Harvesting

Let's face it: every time your cellphone battery runs empty you feel amputated and you quickly run back to your house to connect to a powering-adapter. Bionic Power Inc. is now …

Visual of Gel Remote

Gel Remote

Human-product relationships increasingly play out in a realm which was previously considered exclusive for human-human and human-animal relationships. Panasonic now redesigned one …

Visual of The Breathe Table - Visceral Interaction

The Breathe Table - Visceral Interaction

Now why is that girl so excitingly staring at a few blurry blobs on a flat screen? Is it because these blobs are connected to her breath... What? Yes that is right, you are …

Visual of A plate that regulates the speed of eating

A plate that regulates the speed of eating

Many people tend to eat too fast. As a result they do not receive signals from the stomach that they are in fact full. The result can be overeating and obesity . To encounter …

Visual of No Signal

No Signal

As technology evolves, people are more and more depending on it to function properly. But the nature of technology is that it needs networks, sources, software, batteries and …

Visual of Go forth, Buy a Smartphone and Reproduce Thyself

Go forth, Buy a Smartphone and Reproduce Thyself

It took some years of evolution to turn sex (between different sexes) from a stricly functional activity attuned to reproduction, into the recreational activity it is primarily …

Visual of Next Nature Movie #1: Quest for Fire

Next Nature Movie #1: Quest for Fire

The Quest for Fire (1981) shows the Next Nature of 80.000 BC. Set in a world without highways, supermarkets, airports, Internet, television, farming, money or written language, …

Visual of Next Nature Movie #6: The Matrix

Next Nature Movie #6: The Matrix

In the last few decades there have been numerous films that take the struggle between mankind and its increasingly intelligent and autonomous technology as a leitmotif. Ranging …

Visual of The Footsticker

The Footsticker

There are many advantages of bare feet sporting: better motion control, more feeling in your feet and direct floor contact, etc. In this way you are more grounded and more aware …

Visual of Amber Case: We are all Cyborgs Now

Amber Case: We are all Cyborgs Now

Technology is evolving us, says cyborg anthropologist Amber Case in her 8 minutes of TED . We become a screen-staring, button-clicking new version of homo sapiens, relying on …

Visual of Back to the Tribe

Back to the Tribe

Traditionally, technology is seen as a force that diminishes our instincts and puts us at a distance of nature. Increasingly however, we realize technology can also energize and …

Visual of Catalytic Clothing

Catalytic Clothing

Catalytic Clothing is a fashionably calm technology that aims to tackle air pollution by embedding a substance in the clothing that purifies air when you wear it. The purifying …

Visual of Flap to Freedom

Flap to Freedom

It works like this. Position yourself with a friend in front of a battery hen and flap your arms as fast as you can when the music sets in. The harder you flap the faster your …

Visual of Humanthesizer

Humanthesizer

The human body as an instrument is a cool example of how culture and nature are merging. Calvin Harris used a giant human synthesizer to perform his single. The material used is …

Visual of Living Life Support

Living Life Support

Designer Revital Cohen imagines a future where life-support machines are replaced with life-support animals. In this scenario, a transgenic lamb is allowed to frolic in the fields …

Visual of Robot Guide Dog

Robot Guide Dog

#! Possibly the answer for blind people with cynophobia, the fear of dogs. This robot guide dog is stil a bit slow compared to the old nature version, but as technology advances …

Visual of Bacteria

Bacteria "R" Us

There is a domain of creatures that diffusively encircles an entire planet. There are so many of them that they occupy every conceivable ecological niche. Yet, despite their …

Visual of Little Green Cows

Little Green Cows

The world is alight with algae fever. In this age of deep ecological design aspirations, the range of speculative design projects based on algae technology is growing. Algae are …

Visual of Macbook Pro Fragrance

Macbook Pro Fragrance

Nothing beats the factory-scent of expensive, freshly unboxed technology! Artist group Greatest Hits produced the Apple Unboxing Scent for use at an exhibition in Melbourne, where …

Visual of Nano Product: Nansense

Nano Product: Nansense

For years, people have relied on harsh drugs and irritating alarms to control when they sleep and when they wake. Now, the Nansense wristwatch offers an all-natural way to …

Visual of NANO Product: The Necklace

NANO Product: The Necklace

Breast cancer is a disease that comes with feelings of helplessness and loneliness. This nanotechnological necklace allows you to regain some control regarding your disease, in …

Visual of Nanotech Bracelet Detects Allergies

Nanotech Bracelet Detects Allergies

Designed by Luc de Smet, Awear is a speculative bracelet that can detect and record the sources of allergies for children in uncontrolled environments, such as schools and …

Visual of That Website Smells!

That Website Smells!

Do you ever miss being able to smell the woods in an online travel journal? The odor of a new leather jacket in an online shop? Or perhaps you just couldn’t find the words in an …

Visual of The Ecological Human

The Ecological Human

The nature of humanity in the twenty-first century is, according to sociologist Steve Fuller, a ‘bipolar disorder’ beset with dualisms of identification such as divine/animal, …

Visual of Clothes that Turn Heat into Electricity

Clothes that Turn Heat into Electricity

With rising energy costs and our growing arsenal of iPads, smart phones, and wearable monitors, we're always on the lookout for new ways to power our devices.  Perpetua Power , an …

Visual of Bionic Eye: Limited Vision to the Blind

Bionic Eye: Limited Vision to the Blind

A new implant lets blind people see letters, crosswalks and people.

Visual of Food Simulator to Fulfill the Desire to Eat

Food Simulator to Fulfill the Desire to Eat

Two master's students have created a speculative device to simulate the sensations of eating.

Visual of Free Solar Chargers in the Streets of NY

Free Solar Chargers in the Streets of NY

Solar chargers for everyday emergencies.

Visual of Robots Cooperate to Save Coral Reefs

Robots Cooperate to Save Coral Reefs

Robots use swarm intelligence to rebuild coral reefs.

Visual of Smart Sock Makes Your Feet Speak

Smart Sock Makes Your Feet Speak

A new wearable device provides runners with info on posture, rhythm and stride length.

Visual of The Brain Is as Complex as All the World's Digital Data

The Brain Is as Complex as All the World's Digital Data

With advances in genomics, imaging and other technology,scientists have to face the age of big data.

Visual of Transfer a Loving Tap Via Bluetooth

Transfer a Loving Tap Via Bluetooth

A bracelet able to transfer a touch between two people.

Visual of World's First In Vitro Hamburger Arrives

World's First In Vitro Hamburger Arrives

Break out the ketchup: Mark Post has grown the world's first entirely artificial burger from cultured beef cells.

Visual of Human Workers Get Increasingly Obsolete

Human Workers Get Increasingly Obsolete

Robots are coming to replace humans at work, are they a real threat to the world’s unemployed?

Visual of Interview: Chloé Rutzerveld, Designer Who Wants to Grow Healthy 3D Printed Food

Interview: Chloé Rutzerveld, Designer Who Wants to Grow Healthy 3D Printed Food

Food and Concept designer, Chloé Rutzerveld, explains her 3D food printing project Edible Growth.

Visual of Learning Circuits While Playing With Clay

Learning Circuits While Playing With Clay

Kids learn the basics of electric circuits while playing with clay.

Visual of Need to Unplug? There is an App for that

Need to Unplug? There is an App for that

At times it seems we serve our technology as much as it serves us. The OFFTIME App wants to save us from our own devices.

Visual of Professions Of The Future

Professions Of The Future

As technology evolves, what today seems like science fiction may be the job market of tomorrow: 11 professions of the future.

Visual of Super Computer Chips

Super Computer Chips

Indium gallium arsenide couldbe the material of the new super computer chips of the future.

Visual of The Robotic 3D Printed Spider Dress

The Robotic 3D Printed Spider Dress

The Spider Dress is programmed to define and protect the personal space of the wearer.

Visual of What Is This Strange Device?

What Is This Strange Device?

Kids try to figure out what the "prehistoric" Walkman is and how it works.

Visual of Analogue vs Digital: Self-Driving Cars

Analogue vs Digital: Self-Driving Cars

The image on the left is a car, as we know them. It has a lot of digital technology in it already, but not nearly as much as the other one.

Visual of Analogue vs Digital: Still Antisocial

Analogue vs Digital: Still Antisocial

Some modern thinkers argue that new technology is making us antisocial.

Visual of Anthropo-scene #9: Sense, Sensors, Sensitivity

Anthropo-scene #9: Sense, Sensors, Sensitivity

Technology helps us understand the unfolding of the Anthropocene.

Visual of Drugs Testing with Artificial Organs

Drugs Testing with Artificial Organs

Researchers are working on artificial organs-on-chips will be used for drug development.

Visual of GM Pigs for Animal-to-Human Organ Transplant

GM Pigs for Animal-to-Human Organ Transplant

Scientists have been trying to develop GM pigs that could be used to solve the shortage of organs for transplant patients.

Visual of Harvard Creates Half-Man Cyborg Flesh

Harvard Creates Half-Man Cyborg Flesh

Bioengineers at Harvard University have created the first cyborg tissue.

Visual of Heart Tissue Grown with Spider Silk

Heart Tissue Grown with Spider Silk

It might be possible to grow a new heart in labs using spider silk.

Visual of Let Your Drone Mow Your Lawn

Let Your Drone Mow Your Lawn

If you do not want to slave away under the sun, pushing a bulky mower around, drones can do it for you.

Visual of Mini's Augmented Reality Driving Goggles

Mini's Augmented Reality Driving Goggles

The popular car brand is working on augmented reality goggles that enhance the driving experience.

Visual of Modern Times Emergency Kit

Modern Times Emergency Kit

In these modern times a traditional first aid kit won't do anymore. As the world around us innovates, our needs in case of an emergency change as well.

Visual of Order Anything with Amazon's Button

Order Anything with Amazon's Button

Amazon introduced a new gadget, named Dash Button, that will help you order groceries automatically.

Visual of If a Robot Buys XTC on the Dark Web, Who is Responsible?

If a Robot Buys XTC on the Dark Web, Who is Responsible?

The Random Darknet Shopper, with bitcoin to burn, has purchased counterfeit jeans, master keys, dodgy cigs and even a bag of ecstasy tablets. Who is legally liable?

Visual of The Risk of Technological Unemployment

The Risk of Technological Unemployment

Stephen Hawking gives his opinion on what technological unemployment, aka machines taking over our jobs, can represent for future human societies.

Visual of Wearable Device For Tomato Lovers

Wearable Device For Tomato Lovers

The Wearable Tomato Project consists in a robot that dispenses tomatoes.

Visual of Cellphones Go Feral

Cellphones Go Feral

After reports of Samsung phones causing serious damage, plane delays and even hospitalization, the company made a first recall. However, the new phones were still bursting into flames.

Visual of But will lab-grown meat be kosher?

But will lab-grown meat be kosher?

Read Benjamin Aldes Wurgaft's essay on judaism in relation to the production of laboratory-grown meat.

Visual of Interview: Leanne Wijnsma, Designer for the Instinct Who Uses Smell as Medium

Interview: Leanne Wijnsma, Designer for the Instinct Who Uses Smell as Medium

Dutch experience designer Leanne Wijnsma designs for the human instinct and puts the sense of smell back to where it belongs, as modern hazards have shifted to the digital realm.

Visual of Israeli Tech Turns Any Road Electric

Israeli Tech Turns Any Road Electric

ElectRoad developed a unique technology that powers the vehicle wirelessly from the road while driving.

Visual of Medical Practice Aided by Robots

Medical Practice Aided by Robots

Robots in health care could lead to a doctorless hospital.

Visual of A Robot to Help The Refugee Crisis

A Robot to Help The Refugee Crisis

In the last months we've been witnessing a refugee crisis of huge proportions. More than a million people crossed the sea to flee violence in Africa and the Middle-East. Together …

Visual of This Robot Takes Care of Your Children

This Robot Takes Care of Your Children

This robot nanny is designed to take on adult responsibilities, raising concerns regarding the consequences of using robots to raise our children.

Visual of A Smart Top to Correct Body Posture

A Smart Top to Correct Body Posture

FysioPal is a smart top made to support and enhance the upper-body and posture.

Visual of A System that Predicts Crime

A System that Predicts Crime

An experiment tries to prevent crime by identifying aggressive behavior with new surveillance technology before actual violence is used.

Visual of Web Training Collar

Web Training Collar

Jasper van Loenen developed a wearable that sends a corrective electrostatic shock to its wearer when visiting an unprotected website.

Visual of The World's First Cyborg Olympics

The World's First Cyborg Olympics

The first cyborg Olympics will take place in Zurich in October.

Visual of Make the World Your Office

Make the World Your Office

Imagine being able to enter your office through a digital representation of reality. It sounds crazy, but it’s possible with augmented and virtual reality.

Visual of Your Smartphone Is Your New Eye Doctor

Your Smartphone Is Your New Eye Doctor

The EyeQue personal vision tracker is a smartphone app that allows you to test your eyes from the comfort of your couch.

Visual of Your Next Nature guide to Dutch Design Week 2018

Your Next Nature guide to Dutch Design Week 2018

Over time, our bodies, our food and our environment have become more and more subject to design. As designers, we hold the responsibility and have the unique chance to envision …

Visual of Ermi van Oers wants to bring  living light to your living room

Ermi van Oers wants to bring living light to your living room

The Living Light harnesses plant energy to provide light. We spoke to its designer, Ermi van Oers, to find out more about the unique product.

Visual of Three scenarios for the future of farming

Three scenarios for the future of farming

Agriculture may be one of the oldest of our technologies. Over time it has developed, changed, revolutionized, industrialized - or simply put, it has evolved . Today’s farms are …

Visual of A happy birth day to Louise Brown

A happy birth day to Louise Brown

Dear Louise Brown, On behalf of the future I would like to congratulate you on your birthday. It has been 40 years that you where born into this world on July 25th 1978, …

Visual of How a museum encourages its visitors to examine their relationship with their environment

How a museum encourages its visitors to examine their relationship with their environment

Last month I had the opportunity to immerse myself in Tokyo’s newly opened digital art landscape, the Mori Digital Art Museum. The museum stands out for it enables virtual …

Visual of Your next doctor might just be a robot

Your next doctor might just be a robot

Conventional wisdom says that you can’t replace the human touch in terms of medical care, but in our rapidly changing technological environment, it appears that this perception …

Visual of Next Nature Gift Guide 2018

Next Nature Gift Guide 2018

The season of giving has come and to make sure you can find the perfect gift for your loved ones we have brought together a collection of Next Nature inspired goodies. Whether you …

Visual of 3D-printing food waste into tasty products

3D-printing food waste into tasty products

Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …

Visual of Here’s what manufacturing enhanced with virtual reality will look like

Here’s what manufacturing enhanced with virtual reality will look like

Robots are coming for our jobs. Virtual reality is coming to make the jobs that remain easier to accomplish. All of the world’s manufacturing sectors are in the process of …

Visual of In conversation with Jalila Essaïdi

In conversation with Jalila Essaïdi

What do in-vitro human skin, spider silk and cow manure have in common? They are all unlikely materials that can cloth, protect and inspire humans, as realized by award-winning …

Visual of Maurizio Montalti talks about the cycle of life

Maurizio Montalti talks about the cycle of life

As modern humans, we are out of balance with our natural environment. With use of technology, we try to prolong our human lifespan and create materials that live longer than we …

Visual of 3 future farms that can feed the planet and heal it too

3 future farms that can feed the planet and heal it too

Intensive agriculture may be nourishing most of the Earth’s inhabitants, but it’s doing the opposite to earth itself. Its dependence on singular crops, heavy ploughing machinery, …

Visual of Our Next Nature Future Lab plan received funding

Our Next Nature Future Lab plan received funding

Hooray! This just in: Next Nature Network is granted a significant contribution from the Dutch government intended to develop a Future Lab for design & technology in Eindhoven …

Visual of Design your Self!

Design your Self!

Who are you, who do you want to be, and what do you need to do to get there? We are constantly pushed to lead the perfect life. The media present us with a picture of an existence …

Visual of Can AI become addicted?

Can AI become addicted?

In 1953, a Harvard psychologist thought he discovered pleasure – accidentally – within the cranium of a rat. With an electrode inserted into a specific area of its brain, the rat …

Visual of Next Generation: Exploring non-binary futures with Lena Kuzmich

Next Generation: Exploring non-binary futures with Lena Kuzmich

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of That modernist dream of the house as butler is not going to happen

That modernist dream of the house as butler is not going to happen

Looking at evolution, we see that there’s always a next nature. Nature changes along with us. How will that influence our way of life in the future?

Visual of The sense of privacy

The sense of privacy

Humans’ natural sense of privacy helps them regulate the boundaries of public and private, but fail when trying to identify privacy risks in the online world.

Visual of How WhatsApp voice memos help Senegal's farmers

How WhatsApp voice memos help Senegal's farmers

Within the digital realms of our smartphones, WhatsApp groups cater to diverse intents: exchanging witty dad jokes, soliciting style counsel ahead of night-outs with friends, or …

Visual of How to design your future family

How to design your future family

Imagine a place called Reprodutopia. How would such a place look like?

Visual of The fantastical living landscapes of AUSGANG Studio

The fantastical living landscapes of AUSGANG Studio

AUSGANG Studio combines art, technology, and living materials to tell stories of our world's trajectories.

Visual of The World is not a Desktop

The World is not a Desktop

Mark Weiser (originally written for ACM Interactions ). What is the metaphor for the computer of the future? The intelligent agent? The television (multimedia)? The 3-D graphics …

Visual of Interview with a cyborg

Interview with a cyborg

Erich Berger has a 96 year old grandmother who is a cyborg. She features dentures, hearing aids, glasses, pace maker, a metal implant on the pinkie toe, and more. Quotes from the …

Visual of Switch Critters - Can you make them switch?

Switch Critters - Can you make them switch?

Earlier we discussed the Magical Interaction project, in which Joris van Gelder rethought the boring activity of switching on/off a light by transforming it into a magical …

Visual of Future playground

Future playground

Shot taken before the robot in question short-circuited and started to kill all humans in sight.

Visual of Google tracks flue spread via sick searchers

Google tracks flue spread via sick searchers

This Tuesday, search giant Google released an experimental tool that tracks the intensity and movement of the influenza virus across the United States by monitoring the number of …

Visual of Human genome sequencing soon child play?

Human genome sequencing soon child play?

Starting next spring, a complete human-genome sequence can be ordered the Californian startup Complete Genomics for just $5,000, Techreview reports. Currently sequencing still …

Visual of Luxalive - The emotionally aware lamp

Luxalive - The emotionally aware lamp

So you thought that animated Pixar Lamp from the movies was just a fantasy? Not anymore. Luxalive is a prototype of an reading lamp that moves according to the character of its …

Visual of Remote pets

Remote pets

Humans have domesticated animals for thousands of years. The earliest known evidence of a domesticated dog is a jawbone found in a cave in Iraq and dated to about 12,000 years ago …

Visual of A robot that controls your remote controls

A robot that controls your remote controls

Confused with the pile of remote controls in your house? Now here is an idea: get a robot to control them. Researchers at Toshiba have developed a talking robot, named ApriPoko, …

Visual of Eyeborg

Eyeborg

The Eyeborg Project is the work of Rob Spence, a 36 year old filmmaker residing in Toronto, Canada and Kosta Grammatis – an unemployed engineer from San Francisco, California. …

Visual of Fresh from the Pharm

Fresh from the Pharm

Will we in the future still buy several needs according food in shops, or will we grow M&M’s ourselves? There is a lot happening on in the field of food technology , think for …

Visual of Green Vibes

Green Vibes

The big lobby to endeavor for a climate neutral lifestyle must have reached its peak. It is common knowledge that recycling electronic and battery operated utensils is better for …

Visual of How biotech will drive our evolution

How biotech will drive our evolution

Are you ready for some techno-optimism? Buckle up and enjoy the ride with bio-tech evangelist Gregory Stock . Some quotes from his prophetic TED talk : "We are seizing control of …

Visual of Monitoring your computer's activity like a frog pond

Monitoring your computer's activity like a frog pond

Multi-touch designer and developer Richard Monson-Haefel considers sound as an important part of our user interfaces. As an application of " Calm Technology " which revolves …

Visual of Mud Tub

Mud Tub

Mud tub is an experimental tangible interface that allows people to control a computer while playing in the mud. By sloshing, squishing, pulling, punching, etc, in a tub of mud …

Visual of Nanoparticles in Sunscreen Damage Microbes

Nanoparticles in Sunscreen Damage Microbes

Nanotechnology has been hailed for its benefits because of the potential ability to create drugs that could cure cancer and radiation poisoning, make miniature pollutant filters …

Visual of Space Monkey

Space Monkey

During the 1960s, monkeys were sent into outer space as part of the US space exploration program. But they didn’t all return, until now. Via scaryideas.com | Related: WWF

Visual of Squamata headset dances with the Music

Squamata headset dances with the Music

Inspired by body language of animals (in particular squamates and porcupines), designer Jop Japenga created a headphone with an adaptive skin that responds to the music played on …

Visual of Babel Fish

Babel Fish

Researchers are working on a language and a device that will help humans and dolphins talk with each other. Denise Herzing , a researcher and founder of the Wild Dolphin Project …

Visual of Brainscan App

Brainscan App

By hooking up a commercially available EEG headset to a Nokia N900 smartphone, Jakob Eg Larsen and colleagues at the Technical University of Denmark in Kongens Lyngby have created …

Visual of It's a plane!

It's a plane!

By nature, man is not meant to fly. But while we're at it, we may as well turn it into an experience . Charles Champion, Airbus Executive Vice President Engineering, envisions a …

Visual of Kitten Ears – Blushing 2.0

Kitten Ears – Blushing 2.0

Always wanted a pair of kitten ears to express your feelings to the world? Well, you probably never thought of that – as you have to be a Japanese genius to come up with such an …

Visual of Nano Skin Prosthetics

Nano Skin Prosthetics

Nano-skin may let amputees feel again.

Visual of Remote Kissing Device

Remote Kissing Device

Nobuhiru Takahashi, student at the Kajimoto Laboratory of the University of Electro-Communications in Chofu City, Tokyo, invented this Internet French kissing device. When a …

Visual of Robo-teacher

Robo-teacher

Say hello to teacher Engkey ! The city of Daegu — South Korea, introduced 29 robot teachers in 19 elementary schools as part of a large scale project to robotize teaching. The …

Visual of Rule #3: Keep it ASS: Abstract, Simple and Subtle

Rule #3: Keep it ASS: Abstract, Simple and Subtle

For past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design,  click here.   Making good use of anthropomorphism isn’t easy. As you’ve probably …

Visual of Unboxing Artificial Intelligence

Unboxing Artificial Intelligence

Did you know that phones were once used for calling up our (human) friends? Researching the beginning of it all, we came accross demo video's on the cloud called "internet" where …

Visual of Braille 2.0

Braille 2.0

Text for blind people using the Braille alphabet has been around for some time. But instead of making separate books for the visually impaired, why not change the way we all read? …

Visual of Four Objections to Lab-Grown Meat

Four Objections to Lab-Grown Meat

In vitro meat has been billed as a way to  end animal suffering , put a stop to global warming , and solve the world's insatiable demand for animal protein. There's no doubt that …

Visual of Let the Robotic Farmers feed the World

Let the Robotic Farmers feed the World

The future of farming is not to be found in further mass-industrialization nor in the return to traditional farming with man and horse power, but rather in swarms of smart, cheap robotic farmers that patiently seed, tend and harvest fields one plant at a time without the need for damaging pesticides.

Visual of Lucy McRay - Swallowable Parfum

Lucy McRay - Swallowable Parfum

Know garlic? Now imagine we could make something that functions alike, but smells a lot better. That's what Swallowable parfum is about.

Visual of Raise Crops on the Moon with Plant-Growing Jelly

Raise Crops on the Moon with Plant-Growing Jelly

In dry areas like the desert, on mountain tops or on the moon it’s impossible to grow anything. Or is it? A rain in the desert sparks extreme plant growth from the moment the …

Visual of Thirsty? With a Cyborg Bladder, You'll Never Need to Drink

Thirsty? With a Cyborg Bladder, You'll Never Need to Drink

Some desert animals, like the kangaroo rat, get through their lives without needing to drink even a drop of water. Now, a Japanese design company aims to make humans just as …

Visual of “Soccket” Ball Generates Free Electricity

“Soccket” Ball Generates Free Electricity

It looks like a normal soccer ball, but Soccket has a secret: a hole for a charging cable. Designed by two Harvard students, the ball has a pendulum-like mechanism inside that …

Visual of A Lifetime of Questions through Google

A Lifetime of Questions through Google

Google becomes the authority on existential questions about aging.

Visual of Bright Streetlights Make Us No Safer, and Why That's Good News

Bright Streetlights Make Us No Safer, and Why That's Good News

Artificial lighting at night makes us fat, depressed and sick. What are the alternatives?

Visual of Bye Bye Barbed Wire: Cow-Mounted GPS Will Enable

Bye Bye Barbed Wire: Cow-Mounted GPS Will Enable "Virtual Fencing"

A device that remotely controls cattle's movements promises to transform the American landscape.

Visual of Care for a Meat Flower Amuse?

Care for a Meat Flower Amuse?

Vegetarian food products typically mimic existing meat products. The meat flower reverses this principle.

Visual of Pick Pig - Name Pig - Love Pig - Eat Pig

Pick Pig - Name Pig - Love Pig - Eat Pig

In a time of all-horse hamburgers and E. coli outbreaks, food provenance has become a huge issue. Consumers are becoming increasingly aware of the lack of traceability within the …

Visual of Did Booze Make Us Modern?

Did Booze Make Us Modern?

A psychiatrist argues that beer gave us civilization - but do intoxicants play a deeper evolutionary role than that?

Visual of EcoBot III: a Robot that Produces Energy Fueled by Organic Matter

EcoBot III: a Robot that Produces Energy Fueled by Organic Matter

There are robots that look like people, and then there are robots, like the Ecobot III, that look nothing like humans but have our same biological needs: they have to eat, digest …

Visual of Implantable Microchip Controls Appetite

Implantable Microchip Controls Appetite

By attaching to the vagus nerve, a chip can contribute to "natural" weight-loss.

Visual of Interview: Jason Silva, Media Artist and Curator of Awe-Inspiring Ideas

Interview: Jason Silva, Media Artist and Curator of Awe-Inspiring Ideas

Media artist, filmmaker and wonderjunkie Jason Silva talks about technological evolution and why humans are gods with anuses.

Visual of Invisible Headphone Implants

Invisible Headphone Implants

Invisible ear implants for listening to music, getting directions, and recording conversation.

Visual of Why Meat Grown in Labs is the Next Logical Step for Food Production

Why Meat Grown in Labs is the Next Logical Step for Food Production

Lab grown meat is part of the trajectory that agricultural technology is already following.

Visual of Q&A with CEO of In Vitro Meat Company

Q&A with CEO of In Vitro Meat Company "Modern Meadow"

Excerpts from the Rebbit AMA with Andras Forgacs, founder of a company that manufactures in vitro meat.

Visual of

"Responsive Typography" Tracks Your Location to Automatically Resize Text

A new website changes the text's font size depending on your distance from the computer.

Visual of

"Soylent" Liquid Meals Will Save the World

Can a meal replacer save us money, time, and maybe even save the world?

Visual of Treating Mental Illness with Video Games

Treating Mental Illness with Video Games

Neurofeedback shows promises in treating a range of mental ailments.

Visual of Use a Touchscreen Without Touching it

Use a Touchscreen Without Touching it

UltraHaptics is a system for creating haptic feedback in mid-air, offering new kind of interactions with our touchscreens.

Visual of A Jewel That Stops You From Checking Your Phone

A Jewel That Stops You From Checking Your Phone

For every smartphone user to recognize, is that merely the lighting of your screen, a vibration or ring distracts you from almost every activity. Even when you are spending time …

Visual of BAT Flies High in the Sky to Make Energy

BAT Flies High in the Sky to Make Energy

Buoyant Airborne Turbine is a giant high altitude wind turbine that brings low cost energy to remote areas and off-grid sites.

Visual of Bionic Hand with Real Sense of Touch

Bionic Hand with Real Sense of Touch

LifeHand 2: a prosthetic hand that infers the ability to feel rudimentary shapes and forms by touch.

Visual of Cat-like Sensitive Whiskers for Robots

Cat-like Sensitive Whiskers for Robots

Electronic whiskers put sensitive catlike sensors on robots.

Visual of Plastic Pollution Solution

Plastic Pollution Solution

Is there a possibility to clean up the oceans from plastic pollution?

Visual of Printing with Grass

Printing with Grass

This 3D Grass Printer can print a garden in any shape you can imagine

Visual of Razorius Gilletus Flexball Subspecies

Razorius Gilletus Flexball Subspecies

The latest subspecies in the Razorius line is the Razorius Gilletus Flexball. While Gillete proclaims they reinvented shaving, others argue Gillette's new razor is everything that's wrong with America.

Visual of Razorius Gilletus Gold Plastic

Razorius Gilletus Gold Plastic

Like the exorbitant feathers of the peacock, which only function is to aesthetically stand out amid its competitors, this new species of Razorius Gilletus only differs from its predecessor aesthetically.

Visual of Recovering Phosphorus from Wastewater

Recovering Phosphorus from Wastewater

Researchers found a technology that allows to recover valuable substances from wastewater.

Visual of Remote Surgery

Remote Surgery

Remote surgery is the new step towards robotic surgeons.

Visual of Smart Tags Change Color as Food Spoils

Smart Tags Change Color as Food Spoils

Smart Tags stick to containers of food and change color when something has expired.

Visual of The First 3D Printed Canal House

The First 3D Printed Canal House

The first 3D printed house is a recognisable and attractive Dutch Canal House, an exhibition and building site in the heart of Amsterdam.

Visual of The Power Amplification Robot

The Power Amplification Robot

Power Loader: the power amplification exoskeleton robot.

Visual of Wearable Antenna for Health Monitoring

Wearable Antenna for Health Monitoring

Wearable multifunctional antenna made of silver nano wires to monitor recovering people.

Visual of 3D Printed Eyes with WiFi Connection

3D Printed Eyes with WiFi Connection

Italian research studio is working on EYE: a 3D bioprinted sight augmentation.

Visual of 3D Printed Fish Remove Toxins and Deliver Drugs

3D Printed Fish Remove Toxins and Deliver Drugs

Researchers from UC San Diego announced that they have developed 3D print tiny microrobots in the shape of fish able to detect and remove toxin from liquid.

Visual of Analogue vs Digital: Handwriting

Analogue vs Digital: Handwriting

Will handwriting soon be history? Or will we always prefer a handwritten love letter from our beloved?

Visual of Facebook's Internet Drone Unveiled

Facebook's Internet Drone Unveiled

Facebook introduced its solar-powered drone project aimed to provide internet access to rural areas.

Visual of The Ice Cream That Doesn't Melt

The Ice Cream That Doesn't Melt

Researchers discovered a protein that can be used to produce the first ice cream that melts more slowly that the normal products on the market today.

Visual of Jazz-Playing Robot Challenges Human-Computer Interactions

Jazz-Playing Robot Challenges Human-Computer Interactions

A musical robot able to improvise a jazz solo in response to an actual person performing jazz.

Visual of Local Deliveries: Robots or Drones?

Local Deliveries: Robots or Drones?

Starship, a robot that will remodel our local deliveries system.

Visual of Medical Microbots Used to Perform Biopsy

Medical Microbots Used to Perform Biopsy

With recent successful experiments, we may see doctors switching from the single forceps to hordes of so-called microgrippers.

Visual of Meet the Hospital of the Future

Meet the Hospital of the Future

With its 656 beds, this hospital offers unconventional and leading computerized assistance for all sorts of patients.

Visual of Permanent Eye-Color Change

Permanent Eye-Color Change

A new laser surgery can permanently turn eyes from brown to blue.

Visual of Robot’s Best Friend

Robot’s Best Friend

From chef, to nurse, and also lover. Get ready, a new generation of robots is going to invade our lives!

Visual of Should We Fear Thinking Machines?

Should We Fear Thinking Machines?

It seems thinking machines could put the human race in danger. How realistic these fears are?

Visual of Smart Gloves Turn Gestures into Music

Smart Gloves Turn Gestures into Music

English artist Imogen Heap, with an army of artists, musicians, scientists and technologists, developed the Mi.Mu gloves.

Visual of Soil-Free Farming in the Desert

Soil-Free Farming in the Desert

A special absorbant film that require no soil may be able to grow plants more efficiently than soil farming.

Visual of The Future of Artificial Reproduction

The Future of Artificial Reproduction

According to researchers we could go a step further and use stem cells derived from your skin cells.

Visual of Anonymity Becomes the New Privacy

Anonymity Becomes the New Privacy

Artists respond to biometric technology and data collecting software through subversive projects.

Visual of Breaking Language Barriers

Breaking Language Barriers

We have witnessed significant progresses in the field of real-time translation, and this new wearable translator, called ili, sums up perfectly this essence.

Visual of Diamond Batteries from Nuclear Waste

Diamond Batteries from Nuclear Waste

Researchers are turning diamonds into batteries.

Visual of Drones in Agriculture

Drones in Agriculture

Here's a look at how drones can and will impact the agriculture and farming industry.

Visual of The First Self-Driving City Coach

The First Self-Driving City Coach

Mercedes-Benz just revealed the first self-driving city coach and took it to the streets of Amsterdam for a test drive.

Visual of The Bioengineered Elixir of Life

The Bioengineered Elixir of Life

Scientists say they can reverse aging by reprogramming the genome.

Visual of Growing Drones From Chemicals

Growing Drones From Chemicals

Researchers are experimenting with a new technology that would be able to grow drones from chemical compounds.

Visual of How We Domesticated Food

How We Domesticated Food

We tend to believe that the fruit and the vegetables we eat today are "natural" and the same as they always were. It turns out that in the past this familiar food didn't look like this at all.

Visual of Interview: Agi Haines, Speculative Artist Who Wants to Redesign the Human Body

Interview: Agi Haines, Speculative Artist Who Wants to Redesign the Human Body

Speculative designer Agi Haines' work focuses on (re)designing the human body, and speculates upon future scenarios.

Visual of Designer Govert Flint applies motion to everyday life

Designer Govert Flint applies motion to everyday life

Interview with Govert Flint, designer, architect and self-taught artist.

Visual of Next Nature and Next Generations

Next Nature and Next Generations

Our workshop with kids from Lanterna Magica, an unconventional primary school in Amsterdam.

Visual of Pigs Have a Heart for Us

Pigs Have a Heart for Us

Replacing your old heart with a new heart from an animal may seem extreme? Well, this future may arrive sooner than we think.

Visual of How Rare Is Virtual Gold?

How Rare Is Virtual Gold?

Part one of a ten part series exploring the design of an invisible technology: money.

Visual of VR Surgery and Live Stream Operations

VR Surgery and Live Stream Operations

There is a new breakthrough coming from the operating room: an app, called MDLinking, that connects 8.5 million doctors world wide.

Visual of Add-on Body Parts: Bionic Thumb

Add-on Body Parts: Bionic Thumb

Royal College of Art graduate Dani Clode reframed prosthetics as extensions of the body, rather than replacements for missing parts.

Visual of Female Menstrual Cycle on a Computer Chip

Female Menstrual Cycle on a Computer Chip

The complicated system of a female menstruation cycle was reproduced on a computer chip for the first time.

Visual of The Future of Firefighting

The Future of Firefighting

Firefighters can see through smoke with new thermal mask.

Visual of Govert Flint on Enrichers

Govert Flint on Enrichers

NNN fellow Govert Flint discusses Enrichers in Frame magazine.

Visual of Hoverboarding Over the Atlantic

Hoverboarding Over the Atlantic

In 2017, a hoverboard can fly 164 feet above earth and able to hover over the Atlantic Ocean.

Visual of The Human Smart Home Assistant

The Human Smart Home Assistant

Artist Lauren McCarthy launched a project called LAUREN in which she embodies a eponymous human smart home assistant.

Visual of Conversation with Dutch Philosopher Bas Haring: Robot, Colleague or Foe?

Conversation with Dutch Philosopher Bas Haring: Robot, Colleague or Foe?

We talked with Bas Haring to discuss the conception, image and will of the robot. Read our conversation with him and update your ideas about robots.

Visual of Interview: Lining Yao, Interaction Designer and Maker of Novel Materials

Interview: Lining Yao, Interaction Designer and Maker of Novel Materials

We recently interviewed Lining Yao, Chinese interaction designer who uses organic materials as a technology that brings us back to nature.

Visual of Rights for Robots: EU Calls for Regulation

Rights for Robots: EU Calls for Regulation

A new report recommends that we decide the legal status of robots sooner rather than later. It even suggests that they could be given personhood and rights.

Visual of Smell of Data Documentary on Nextnature.net

Smell of Data Documentary on Nextnature.net

The Smell of Data documentary will make its online debut on nextnature.net.

Visual of Chinese farmers are using AI to help rear the world’s biggest pig population

Chinese farmers are using AI to help rear the world’s biggest pig population

It’s been called China’s “pork miracle.” For centuries, pig-rearing in the country was predominantly a backyard occupation. (The etymology of the Chinese character for “home” …

Visual of Slowing down to start up: Here's the first chapter of our crypto deep dive series

Slowing down to start up: Here's the first chapter of our crypto deep dive series

It takes years to design a new banknote, having hundreds of people working on every little detail, all done under the watchful eye of governments and professionals. However today, …

Visual of Brain-assisted driving: Mind-control your car

Brain-assisted driving: Mind-control your car

Before fully autonomous cars take over our streets, we may experience a transition phase: Fasten your seatbelts, as Nissan introduced a so-called Brain to Vehicle (B2V) system to …

Visual of Beyond biomimicry: a new urgency

Beyond biomimicry: a new urgency

Designers face an unprecedented urgency to alter their methods and reprioritize their goals to address the accelerating degradation of the environment. This new …

Visual of Enter the Future Food Formula

Enter the Future Food Formula

Imagine, it’s 2050 and you are feeling hungry. What will be on your plate? Where will your food come from, and how will it be produced? It may be juicy ants from the nearest …

Visual of Next Generation: Visualising the diversity of microbial species with Valerie Daude

Next Generation: Visualising the diversity of microbial species with Valerie Daude

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of The origin of the LED lamp

The origin of the LED lamp

For thousands of years people used oil lamps and candles to illuminate their homes during the hours of darkness. Neither produced much light and both were inconvenient in use as …

Visual of Next Generation: Creating utopian and dystopian futures with Bas Jansen

Next Generation: Creating utopian and dystopian futures with Bas Jansen

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here?  Get in touch  and …

Visual of How emojis represent the past, present and future within Next Nature

How emojis represent the past, present and future within Next Nature

It's that time of year again; the Unicode Emoji 13.0 has announced that 117 new emojis are to be implemented in the second half of 2020. It got us curious of what these new emojis …

Visual of A countryside dweller's guide to the future

A countryside dweller's guide to the future

The current lockdown in much of Europe has city-dwellers flocking to the countryside to wait out the outbreak sweeping the continent. Seeking relief from coronavirus, urbanites …

Visual of The Coronation

The Coronation

For years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …

Visual of A button that tells your boss you're unhappy

A button that tells your boss you're unhappy

With gyms closed and millions cooped up and restless at home, it’s little wonder that “healthtech” is now being billed as the next big battleground over which the likes of …

Visual of 5 unusual technologies for harvesting water in dry areas

5 unusual technologies for harvesting water in dry areas

Water scarcity is among the top five global risks affecting people’s wellbeing. In water-scarce areas, the situation is grim. Conventional sources like snowfall, rainfall, river …

Visual of Mojo Visions augmented reality contact lenses kick off a race to AR on your eye

Mojo Visions augmented reality contact lenses kick off a race to AR on your eye

The digital world has been creeping closer to your face. Was a time when a laptop was about as personal as you got with a computer. Then came smartphones, and a few years later, …

Visual of Why we need to get better at predicting space weather

Why we need to get better at predicting space weather

The Sun is the most important source of energy for sustaining life on Earth, but it gives us a lot more than just light and heat. It also gives us solar storms.

Visual of Five things not to miss at Floriade

Five things not to miss at Floriade

Here are 5 things you cannot miss at Floriade Expo 2022

Visual of Exploring assisted evolution with Prof. Dr. John van der Oost

Exploring assisted evolution with Prof. Dr. John van der Oost

Assisted evolution raises complex questions. The practice involves human intervention to increase the rate of natural evolutionary processes. A technique that inevitably …

Visual of Chloé Rutzerveld designs the food of tomorrow

Chloé Rutzerveld designs the food of tomorrow

You are in for a surprise when you look at food and concept designer Chloé Rutzerveld 's portfolio. It is hard to believe that somebody so young - she is just 25 - has already …

Visual of Next Generation: Redesigning Burberry with Jiyong Lee

Next Generation: Redesigning Burberry with Jiyong Lee

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of What's solar geoeneering and why is it controversial?

What's solar geoeneering and why is it controversial?

A report from 2021 from the National Academies of Sciences, Engineering and Medicine tackles a controversial question : Is solar geoengineering – an approach designed to cool the …

Visual of Scoring music hits with Grimes using her Elf. Tech

Scoring music hits with Grimes using her Elf. Tech

The music industry is witnessing drastic changes. With the emergence of artificial intelligence technology, no industry has been left untouched and there are broad discussions …

Visual of Meet Indonesia's virtual news anchors

Meet Indonesia's virtual news anchors

Virtual news anchors seem to spread like wildfire across Asia. We've witnessed Xinhua present the news from China and applauded Lisa on becoming India’s first regional AI news …

Visual of People would rather give up sex and vacations than their smartphones

People would rather give up sex and vacations than their smartphones

Did you know that some Dutch people are so addicted to their devices that they'd rather give up sex, vacations, or even a finger than their phone?

Visual of This device helps you to control your lucid dreams

This device helps you to control your lucid dreams

What if we could control our dreams? In the near future, this might become a reality. Prophetic developed a new technology that enables lucid dream control. 

Visual of Seeking Symbiosis

Seeking Symbiosis

Visual artist Heleen Blanken explores the complex relationship between people, nature and technology.

Visual of The Material Futures of Central Saint Martins

The Material Futures of Central Saint Martins

Meet United Matters, a London collective exploring how we might live in the future by blurring the boundaries between craft, science and technology.

Visual of CrackBerry addicts are suing their Employers

CrackBerry addicts are suing their Employers

No self-respecting manager would be without a BlackBerry. But now these handheld gadgets, which provide workaholics with constant email updates, are being blamed for chronic …

Visual of First A4 colour e-paper unfurled

First A4 colour e-paper unfurled

Philips presented an A4-sized colour electronic paper . A paper-thin and bendable viewing panel. "This represents the next generation in display technology," Chung In-Jae, chief …

Visual of Friending, Ancient or Otherwise

Friending, Ancient or Otherwise

By ALEX WRIGHT, Published in NY Times December 2, 2007 The growing popularity of social networking sites like Facebook , MySpace and Second Life has thrust many of us into a new …

Visual of Printing virtuality

Printing virtuality

Phone, internet, television, photography, even books or music: today it is hard for the mind to escape from virtual worlds. A day without communication or interaction could make …

Visual of RedesignMe

RedesignMe

We are all born in a world that has been designed already. Cars, dishwashers, dildo's, remote controls, ATM machines. Although these products are supposed to make life better, …

Visual of Robot farmer Mr Woo

Robot farmer Mr Woo

Comedian Paul Merton went to China for Five.tv (early 2007) and near Beijing he reads the following headline: This farmer grows robots...

Visual of Slogan: The Future is Analog

Slogan: The Future is Analog

I first saw this statement on the Artvertising building . Let this be our slogan of the week.

Visual of All Is Full Of Love

All Is Full Of Love

While time seems to flow in this one direction, some people just know how to walk straight through that fourth dimension; catch it in a videoclip and throw the message into …

Visual of Avatarian Graveyard

Avatarian Graveyard

Avatarian Graveyard supplies a service for virtual addicts – people who excessively or compulsively spend time in virtual environments – to help them reintegrate into everyday …

Visual of BicycleBot

BicycleBot

Murata Boy, is a robot capable of riding bicycles unassisted. Balancing, pedaling and directing the bicyclee, turning the bike to avoid obstacles, etc. And this is his nephew, …

Visual of Hemp–Mote

Hemp–Mote

This weeks peculiar image gives gaming that "natural" touch: the Hemp–Mote by dhrek.com Made from 3 kinds of 100% natural hemp string on the outside, while remaining 100% …

Visual of High Performance Hip

High Performance Hip

A commercial by an orthopaedic reconstruction company introducing the next generation of joint replacements: " Highly advanced hips and knees. Engineered to meet the needs of your …

Visual of Homo Desktopus

Homo Desktopus

A future physical anthropologist who knows nothing about the human race and would dig up a contemporary desktop computer, might conclude homo desktopus must have been the user of …

Visual of Is it a bird?

Is it a bird?

Benjamin Verdonck's Giant Nest in Rotterdam.

Visual of Let the Dutch bury the Carbon

Let the Dutch bury the Carbon

Too much carbon emissions warming up the planet? No problem: just bring the stuff back to where you got it from in the first place. Experts have been advising to bury carbon …

Visual of Making Objects Invisible: It's getting easier

Making Objects Invisible: It's getting easier

Theorists predict a new class of materials that could render objects invisible. The materials work because they interact with light in unusual ways. Researchers are beginning to …

Visual of Robot asimo conducts concert

Robot asimo conducts concert

At a recent Yo-Yo Ma concert at the Detroit Opera House, Honda's ASIMO robot took the stage and conducted. Blame Honda when the robots take over. Thanks Paul .

Visual of Saturn (Directors Cut)

Saturn (Directors Cut)

The struggle between the born and the made is being fought out in a wardrobe on Saturn. By: 1stavemachine.com | Related: Sixties Last

Visual of The Telepresence Frame

The Telepresence Frame

The Telepresence Frame is a domestic object which utilises the fact that one's bodily functions are digitised in order to create a new form of telepresence. Allowing loved ones to …

Visual of Voodoo Communication Device for Lovers

Voodoo Communication Device for Lovers

Voodoo is an ancient religion, originating from Africa, who’s mystical practice is believed to bring reward to those who are willing to place their destiny in the hands of loving …

Visual of When Facebook gets Physical

When Facebook gets Physical

What would it be like if the communication on a social networking site like Facebook was actually played out in everyday life? Hilarious sketch by Idiots of Ants (thanks Martijn ).

Visual of BVPS Next Nature in LA - Pictures!

BVPS Next Nature in LA - Pictures!

May 17th 2008. Biggest Visual Power Show: Next Nature in LA . More pictures below. We are all born in a world that has been designed already. BVPS intro video by Floris Kaayk. Big …

Visual of Augmented Phone Browsing

Augmented Phone Browsing

This video shows the first beta version of TwittARound – an augmented reality Twitter viewer on the iPhone 3Gs. It shows live tweets around your location on the horizon. Because …

Visual of Battery-Free Implantable Neural Sensor

Battery-Free Implantable Neural Sensor

The shrinking size of electronics allows for the implantation of increasingly sophisticated electronic devices in the human body, paving the way for new prosthetics and …

Visual of Brainwave Binoculars

Brainwave Binoculars

The eye passes on more information to the brain than the brain will process. In that sense, the brain functions as a filter. But on the battlefield the risk of neglecting …

Visual of Colalife

Colalife

Coca-Cola© succeeds in what most NGO's try to achieve: getting the goods to the poor in the 3rd world   Africa. For most people there, a Coke is easier to get and cheaper than a …

Visual of Controlling Human Odour

Controlling Human Odour

The ultimate personal hygiene product, feces odor tablets, is another Japanese innovation sold by the Takano Yori Beauty Clinic . These pills promise to make your excrement …

Visual of Crash course on synthetic genomics

Crash course on synthetic genomics

Next Monday when your colleagues ask you what you have been doing for the weekend, you might answer you something default like you went out with friends, danced, biked to the …

Visual of DrinkPeeDrinkPeeDrinkPee

DrinkPeeDrinkPeeDrinkPee

Drinkpeedrinkpeedrinkpee is a project by Britta Riley and Rebecca Bray about the role our bodies play in larger ecosystems. It's an installation about the Urine to Fertilzer DIY …

Visual of Exmovere Chariot: the wearable wheelchair

Exmovere Chariot: the wearable wheelchair

Exmovere Holdings , a biomedical engineering company, is focused on government and consumer applications for healthcare, security and mobility. This company developed Exmovere …

Visual of Food Design in the 21th Century

Food Design in the 21th Century

Old nature provided us with a wide variety of food: fresh milk, crispy vegetables, nutritious meat. Yet this is not enough, we want more: We want a printed steak , square …

Visual of iReligion

iReligion

Graphic designer Roel Boonen takes the Apple cult to the extreme with this iReligion triptych. His piece is illustrative on how central corporations and digital technology have …

Visual of Mapping the human desire to be touched

Mapping the human desire to be touched

Fleshmap touch investigates the collective perception of erogenous zones. Hundreds of people ranked how good it would feel to touch or be touched by a lover in different points of …

Visual of Pelvis Rocking Chair

Pelvis Rocking Chair

It is nature, but not like we know it when chairs biomimic the pelvis. This anatomic Ruby rockingchair was designed by Pouyan Mokhtarani , Tehran (Iran). Via b oingboing.net | …

Visual of Placebo Buttons

Placebo Buttons

Buttons are everywhere: throughout your day you press them on phones, alarm clocks, keyboards, elevators, dishwashers and of course on the computer screen. Although buttons did …

Visual of Project Natal: You are the Cursor

Project Natal: You are the Cursor

Today browsing and gaming is dominated by the shortcomings of machines, for machines simply do not know who is on the other end. Man needs to interact; therefore man needs to …

Visual of The Eye of a Cyber Sapien

The Eye of a Cyber Sapien

An  earlier post  on this blog already displayed the possible future of sight using augmented contact lenses.  Researchers at MIT  take this second sight to a next level by …

Visual of The Robot Versus the Sign

The Robot Versus the Sign

Quote Eric Horvitz : "After finishing my doctoral work, I returned to Stanford Medical School to finish up the MD part of my MD/PhD. During one of my last clinical rotations, I …

Visual of Friendly Vending Machine

Friendly Vending Machine

Designer Guus Baggermans was quite annoyed by the clumsy impoliteness of current vending machines, that typically require you to enter some abstract number to select your drink or …

Visual of Geminoid Female

Geminoid Female

Professor Hiroshi Ishiguro ( Intelligent Robotics Laboratory at Osaska University) has done it again! This time in coöperation with robot-maker Kokoro Co. Ltd . Objective: to …

Visual of Having Invented the Gods, Perhaps we can Turn into Them

Having Invented the Gods, Perhaps we can Turn into Them

My name is Jason Silva. I've spent the last 5 years hosting and producing a tv show on Al Gore's Emmy-winning Current TV network and I'm a fellow at the Hybrid Realities …

Visual of Here Comes the iPhone Virus

Here Comes the iPhone Virus

By analyzing billions of phone calls, researchers at Scandinavian telecom company Telenor , mapped how social connections between people – measured partly by how often they called …

Visual of iBookshelf: Simulation before Extinction

iBookshelf: Simulation before Extinction

As technology progresses we constantly have to adapt ourselves to an ever changing media landscape. Designers try to smooth the changes with a ' progressive nostalgic ' strategy: …

Visual of Invisibility Cloak Hides Objects Visible To The Naked Eye

Invisibility Cloak Hides Objects Visible To The Naked Eye

Some years ago scientists managed to build a rudimentary invisibility cloak, which was an impressive device but it had some important limitations, not least of which was that it …

Visual of Memory Helmet

Memory Helmet

Protection is the fundamental purpose of the helmet. This helmet, a conceptual design project by Seungjoo Lee , enables the storage and protection of memories. Plug in your USB to …

Visual of Miniature Sensor Network for the Office

Miniature Sensor Network for the Office

"Have you seen my stapler? No, but just look it up on Google home office maps ." CSIRO Researchers have developed miniature sensors that track lab equipment, coffee mugs and …

Visual of Nano Supermarket Opens its Doors

Nano Supermarket Opens its Doors

Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …

Visual of Next Nature Movie #2: Being There

Next Nature Movie #2: Being There

The main character in ‘Being There’ (1979) is a simple-minded gardener named Chance, played brilliantly by Peter Sellars, who has spent all his life as a servant in the Washington …

Visual of Next Nature Movie #4: Blade Runner

Next Nature Movie #4: Blade Runner

Look around you and try to find the most natural thing in the room you are in now. It is you. Now, you wouldn’t be so sure in the apocalyptic Los Angeles of 2019 depicted in Blade …

Visual of Onion Pill

Onion Pill

Since the intake of medicines has become a mundane ritual nowadays, why not naturalize the interface? French artist Mathieu Lehanneur is rethinking the pill-person interface in …

Visual of Our Heart as a Power Plant

Our Heart as a Power Plant

Nanowire generators could one day lead to medical devices powered by the patient's own heart. A tiny, nearly invisible nanowire can convert the energy of pulsing, flexing muscles …

Visual of Blinky – Does what we want it to do

Blinky – Does what we want it to do

In the short movie Blinky, on a boy and his robot, director Ruari Robinson reflects on our daily dealings with technology and its risks. Alex is a child growing up in a family …

Visual of Hi, a Real Human Interface

Hi, a Real Human Interface

By Multitouch Barcelona , via Trendbeheer .

Visual of I am not a Robot. I am a Unicorn.

I am not a Robot. I am a Unicorn.

At Cornell Creative Machines Lab they were curious to see how two "chatbots" would make conversation. Powered by Cleverbot , created by AI researcher Rollo Carpenter, the robots …

Visual of Should we clone Neanderthals?

Should we clone Neanderthals?

If Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …

Visual of Social Microbial life

Social Microbial life

MyMicrobes , interestingly dubbed "Fecesbook" by ABC News , is the new social network for your gastrointestinal bacteria. For only $2,100 and a bit of poo you can become a member …

Visual of Special in Groene Amsterdammer

Special in Groene Amsterdammer

This week the oldest and classiest Dutch newsmagazine De Groene Amsterdammer features an 11-page special with lots of material from the forthcoming Next Nature book The special …

Visual of Why Handwriting Must Die

Why Handwriting Must Die

Associate professor Anne Trubek argues that handwriting will soon be history , because writing words by hand is a technology that's just too slow for our times, and our minds. A …

Visual of 3D Printing a New Face

3D Printing a New Face

Earlier this year, Belgian surgeons successfully performed the country's first full-face transplant using 3D printing. The operation was conducted by a medical team of Ghent …

Visual of A Clockwork Forest

A Clockwork Forest

Has nature become a fairytale or do we want it to be one? In their installation The Clockwork Forest , artist collective Greyworld seems to opt for the latter. The work of art …

Visual of A Computer that Nods and Waves When You Do

A Computer that Nods and Waves When You Do

Ever wish you could express yourself better over Skype? Tired of being a disconnected head-in-a-box? A team at Stanford University has rigged a Mac computer screen to shake its …

Visual of A Fake Sun for Your 25/7 Life

A Fake Sun for Your 25/7 Life

The earth operates on a 24 hour cycle, and so do humans. For most of history, we didn't have much choice in the matter. However, in the absence of visual cues light sunlight, some …

Visual of A More Realistic Mermaid

A More Realistic Mermaid

After being denied permission to reproduce the famed Little Mermaid statue from Copenhagen, the authorities of Vancouver decided to go for something more realistic.

Visual of Arne Hendriks – Incredible Shrinking Man

Arne Hendriks – Incredible Shrinking Man

Artist Arne Hendriks explores the possibilities and implications of downsizing the human species to better fit the earth.

Visual of Charging Phones by (and with) Camp Fire

Charging Phones by (and with) Camp Fire

With areas of New York still without electricity, BioLite  recently came to the rescue of Brooklynites by   setting up a charging station  with camping stoves that convert excess …

Visual of Further Incredibly Shrinking Man

Further Incredibly Shrinking Man

Artist Arne Hendriks gave a lustrous talk on the possibilities of downsizing humanity to better fit the earth.

Visual of Is the Human Body Redundant?

Is the Human Body Redundant?

The increasing ‘liveliness’ of machines and accessibility to the virtual world has raised questions about whether it is possible to uncouple the mind from the body in through a …

Visual of New Volvo Recognizes Shapes of Animals like Deer & Elk to Reduce Crash Impact.

New Volvo Recognizes Shapes of Animals like Deer & Elk to Reduce Crash Impact.

Volvo cars is testing a new safety system that automatically hits the brakes once an animal is detected in the vehicles vicinity. The Animal Detection System expands the range and …

Visual of Pantone SkinTone

Pantone SkinTone

Should made-to-order babies become a reality in the near future, one piece of the design puzzle has been solved now Pantone has release their SkinTone system. Indexing 110 skin …

Visual of Robot Fridge Forces You to Smile for Food

Robot Fridge Forces You to Smile for Food

Feeling grumpy and hungry? Unfortunately, the University of Tokyo's Happiness Counter refrigerator won't open up until you give it a big smile. The concept is based on the fact …

Visual of Robutt

Robutt

Tokyo University of Electro-Communications , revealed SHIRI (? = "buttocks"), a "Buttocks Humanoid That Represents Emotions With Visual and Tactual Transformation of the Muscles." …

Visual of Rule #5: Consider Zoomorphism as an Alternative

Rule #5: Consider Zoomorphism as an Alternative

For past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design,  click here.   When a product imitates animal behavior, the strict social rules …

Visual of The Right to Privacy

The Right to Privacy

Privacy is a right. A right given to people by telecommunications companies and social networking websites. It can be described by multiple-choice lists of settings. And it seems …

Visual of Will a Cockroach Save Your Life?

Will a Cockroach Save Your Life?

Often cockroaches aren’t people's best friends, but maybe in a few years you will be relieved when you see a cockroach. Researchers of the North Carolina State University …

Visual of Birdhouse Sweet Birdhouse

Birdhouse Sweet Birdhouse

3D printer company MakerBot  recently launched a contest  inviting designers to create the birdhouse of the future. The winner is The American Craftsman Bungalow by Brent J. …

Visual of Bored with Sex? There's a Pill for That

Bored with Sex? There's a Pill for That

Trials for new drugs hold promise for a "cure" for female boredom in the sack.

Visual of DIY Body Modification to Hack Evolution

DIY Body Modification to Hack Evolution

Biohacker Tim Cannon inserted a chip into his arm to monitor his bodily data and transmit it to an Android device.

Visual of Electric Skin Could Allow Robots to Feel

Electric Skin Could Allow Robots to Feel

A new kind of piezotronic transistor mesh could make for robotic skin that’s as sensitive as your own is, covered in thousands of tiny mechanical hairs.

Visual of Hug & Pay

Hug & Pay

The rise of digital currencies reduces the need for physical interaction and communication between people. At the same time every payment method still leans on trust. But how can …

Visual of In-Vitro Hamburger Sponsored by Google

In-Vitro Hamburger Sponsored by Google

More remarkable than the look and taste of the burger, which only stood out because it was presented in a petri dish and described by one of the panelist as 'hot', was the revelation that Serge Brin, co-founder of Google.com, financed the project.

Visual of Interview: Arne Hendriks, Researcher and

Interview: Arne Hendriks, Researcher and "Father" of The Incredible Shrinking Man

Hendriks’s activity explores the positive transformative power of creative impulses and the importance of fundamental free scientific research.

Visual of Interview: Floris Kaayk, the Visionary Creative Mind Behind Human Birdwings

Interview: Floris Kaayk, the Visionary Creative Mind Behind Human Birdwings

Floris Kayak discusses online hoaxes and the future of technology.

Visual of Loyal Lamps that Follow You Like Pets

Loyal Lamps that Follow You Like Pets

Two lights that behave like pets, acting and reacting like autonomous creatures.

Visual of Next Nature TEDx Talk in Budapest

Next Nature TEDx Talk in Budapest

Indulge in the Next Nature stump speech at TEDx from Dr. Van Mensvoort

Visual of Our Electronics, 100 Years Later

Our Electronics, 100 Years Later

An artist envisions our consumer electronics in a century, moss-covered and half-decayed.

Visual of Project Genesis

Project Genesis

We serve our systems as much as they serve us.

Visual of Protocell Shoe Mends Itself

Protocell Shoe Mends Itself

The self-repairing sole is a dynamic solution to an everyday problem.

Visual of Shape-Shifting House Acts like a Flower

Shape-Shifting House Acts like a Flower

Imagine your home adapting itself to seasonal, meteorological and even astronomical conditions by changing its shape.  D*Dynamic is based on the discovery of mathematician Henry …

Visual of The Hedonometer Uses Social Media to Measure Global Happiness

The Hedonometer Uses Social Media to Measure Global Happiness

Scientists are using Twitter, blogs, and news sites to categorize the global psyche.

Visual of The Smart Desk: Exercise While Working

The Smart Desk: Exercise While Working

A "breathing" desk that reminds you to change positions throughout the day.

Visual of With

With "Stealth Wear", Hide from Unmanned Drones in Style

Tired your ugly duds? Sick of surveillance drones? Does Adam Harvey have the clothing for you!

Visual of 50 Years Ago Asimov Predicted WiFi, Smartphones and Today's World Features

50 Years Ago Asimov Predicted WiFi, Smartphones and Today's World Features

Isaac Asimov predicts in 1964 what the world will look like today, in 2014.

Visual of A Brief History of Humankind

A Brief History of Humankind

Historian Yuval Noah Harari takes us on a journey through the whole human history.

Visual of A Plan to Eliminate Predators

A Plan to Eliminate Predators

British philosopher David Pearce believes we should to stop animals from hunting and killing other animals.

Visual of Assemble Your Own Computer

Assemble Your Own Computer

Kano: the low-cost computer anyone can assemble.

Visual of Balloon-Powered Internet For Everyone

Balloon-Powered Internet For Everyone

Project Loon by Google has the mission of providing Internet access to rural and remote areas, with a hot air balloon network.

Visual of Cosmos Tourism

Cosmos Tourism

The World View Experience offers an expensive journey to the edge of space.

Visual of Digital Native

Digital Native

Digital natives have trouble understanding life before 24/7 online connectivity.

Visual of DIY Wire Networks In India

DIY Wire Networks In India

Indian fragile DIY electronic infrastructure gives an insight into our complex electronic wire systems.

Visual of Electricity From Plants

Electricity From Plants

A new technology enables us to produce electricity from living plants at practically every site where plants can grow.

Visual of Exploring the City Soundscape

Exploring the City Soundscape

Buq are electronic life forms that shift the experience of the street scape from the primarily visual to a more auditory experience.

Visual of First 3D-printed Skull implanted

First 3D-printed Skull implanted

First 3D-printed skull has been implanted on a 22 years old dutch women.

Visual of Flight Paths Of Birds Captured On Video

Flight Paths Of Birds Captured On Video

Visualizing of the flight paths of birds.

Visual of Grandma Wants Google Glass

Grandma Wants Google Glass

Everyone adapts to new technologies!

Visual of Let the Drones take care of the Biosphere

Let the Drones take care of the Biosphere

Drones are typically thought of as flying spying robots, or even worse flying spying shooting robots. But could we also employ drones for good? The people of …

Visual of Listening to Wi-Fi

Listening to Wi-Fi

Modern technologies give deaf people the ability to hear again, not only regular sounds but also the invisible Wi-Fi signals.

Visual of Making Seawater Drinkable with Nanotech

Making Seawater Drinkable with Nanotech

Filtering sea water to drinkable fresh water is no longer science fiction.

Visual of Miracles Happen… Again

Miracles Happen… Again

Miracles in the digital era.

Visual of NANO Supermarket Best Product 2014

NANO Supermarket Best Product 2014

A jury of design and science experts awarded the best NANO Supermarket product a € 2.500 prize.

Visual of Robotic Easter Egg Decorator

Robotic Easter Egg Decorator

A robot that applies computer controlled motion to precisely decorate your Easter eggs.

Visual of The Flying Car

The Flying Car

From automobile to airplane: the flying car is built to travel as easily on the road as in the sky.

Visual of The Sound of Nature

The Sound of Nature

Love the sound of nature.

Visual of Touching your Unborn Child

Touching your Unborn Child

Thanks to 3D Babies and a mere $600,- you can now experience that excitement of holding your baby in your hands before he or she is born.

Visual of Weaving a Home

Weaving a Home

A lightweight and mobile structural fabric based on ancient traditions of weaving fibers.

Visual of Analogue vs Digital: Never Lost with GPS

Analogue vs Digital: Never Lost with GPS

Before global positioning systems, we all used maps. And they could be very annoying.

Visual of Analogue vs Digital: Phoning

Analogue vs Digital: Phoning

Remember these? If you are a digital native there is a chance you never noticed one of them.

Visual of Caress of the Gaze

Caress of the Gaze

Designer Behnaz Farahi envisions an interactive 3D printed outfit that can detect and respond to the gaze of the other and respond accordingly with life-like behavior.

Visual of Experimental Office: No Chairs, No Desks

Experimental Office: No Chairs, No Desks

To counter the sitting dogma, design firm RAAAF and artist Barbara Visser created a dynamic office concept, entirely based on movement and leaning.

Visual of Flights Delayed Due to iPad Crash

Flights Delayed Due to iPad Crash

Dozens of American Airlines flights were grounded as pliots' iPads crashed.

Visual of Hyperform: the Future of 3D Printing

Hyperform: the Future of 3D Printing

"However, while 3D printers are becoming increasingly accessible and capable of rivalling the quality of professional equipment, they are still inherently limited by a small print …

Visual of Living Underground with Fake Sunlight

Living Underground with Fake Sunlight

Coelux skylight recreates natural sunlight using Nano Technology.

Visual of Mark Zuckerberg Discovers 'Books'

Mark Zuckerberg Discovers 'Books'

Books allow you to fully explore a topic and immerse yourself in a deeper way than most media today.

Visual of First Testings of Google's Project Loon Announced

First Testings of Google's Project Loon Announced

Google plans to connect more than 100 million people in a cheap, new and sustainable way, in a territory where only one person on three has access to the Internet.

Visual of OUT NOW: Save the Humans! Book

OUT NOW: Save the Humans! Book

The SAVE THE HUMANS! book is now available on our web shop.

Visual of Poem Passes the Turing Test

Poem Passes the Turing Test

Zackary Scholl developed a program to produce a poem that passed the Turing Test.

Visual of Prodigious Yogurt Can Reveal Cancer

Prodigious Yogurt Can Reveal Cancer

An extraordinary yogurt that could soon implement accurate, young disease diagnosis.

Visual of Stewart Helps People to Trust Self-Driving Car

Stewart Helps People to Trust Self-Driving Car

Stewart is a tactile interface that mediates the communication between human and self-driving car.

Visual of Teasing the Internet of Things

Teasing the Internet of Things

When there is such abundance of areas where IoT could be applied, several ridiculous, unnecessary products are inevitable.

Visual of The Golden Quarter

The Golden Quarter

Some of our greatest cultural and technological achievements took place between 1945 and 1971. Why has progress stalled?

Visual of Turning Cockroaches into Rescue Robots

Turning Cockroaches into Rescue Robots

Cyborg cockroaches might be used for search-and-rescue operations in the future.

Visual of Watch out for Bullied Robots

Watch out for Bullied Robots

Dystopian future scenarios filled with evil robots are everywhere. We are afraid of robots treating us badly, but what will happen if it'll be the other way around? According to …

Visual of Designed to Survive Our Roads

Designed to Survive Our Roads

A road safety campaign in the Australian state of Victoria exposed an educational, yet confronting picture to raise awareness to the vulnerable human body on the road.

Visual of Disney-Themed Prosthetics for Children

Disney-Themed Prosthetics for Children

Open Bionics is helping children in need for bionic hands. With Iron Man, Frozen, or Star Wars-themed prosthetics, their fantasies become reality.

Visual of Driverless Taxi Pods

Driverless Taxi Pods

Driverless Taxi Pods pilot in suburb of New Delhi.

Visual of Hyperloop Set to Change Mass Transit

Hyperloop Set to Change Mass Transit

The Hyperloop is a future transportation means that is safer, faster, and cheaper than current forms of mass transit.

Visual of Computers Need Domestication

Computers Need Domestication

Soon we won’t program computers anymore, we’ll train them like dogs.

Visual of Man Controls Prosthetic Arm with His Mind

Man Controls Prosthetic Arm with His Mind

Researchers at the John Hopkins University School of Medicine succeeded in hooking up a prosthetic arm to the human brain.

Visual of Morality of an Autonomous Car

Morality of an Autonomous Car

When an autonomous car has to make a decision, will self-interest or the public good predominate?

Visual of Bionic Prosthetic Arm with Personal Drone

Bionic Prosthetic Arm with Personal Drone

Why would you stick to an elbow, a wrist and five fingers if you could make anything? This guy got a game-inspired bionic arm.

Visual of Re-introducing Extinct Species

Re-introducing Extinct Species

Extinct European bisons are being reintroduced in parks. But what makes a national park?

Visual of Self-Driving Cars Are Here to Stay

Self-Driving Cars Are Here to Stay

The first time you switch on your self-driving car, punch in your coordinates and cruise off to the soulless thrum of an electric motor you’ve got to wonder: does this thing know what it’s doing?

Visual of Self-Driving Trucks Hit the Highways

Self-Driving Trucks Hit the Highways

A driverless convoy of trucks drove through Europe and safely arrived in Rotterdam yesterday.

Visual of Solar-Powered Donkeys to Stay Online

Solar-Powered Donkeys to Stay Online

Turkish shepherds are installing solar panels on their donkeys to stay connected.

Visual of This Indestructible Micro-Animal Will Help Us

This Indestructible Micro-Animal Will Help Us

Will a small step for Ramazzottius Varieornatus be a giant leap for mankind?

Visual of Meeting the Future at TodaysArt

Meeting the Future at TodaysArt

Last week The Hague hosted a festival dedicated to contemporary experiments in music, art and digital culture.

Visual of Men Pregnancy: Reality or Science-fiction?

Men Pregnancy: Reality or Science-fiction?

The first uterus transplant in the United States raises the question: could uterus transplants allow men to get pregnant too?

Visual of 1978 - World’s First ‘Test Tube Baby’ Born

1978 - World’s First ‘Test Tube Baby’ Born

In 1978, the world's first test-tube baby was born, her name is Louise Brown.

Visual of What You Should Know About Artificial Intelligence Changing Jobs

What You Should Know About Artificial Intelligence Changing Jobs

It should come as no surprise that artificial intelligence naturally extends into the way we work. Let's look at how AI changes the way we relate to work.

Visual of Carpooling into the Future

Carpooling into the Future

American company Ideo has taken the essence of on-demand economy at heart, presenting a vehicle with detail-designed services for the future of carpooling.

Visual of Color Lessons from the Cotinga Bird

Color Lessons from the Cotinga Bird

Brighter inks, without pigment: nanostructured capsules could bring about paints and electronic displays that never fade.

Visual of Digital Detox: Disconnect to Reconnect?

Digital Detox: Disconnect to Reconnect?

Do you feel information overloaded? Do you experience stress? Do you feel like you are addicted to your smartphone, laptop, or the Internet? Get yourself digital detoxed!

Visual of Flying Car Modular Transport System

Flying Car Modular Transport System

Airbus and Italdesign unveil modular urban land and air transport system.

Visual of Heart Repair with Spinach Leaves

Heart Repair with Spinach Leaves

Scientists developed a procedure to repair your heart with a spinach leaf.

Visual of HUBOT: Meet the Home Healthcare Professional

HUBOT: Meet the Home Healthcare Professional

The home healthcare professional is one of the 16 positions from HUBOT, the job agency for people and robots.

Visual of HUBOT: Meet the Air Traffic Security Worker

HUBOT: Meet the Air Traffic Security Worker

As air traffic security you make sure that birds stay away from the airport using your eagle drone. With an accessory console, you fly the quadcopter from the sideline to scare …

Visual of HUBOT: Meet the Robot Coach

HUBOT: Meet the Robot Coach

Craftsmanship is generally very appreciated, but it takes a lot of time to master a craft. Therefore, as a robot coach you train - you guessed it, a robot - to transfer your …

Visual of Opening HUBOT at DDW

Opening HUBOT at DDW

The robots have arrived! Yesterday we celebrated the launch of HUBOT , job agency for people and robots at MediaMarkt , as part of the Dutch Design Week in Eindhoven. Our virtual …

Visual of HUBOT: Meet the Organ Designer

HUBOT: Meet the Organ Designer

As an organ designer, you develop genetic algorithms from which organs are grown to perfectly fit the recipient’s body, but also to meet the personal wishes of the patient.

Visual of Sexy Cyborg Sports Her Prosthetic Limb

Sexy Cyborg Sports Her Prosthetic Limb

The Brazilian model Paola Antonini uses her Instagram to show off her prosthetic limb.

Visual of Rescue Drone Will Save You in Open Water

Rescue Drone Will Save You in Open Water

Drone made to rescue in bad weather condition in open waters.

Visual of Virtual Networking, the Future Social Media

Virtual Networking, the Future Social Media

Virtual reality is already becoming a part of the conversation surrounding social media. Will it become the next popular social network?

Visual of Artificial Womb Workshop at Border Sessions

Artificial Womb Workshop at Border Sessions

At Border Sessions Festival in the Hague a workshop was hosted by Next Nature Network on the artificial womb.

Visual of How AI could revolutionize the teaching profession

How AI could revolutionize the teaching profession

In various parts of the world, access to education is, or risks becoming, a huge crisis. UNESCO estimates that around 20 million new teachers are needed worldwide - and that's not …

Visual of HUBOT: Meet the Cybercrime Detective

HUBOT: Meet the Cybercrime Detective

As a cybercrime detective, you search for suspicious patterns that indicate crime in the digital domain.

Visual of On the origin of the e-bike

On the origin of the e-bike

The oldest known serious candidate forerunner for the bicycle is the ‘running machine’ built by the German Baron Karl von Drais. His two-wheeled machine became known as the …

Visual of Smartphone app helps indigenous communities fight deforestation

Smartphone app helps indigenous communities fight deforestation

Five people suspected of illegal gold mining in Peru are in custody after indigenous community members used a system called ForestLink to alert authorities to the activity. …

Visual of Next Nature Night: Future food is on the menu

Next Nature Night: Future food is on the menu

Always thinking about food? What about food that doesn’t exist yet? On the 18th of September at De Studio, Next Nature Network will host a night of talks on the future of food and …

Visual of Human-animal hybrids could be used for growing organs

Human-animal hybrids could be used for growing organs

Around the world thousands of people are on organ donor waiting lists. While some of those people will receive the organ transplants they need in time, the sad reality is that …

Visual of Lessons in bio design from Emma van der Leest

Lessons in bio design from Emma van der Leest

As a young bio designer at the start of your career, you'll have to overtake all kinds of obstacles. From the collection of living materials to working in a laboratory and …

Visual of Emma is your colleague of the future

Emma is your colleague of the future

Emma is in poor health. She has painful varicose veins, stress-related eczema, puffy skin, a grey complexion, red eyes and a hunch-back. She is an imagined office worker of the …

Visual of Pack your bags: Next Nature is going to China

Pack your bags: Next Nature is going to China

To our Chinese friends (and beyond)! From 2 November 2019 to 1 February 2020, we'll be crossing the globe for a large showcase at the OCT Art and Design Gallery in Shenzhen, …

Visual of Electric cars might not yet be green, but we should buy them anyway

Electric cars might not yet be green, but we should buy them anyway

Transforming the way we travel is an essential part of tackling the climate crisis. The transport sector contributes about 20% of global carbon emissions . In the UK the figure is …

Visual of Meatable: from stem cells to pork chops

Meatable: from stem cells to pork chops

The food chain has always worked roughly like this: sunlight feeds plants. Plants feed insects. Insects and plants feed animals. Plants and animals feed people. Then …

Visual of Next Generation: Shimmering nature with Elissa Brunato

Next Generation: Shimmering nature with Elissa Brunato

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here?  Get in touch …

Visual of Next Generation: Searching for Null Island with Deborah Mora

Next Generation: Searching for Null Island with Deborah Mora

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Talking non-human nonsense with Nonhuman Nonsense

Talking non-human nonsense with Nonhuman Nonsense

Nonhuman Nonsense is a research-driven design and art studio existing somewhere between utopia and dystopia. They wonder upon our relationship with the non-human, embracing …

Visual of This book explains why cooking food was essential to human evolution

This book explains why cooking food was essential to human evolution

A must-read to the Next Nature fan: Catching Fire: How Cooking Made Us Human (2009). Written by British primatologist Richard Wrangham, the author shares his hypothesis that …

Visual of Future cities: why we need to reimagine the look of urban landscapes

Future cities: why we need to reimagine the look of urban landscapes

In imagining future urban landsapes, we need to answer questions about what can be sustained and what cannot, where cities can be located and where they cannot.

Visual of What will your future supermarket look like?

What will your future supermarket look like?

What will the supermarket of the future look like? And what kind of food will you be able to buy there? That is what the Embassy of Food is researching. The production and …

Visual of Max Liboiron: pollution is colonialism

Max Liboiron: pollution is colonialism

We now live in a world where plastics are becoming a part of our marine ecosystems. As a result, we strive hard to clean the plastics from our oceans. Dr. Max Liboiron ( Michif …

Visual of Metaverse: 5 things you need to know

Metaverse: 5 things you need to know

What is the metaverse and to what extent should we believe that the vision being presented to us is really going to be central to our daily lives?

Visual of Can microbes communicate with alien species?

Can microbes communicate with alien species?

Are we alone in the universe? The famous Seti (Search for Extraterrestrial Intelligence) programme has been trying to answer this question since 1959. American astronomer Carl …

Visual of We could power households from the scraps in our food waste bins

We could power households from the scraps in our food waste bins

Imagine if you could power your kettle using the energy generated from the vegetable cuttings quietly breaking down in your kitchen’s compost bin. That reality might not be so far …

Visual of This year's electronic waste weighs more than the Great Wall of China

This year's electronic waste weighs more than the Great Wall of China

It’s widely known that the world has a plastics problem. What’s less widely known is that we have a similar problem with another kind of waste: electronics

Visual of Growing artificial muscles

Growing artificial muscles

A team of researchers from Freiburg University has developed an artificial muscle that may result in improvements in medicine, prosthetics, and implants.

Visual of Growth is not the problem, but the solution

Growth is not the problem, but the solution

If we want to bring down global CO2 emissions to zero, we will need technological innovation and massive infrastructure projects.

Visual of Next Generation: (Un)learning Time By Light with Valentine Maurice

Next Generation: (Un)learning Time By Light with Valentine Maurice

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Publish your graduation project

Publish your graduation project

*Our open call will continue for another month due to popular demand* Calling all art students, academics and everything in between. Are you a recent graduate (or soon to be)? Do …

Visual of This expo explores technological nature and indigenous insight

This expo explores technological nature and indigenous insight

Technology brings us closer to nature, and indigenous insight reconnects us to our roots.

Visual of Are plants our new co-composers?

Are plants our new co-composers?

Musicians have stumbled upon an unconventional and intriguing creative partner: plants. Yes, that's right, plants. Through the use of advanced sensors and software, …

Visual of Dancing at the intersection of natural and virtual worlds

Dancing at the intersection of natural and virtual worlds

Exploring the intersection of technology and art, a team of creatives presents a virtual performance that pushes the limits of human expression.

Visual of I'm not a robot: AI better at proving to be human than humans

I'm not a robot: AI better at proving to be human than humans

Researchers at the University of California discovered that bots now excel at solving CAPTCHAs faster and more accurately than humans.

Visual of Playing Pong with lab-grown brains

Playing Pong with lab-grown brains

Biotechnology startup Cortical Labs successfully guided human brain cells in a petri dish through a simulated game of Pong.

Visual of Furniture futures

Furniture futures

Wondering how next natural furniture may change your way of life? Will we feed our lamps? Grow chairs? Talk with our tables?

Visual of How to design your (home)office

How to design your (home)office

Designer Govert Flint proposes a new office concept, entirely based on movement and play.

Visual of The Petunia Carnage

The Petunia Carnage

To pay tribute to the destroyed orange petunias during the Petunia crisis, Klaus Pichler has composed an illustrative book.

Visual of Paradise by the Laptop Light

Paradise by the Laptop Light

Paradise by the Laptop Light is a visual power event with short films, speedlectures, special guests and one laptop. It will be held on 23 November 2007 16:30, as part of STRP Art …

Visual of Nanosculpture

Nanosculpture

This copy of Rodins "Le Penseur" / "The Thinker" (1880) shouldn't have that much on its mind... By using laser-technology, Korean researchers have crafted the microscopic version …

Visual of Next Friday: Paradise by the Laptop Light

Next Friday: Paradise by the Laptop Light

Paradise by the Laptop Light is a visual power event with short films, speedlectures, special guests and one laptop. It will be held on Friday 23 November 2007 16:30 - 18:00, as …

Visual of X-finger

X-finger

wired.com | video | Related posts: Robotic hand | Bionic arm Invented by Dan Didrick of Naples, Florida, the device has NO batteries, electronics, servos or actuators. Instead, …

Visual of Amsterdam Weekly on the Natural Revolution

Amsterdam Weekly on the Natural Revolution

The free cultural paper Amsterdam Weekly discusses the Natural Revolution of and includes tree tips for successful living in the next version of nature. Download PDF (148kb) . …

Visual of Cell Phone Minutes: the Next Currency

Cell Phone Minutes: the Next Currency

It might just be my old nature mind, but I still find it a daily miracle: being able to walk into the bakery around the corner and trade a piece of paper – called money – for a …

Visual of Human body farm

Human body farm

Why not use the human body to grow products for the medical industry? The designer Michael Burton envisions Future Farm where the body is used as a farm to cultivate clinical and …

Visual of Interactive Nanotech Food

Interactive Nanotech Food

Nanotechnology isn't just protecting your food - it's in your food. Scientists are manufacturing nano-sized vitamins that are easier for our bodies to absorb. In the future they …

Visual of Want privacy? Use pigeon messaging

Want privacy? Use pigeon messaging

Our society seems to be driven by an obsession of gathering personal data. Yes, they say it is for your own good, so we willingly collaborate by filling in our most intimate …

Visual of Water in my phone

Water in my phone

Water inside your phone used to be rather devastating, but with the NEC FOMA N702iS (only in Japan) , designed by Oki Sato, it is turned into a joy. Watch the faked fluid move on …

Visual of A Society of Simulations

A Society of Simulations

An interviewer once asked Pablo Picasso why he paints such strange pictures instead of painting things the way they are. Picasso asks the man what he means. The man then takes out …

Visual of Ear on your arm? Why not?!

Ear on your arm? Why not?!

For over 40 years Australian artist Stelios Arcadious Stelarc has made art with medical instruments, prosthetics, robots, virtual reality systems and biotechnology to investigate …

Visual of Forefather Ox cloned to revive delicious Steak

Forefather Ox cloned to revive delicious Steak

Delicious retro-future meat from Japan. Food technology in the overdrive. Japanese researchers successfully cloned what is believed to have been the forefather ox of Gifu …

Visual of From Genes, to Memes, to Temes

From Genes, to Memes, to Temes

Susan Blackmore studies memes: ideas that replicate themselves from brain to brain like a virus. She makes a bold new argument: Humanity has spawned a new kind of meme, the teme, …

Visual of How to print a building

How to print a building

In the nineties laser printers revolutionized graphic design. Currently 3d desktop printers are revolutionizing industrial design. Next we will be printing buildings and …

Visual of Lab creates fake DNA evidence

Lab creates fake DNA evidence

DNA evidence has been the most bulletproof evidence for forensic sciences in recent years. Not anymore. A laboratory at Nucleix, a life-sciences company, has demonstrated it is …

Visual of The Next Hacking Frontier: Your Brain

The Next Hacking Frontier: Your Brain

WiredScience writes: Hackers who commandeer your computer are bad enough. Now scientists worry that someday, they’ll try to take over your brain. In the past year, researchers …

Visual of Turning Brain Waves into Tweets

Turning Brain Waves into Tweets

Are you using Twitter and looking for faster ways to update your followers with your utterly mundane status on what you are thinking? Adam Wilson from the University of Wisconsin …

Visual of Wifi Dowsing Rod

Wifi Dowsing Rod

Today's technology advances so rapidly that people are often unable to update their media schemas in time and as a result are left cluelessly in awe of it all. Mike Thompson's …

Visual of Douglas Coupland: A radical pessimist's guide to the next 10 years

Douglas Coupland: A radical pessimist's guide to the next 10 years

Douglas Coupland is a writer and artist based in Vancouver. For the canadian newspaper Globe and Mail, he wrote The ‘radical pessimist's guide to the next 10 years’ a dystopian …

Visual of There’s Plenty of Room at the Bottom

There’s Plenty of Room at the Bottom

So you’re triggered by our call for products and now you’re considering to send in one, two or maybe three of your brilliant products for the Nano Supermarket? Good. Or – and this …

Visual of Nano Supermarket – Call for Products

Nano Supermarket – Call for Products

Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …

Visual of Nano Supermarket on Dutch TV News

Nano Supermarket on Dutch TV News

The Dutch evening News payed a visit to our Nano Supermarket to familiarize the television viewers with the intricate world of nanotechnology and its potential impact our economy …

Visual of Nano Tattoo to Monitor Diabetes

Nano Tattoo to Monitor Diabetes

Now here is something for the NANO Supermarket : Massachusetts-based Draper Laboratories have developed a special injectable ink with nano–particles. This ink eventually could …

Visual of A bacteria of a different color

A bacteria of a different color

In 2009, undergraduates at the University of Cambridge worked with scientists and artists to engineer E. coli into E. chromi , a new type of bacteria that secretes a range of …

Visual of Apes Like Cooked Food, and What that Means for Human Evolution

Apes Like Cooked Food, and What that Means for Human Evolution

Humans are the only species on earth that cooks its food. Not only do we cook our food, but we usually find the flavor of cooked foods preferable to the raw version. Compare the …

Visual of Deus Ex: The EyeBorg Documentary

Deus Ex: The EyeBorg Documentary

Back in 2009 Rob Spence, a cyborg film maker, worked together with a team of ocularists, inventors, engineering specialists on a prosthetic eye which can capture and stream video. …

Visual of Manko & Life [#8]

Manko & Life [#8]

Manko sighed. Nada: 'Did you like it?' Manko: 'I have to admit that if this is the starter, I'm not sure I'll survive the main course.' Everyone at the table laughed. Manko: 'Let …

Visual of Nano Product: Pharmaceutical Sushi

Nano Product: Pharmaceutical Sushi

Are we creating the penicillin or the asbestos of the 21st century? Prior to the arrival of the Nano Supermarket , we share some speculative nanotech products with you. Here’s the …

Visual of Streetlight Trees

Streetlight Trees

We all know the cellphone masts disguised as trees , created in an attempt to blend technology within the 'natural' landscape. Now Taiwanese scientists have created trees that …

Visual of A Winery in your Microwave

A Winery in your Microwave

A delicious Montepulciano in only 6 seconds? This is now possible with the universal Nano wine. All you need is a microwave oven. In 5,64 seconds at 1000 watt you have a sublime …

Visual of Cellphone Masts Disguised as Trees are Outdated

Cellphone Masts Disguised as Trees are Outdated

There is a new version of the well-known cellphone masts disguised as trees. Instead of adding fake nature to these masts,  ChamTech Operations wants to put a layer of invisible …

Visual of Converse Sneaker Tattoo

Converse Sneaker Tattoo

Today, shoes have been naturalized to the extend that we hardly can imagine life without them. Yet, shoes didn't exist in old nature, hence there must have been a day when …

Visual of Corn 2.0: Survival of the Cheapest

Corn 2.0: Survival of the Cheapest

Congrats to Sean Serafini, the winner of our April Next Nature Spotter contest. While we received many images of fake nature , Sean's entry delves deeper into more diverse next …

Visual of Genetically Engineered

Genetically Engineered "Arctic" Apple Will Never Turn Brown

Canada-based Okanagan Specialty Fruits is pitching a genetically engineered apple that does not turn brown when bruised or exposed to air. This new technology, available in both …

Visual of Mobile Phone Avant La Lettre

Mobile Phone Avant La Lettre

Our peculiar image of the week is exemplary of our human longing for technology that intimately integrates with our body & senses. We are all cyborgs .

Visual of Nano Product: Honest Egg

Nano Product: Honest Egg

Do away with dishonest health claims for eggs and uncertain promises of organic, free-range hens. With eggshells that change color according to hormones, medicines, and nutrients, …

Visual of Nano Product: Nico

Nano Product: Nico

Nico is cute, cuddly and serious about your child’s health. Many adults smoke around children with no thought for their developing lungs. Covered in nicotine-sensitive nano-cloth, …

Visual of Nano Supermarket 2nd Edition: Call for Products

Nano Supermarket 2nd Edition: Call for Products

We call upon designers, technologists and artists to submit their speculative nanotech products for the next round of the NANO supermarket.

Visual of Nanotech Generates the Blackest Black

Nanotech Generates the Blackest Black

As the NANO Supermarket opens discussions on the ethics, purpose and usability of nanotechnology, Frederik De Wilde is researching its artistic possibilities. De Wilde is a guest …

Visual of Rachel Armstrong - Living Architecture

Rachel Armstrong - Living Architecture

Venice, Italy is sinking. To save it, Rachel Armstrong says we must develop living technology.

Visual of To Generate Electricity, Just Tap on this Virus

To Generate Electricity, Just Tap on this Virus

Is your friend impatiently tapping on her phone, or is she just charging the battery? Researchers at the Berkeley Lab have produced the first virus-powered generator that runs off …

Visual of Tuur van Balen – Hacking Yoghurt

Tuur van Balen – Hacking Yoghurt

Designer Tuur van Balen argues biotechnoloyg is actually very accessible and creates an 'anti-depressant yoghurt' on stage.

Visual of Walter Benjamin on Film and the Senses

Walter Benjamin on Film and the Senses

During the late 1930’s the philosopher Walter Benjamin wrote its widely influential essay ‘The work of Art in the Age of Its Technical Reproducibility’. While describing a general …

Visual of What do AR-Burgers taste like?

What do AR-Burgers taste like?

Augmented Reality is supposed to be just over the "Peak of Inflated Expectations" of Gartner's hype cycle . This video, however, is vaulting the technology directly onto the …

Visual of Gathering Electricity from the Atmosphere

Gathering Electricity from the Atmosphere

"Atmospheric energy" has the power to revolutionize the production of electricity.

Visual of Control Your Environment with Myo

Control Your Environment with Myo

A new armband interprets your muscle contractions to act as a novel computer interface.

Visual of Demo Day at Next Nature Lab

Demo Day at Next Nature Lab

Unpolished creativity at the Next Nature lab from the Industrial Design Department at the Eindhoven University of Technology.

Visual of Design Looking Backwards

Design Looking Backwards

Should digital technology imitate that which exists, or could it also surpass it?

Visual of Electricity Travels Through Spider Web

Electricity Travels Through Spider Web

In future electric cables could be made ??of spider webs. 100% natural electric cables, sounds like an oxymoron, but it’s possible! Researcher at Na tional High Magnetic Field …

Visual of Le Bistro In Vitro @ Dutch Design Week

Le Bistro In Vitro @ Dutch Design Week

This whole week you can come and taste meat ice at Le Bistro In Vitro in the main hall of Eindhoven University of Technology.

Visual of NANO Supermarket 2014 Call for Products

NANO Supermarket 2014 Call for Products

Submit your speculative product to the NANO Supermarket and win 2500 euro.

Visual of Nanosponges

Nanosponges "Soak Up" Toxins and Antibiotic-Resistant Bacteria

Nano-scale sponges show promise for defeating a variety of bacteria and toxins.

Visual of Yes, Naturally

Yes, Naturally

The introductory essay from the Yes, Naturally book - available in our store!

Visual of A Conversation with Kevin Kelly

A Conversation with Kevin Kelly

Buckle up for a 1:11:28 interview with technology philosopher and founding editor of Wired Magazine, Kevin Kelly.

Visual of Bionic Plants

Bionic Plants

Scientists designed a way to improve the efficiency of plants light harvesting during the photosynthesis, using nanotechnology.

Visual of NANO Supermarket New Line of Products

NANO Supermarket New Line of Products

During the 2014 Dutch Design Week, the NANO Supermarket debuts a new line of speculative nano products.

Visual of No Future for Traditional Meat

No Future for Traditional Meat

At Home in the Lab with Mark Post, Father of the In Vitro Hamburger. Interview from The In Vitro Meat Cookbook

Visual of Styles for Anti-Face Detection

Styles for Anti-Face Detection

The desire to avoid face recognition algorithms could bring us a whole new set of make up styles,

Visual of The Carnery - A Cultured Future with In Vitro Meat

The Carnery - A Cultured Future with In Vitro Meat

In vitro meat has the capacity to transform meat production as we know it, introducing an entirely new way of thinking about and interacting with food.

Visual of The Evolution Of The Desk 1980 - 2014

The Evolution Of The Desk 1980 - 2014

Objects that normally used to surround us became more and more virtual, radically changing the aspect of our workplace.

Visual of Diseases Of The Future

Diseases Of The Future

Nowadays humans suffer from diseases that didn't exist in the past, a trend that will probably continue into the future. A wide range of new disorders, especially related to the …

Visual of Fake Nature can Prevent Climate Change

Fake Nature can Prevent Climate Change

Scientists are working on an ingenious approach to carbon capture that will enhance the way plants isolate carbon dioxide from other emissions in order to contain it.

Visual of Hacking Human Cells to Use Solar Power

Hacking Human Cells to Use Solar Power

A new biotech startup seeks to hack our cells to use solar energy instead of carbon and oxygen.

Visual of Instageneration: Kids Named after App Filters

Instageneration: Kids Named after App Filters

Technology breaks as an inspiration for names. Among the most popular names of 2015 we can find Instagram filters.

Visual of Interview: Bruce Sterling on the Convergence of Humans and Machines

Interview: Bruce Sterling on the Convergence of Humans and Machines

We had the honor of hosting Bruce Sterling in our Next Nature Network headquarters to talk to him about the concept of the convergence of humans and machines.

Visual of Let Strangers Cheer You up on Twitter

Let Strangers Cheer You up on Twitter

There is now a new application that allows random people to cheer you up on Twitter.

Visual of Abandoning Modern Life to Live as a Goat

Abandoning Modern Life to Live as a Goat

Conceptual designer Thomas Thwaites is currently investigating and experiencing to live life as a goat.

Visual of Next Nature Talk at IoTx in Dubai

Next Nature Talk at IoTx in Dubai

Going to the lustrous IoTx conference in Dubai this year? Don’t miss out the Next Nature lecture.

Visual of Australians Wake Up One Hour Early Due to System Error in Their Mobile Phones

Australians Wake Up One Hour Early Due to System Error in Their Mobile Phones

The glitch meant many woke an hour earlier than usual, leaving not just phone customers but whole households unhappy about rising early.

Visual of You Can Be the Avatar by 2040

You Can Be the Avatar by 2040

Although it still is a theory, nanotechnology might enable us to control the elements, except fire.

Visual of 3D-Printed Shell to Save Tortoise's Life

3D-Printed Shell to Save Tortoise's Life

A severely injured tortoise was saved by a team of doctors thanks to a 3D printed shell.

Visual of Artificial Senses for Navigation

Artificial Senses for Navigation

A team of cyborgs and digital enthusiasts developed a wearable technology for the body that perceives a human sixth sense.

Visual of The First Beauty Contest Judged by AI

The First Beauty Contest Judged by AI

The first beauty contest judged by complex algorithms has sparked controversy after biased results.

Visual of Cars Are Ready to Recognize Us

Cars Are Ready to Recognize Us

We already recognize faces in our cars, now it is time for our cars to recognize our faces.

Visual of A Cryptocurrency Helping to Cure Cancer

A Cryptocurrency Helping to Cure Cancer

Part two of a ten part series exploring the design of an invisible technology: money.

Visual of Foster’s Prototype for a Droneport

Foster’s Prototype for a Droneport

Norman Foster's project for a Droneport that will give a valid, affordable alternative to reach and bring help to remote areas.

Visual of Tangible Money in Digital Currency Era

Tangible Money in Digital Currency Era

The Scrip, a new universal cash device is bringing back the old metallic sparkle of the money and mixing it with today’s technology in order to fill the deficiencies of our credit and debit cards.

Visual of The Non-Disposable Disposable Razor

The Non-Disposable Disposable Razor

We recently stumbled upon a rare mutation: the non-disposable disposable razor.

Visual of The Robots of Tomorrow: Biodegradable

The Robots of Tomorrow: Biodegradable

What happens to robots that are no longer needed? In the future robots will be biodegradable.

Visual of Virtual Bedtime Stories

Virtual Bedtime Stories

Samsung just revealed the prototype version of Bedtime VR Stories, a technology that connects parents to their children in virtual reality, right before bedtime.

Visual of Cultured Meat Closer to Reality

Cultured Meat Closer to Reality

Many companies are seeing the potential of this technology to solve food scarcity, reduce pollution and offer cruelty free meat. One of these firms is Tyson Foods, the meat giant.

Visual of 1999 - Ectogenesis Enters The Matrix

1999 - Ectogenesis Enters The Matrix

The movie The Matrix brought ectogenesis to the public eye.

Visual of AI & VR Impact on Architects and Engineers

AI & VR Impact on Architects and Engineers

Future workspace, human interaction and unique experiences: here’s how artificial intelligence and VR impact on architects and engineers.

Visual of Artificial Womb: the Timeline

Artificial Womb: the Timeline

NNN is currently doing a preliminary research into the idea of the artificial womb. This timeline will help you navigate through the investigation.

Visual of Design Your Own Vegetables

Design Your Own Vegetables

With her project Future Food Formula, food designer Chloé Rutzerveld is looking for innovative methods to design vegetables.

Visual of ECO Coin Award Interviews: Ritsert Mans

ECO Coin Award Interviews: Ritsert Mans

We asked Ritsert Mans, our second ECO coin award nominee about his bike, the technology that fuels it and his hopes for the future.

Visual of ECO Coin Award Interviews: Sandra Rey

ECO Coin Award Interviews: Sandra Rey

We asked Sandra Rey, our third ECO Coin Award nominee, about her company Glowee and her hopes for illuminating the future in a more sustainable way.

Visual of Growing Mushrooms on Grass

Growing Mushrooms on Grass

The Juncao Technology Project makes it possible to grow edible and medicinal fungi on chopped grass or herbal plants.

Visual of The Internet of Bees

The Internet of Bees

What can we learn from listening to the buzz of bees' conversation? With the help of a new monitoring system, a Canadian researcher is hoping to find out.

Visual of Will Kites Provide Wind Energy in the Future?

Will Kites Provide Wind Energy in the Future?

If you’ve watched clouds roll by, you know wind moves more steadily in the upper atmosphere. Turbines just can’t reach high-altitude wind energy. Kites can!

Visual of New in: Next Nature Memory Game

New in: Next Nature Memory Game

We are pleased to announce the launch of the Next Nature Memory Game. Now available in our web shop, it playfully explores the shifting borders between biology and technology.

Visual of Payment by Wedding Ring

Payment by Wedding Ring

The Tappy 'smart ring' is a wedding ring connected to your bank account.

Visual of Personhood Status for Robots

Personhood Status for Robots

An "electronic personhood" for robots has been discussed in the European Parliament recently, raising big questions about equality, citizenship, legal and ironically, human rights for artificial intelligent machines.

Visual of Read the Entire Artificial Womb Series

Read the Entire Artificial Womb Series

We published a timeline series to explore medical, cultural and technological developments in relation to the ectogenesis concept.

Visual of Jobs for Caretakers - Robots at Work #1

Jobs for Caretakers - Robots at Work #1

This is post number one of our serie 'Robots at Work'. In this episode we present you five jobs for caretakers, the ones that work with their hearts.

Visual of How AI and genomics will impact the future of making babies

How AI and genomics will impact the future of making babies

As if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …

Visual of Adding a new dimension to marine restoration: 3D printing coral reefs

Adding a new dimension to marine restoration: 3D printing coral reefs

The local fishermen looked on skeptically. From the deck of a small motorboat, scuba divers grabbed odd chunks of ceramic – which could be described as rocky brains stuck on …

Visual of Towards a design brief for the artificial womb

Towards a design brief for the artificial womb

Humanity is facing the disconnection between biological reproduction and the body, facilitated by the emerging technology of the Artificial Womb. Envisioned in bleak science …

Visual of Here's all you need to know about the future of the ECO Coin (and how it came about)

Here's all you need to know about the future of the ECO Coin (and how it came about)

Today is Earth Day! This means that we think about the relationship between man, nature and technology, as technology is becoming a nature of its own. Acknowledged in 192 …

Visual of Elzelinde van Doleweerd wins the ECO Coin Award 2018

Elzelinde van Doleweerd wins the ECO Coin Award 2018

The ECO Coin Award honours outstanding ecological heroes. In 2015, we handed out our first ECO Coin award to Yoyo Yogasamana for his digitalization of sustainable knowledge to …

Visual of I like my steak lab-grown, not-grass fed

I like my steak lab-grown, not-grass fed

Right now, somewhere in a laboratory in California, the Netherlands or Japan, a technician is taking a few thousand skeletal muscle cells from a living animal, and placing them in …

Visual of 'I volunteer myself to try this cultured meat at my own risk'

'I volunteer myself to try this cultured meat at my own risk'

The Netherlands leads in cheese, clogs, and cultured meat. This sustainable and animal-friendly form of meat has largely been developed in our country. In 1997, Willem van Eelen …

Visual of Should lab-grown meat be labelled as meat when it's available for sale?

Should lab-grown meat be labelled as meat when it's available for sale?

Australian regulators will soon be faced with a challenge: can animal flesh produced in a lab be called meat? Amid reports that lab-grown meat could be on sale this year, the US …

Visual of A phone that says “no” to little kid fingers

A phone that says “no” to little kid fingers

It may soon be possible for your phone to automatically figure out whether it’s you or your five-year-old who’s swiping the screen—and, if it’s the latter, block apps you want to …

Visual of Aleph Farms wants to bring clean meat from the lab to the next farming industry

Aleph Farms wants to bring clean meat from the lab to the next farming industry

Growing meat artificially, instead of within an animal, may soon be an available reality. Meet one of the pioneering developers of this product of the future: Aleph Farms. With …

Visual of Scientists accidentally create mutant enzyme that eats plastic bottles

Scientists accidentally create mutant enzyme that eats plastic bottles

Scientists have created a mutant enzyme that breaks down plastic drinks bottles – by accident. The breakthrough could help solve the global plastic pollution crisis by enabling …

Visual of The Story of Money: Bits

The Story of Money: Bits

The story of money: an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. The final episode: bits.

Visual of Explore your relationship with AI

Explore your relationship with AI

What makes us human? And why do we sometimes fear artificial intelligence? And what about technological singularity - the moment in time when artificial intelligence outperforms …

Visual of An introduction to biomimicry

An introduction to biomimicry

The first time I explained biomimicry to a stranger was not in a talk or a workshop but in a big-box bookstore just after Biomimicry: Innovation Inspired by Nature had come out. I …

Visual of This exhibition investigates how humans will live tomorrow

This exhibition investigates how humans will live tomorrow

Occupying the 52nd floor of Tokyo’s Mori Tower, Mori Art Museum is internationally renowned for its visionary approach and highly original curation of contemporary art. The …

Visual of Gène Bertrand on design for human needs

Gène Bertrand on design for human needs

Nature has always been a source of inspiration for many artists and designers, yet the urgency to connect to nature is more pressing than ever. Environmental issues such as …

Visual of Oded Ezer discusses the future of typography and the importance of dreaming

Oded Ezer discusses the future of typography and the importance of dreaming

Oded Ezer is a typographer from Israel who never fails to push boundaries, or rather, discard them altogether. Ezer is a rebellious force that swings between commercial and …

Visual of Taco futures: In vitro meat in Mexico City

Taco futures: In vitro meat in Mexico City

Our In Vitro Meat Cookbook has inspired many people around the world. Just recently, we had the BBC over at our headquarters to see what makes us thick. This idea of in vitro meat …

Visual of A vegan meat revolution is coming to global fast food chains

A vegan meat revolution is coming to global fast food chains

A few years ago, convincing meat-free “meat” was nothing more than a distant dream for most consumers. Meat substitutes in supermarkets lacked variety and quality. Plant-based …

Visual of Who should win the ECO Coin Award 2019?

Who should win the ECO Coin Award 2019?

Each year we celebrate ecological heroes as part of our ECO Coin Award and this year is no different. Have you seen an inspiring person who is making the world a more …

Visual of This startup is growing sushi-grade salmon from cells in a lab

This startup is growing sushi-grade salmon from cells in a lab

As the ills of factory farming become more pronounced, people are increasingly gravitating towards vegetarian or pescatarian diets. Besides producing a large percentage of our …

Visual of How my chatbot fell in love with me

How my chatbot fell in love with me

The virus is forcing all of us to sit at home. While we are allowed to have social contact—albeit at an appropriate distance, intimate contact is hard to find. How to cope with …

Visual of How public camera recordings domesticate us

How public camera recordings domesticate us

Facial recognition is increasingly being used in many countries around the world. In some cases the take up has been dramatic . As a result, people are being observed by cameras …

Visual of In vitro meat (finally) hits the market

In vitro meat (finally) hits the market

Humanity has an insatiable hunger for meat. Since 2013 we have been researching, developing and campaigning for a humane and eco-friendly way to get our protein fix. Since day one …

Visual of Matilde Boelhouwer wants to make urban environments flower again

Matilde Boelhouwer wants to make urban environments flower again

Matilde Boelhouwer is a designer whose work speculates between art, design, science, biology and food. Matilde shapes this obligation into a studio which mainly focuses on the …

Visual of Embracing the Future with Patricia Piccinini

Embracing the Future with Patricia Piccinini

Patricia Piccinini is an artist interested in the relationship between humans and non-humans, the natural and the artificial, science and storytelling. Working with silicone, …

Visual of Next Generation: Cooking with viruses with Pei-Ying Lin

Next Generation: Cooking with viruses with Pei-Ying Lin

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here?  Get in touch  and …

Visual of Next Generation: Combining AI with human creativity with Sofia Crespo

Next Generation: Combining AI with human creativity with Sofia Crespo

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here?  Get in touch …

Visual of Next Generation: Speculating about the future with Deborah Rhyner

Next Generation: Speculating about the future with Deborah Rhyner

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of Swiping is the new touching

Swiping is the new touching

From all the memes that have reached me through my screen since the outbreak of the corona pandemic, there is one that perfectly reflects my thoughts in the beginning of March …

Visual of 14 Golden Rules of working with a robot

14 Golden Rules of working with a robot

The 14 Golden Rules of HUBOT are rules of conduct which must be followed and which everyone needs to hold each other to account. Themes like respect, teamwork, creativity, and …

Visual of Coffee without the beans

Coffee without the beans

As with many of the products we consume, there’s a cost beyond what we pay at the store. Producing coffee has an environmental cost, too.

Visual of Cyborg mythologies #3: in god we trust, all others bring data

Cyborg mythologies #3: in god we trust, all others bring data

This is #3 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …

Visual of Next Nature plans for Evoluon honored with Region Deal

Next Nature plans for Evoluon honored with Region Deal

Good day astronauts of spaceship Earth! Today it was announced that Next Nature's plans for the Evoluon have been awarded a financial contribution of €7.6 million from the Region …

Visual of In conversation with cyborg choreographer Moon Ribas

In conversation with cyborg choreographer Moon Ribas

If we could extend our senses in order to perceive the planet in a deeper way, would our understanding and our behavior towards it be different? We caught up with cyborg …

Visual of Join us at the DDW Talks: Next Biodiversity

Join us at the DDW Talks: Next Biodiversity

The influence of humans on the earth can hardly be underestimated. Think of climate change, deforestation, and the decline of biodiversity. We are heading for a sixth mass …

Visual of Next nature disasters: the Facebook outage of 2021

Next nature disasters: the Facebook outage of 2021

Where were you on the 4th October 2021? During the day that will be remembered for the Facebook outage, not everyone was equally impacted.

Visual of Don't miss this multi-sensory exhibition by Studio Drift

Don't miss this multi-sensory exhibition by Studio Drift

Shimmering lights drifting as elm seeds in the wind, luminous strings of light shifting between man-made and natural structures, dandelion seeds melding with brass and light. …

Visual of To save forests, researchers are hooking trees up to Twitter (again)

To save forests, researchers are hooking trees up to Twitter (again)

In July 2018, a century-old red oak went live on Twitter. The account @awitnesstree , tweeting from the Harvard Forest in Petersham, Massachusetts, introduces itself in its bio: …

Visual of Emma van der Leest wins ECO Coin Award 2022

Emma van der Leest wins ECO Coin Award 2022

Each year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honour them with our  ECO Coin …

Visual of FIBER Festival 2022: an exploration towards an alternative future

FIBER Festival 2022: an exploration towards an alternative future

FIBER Festival explores the future of a changing world through audiovisual art, daring conversations, and experimental electronic music.

Visual of The Limits and Beyond: A report about the future

The Limits and Beyond: A report about the future

In 1972, the Club of Rome published The Limits to Growth, a report about the future of the world. They described the limits of the world’s resources and what it is capable of …

Visual of Meet a group of young plant scientists who share their belief in the potential of CRISPR

Meet a group of young plant scientists who share their belief in the potential of CRISPR

In the summer of 2018, the European Court of Justice (that’s Europe’s highest court) reviewed a case and concluded that gene-edited crops should be subject to the same regulations …

Visual of Personalise your gut health with Microbiota To Go

Personalise your gut health with Microbiota To Go

In the supermarket of the future, part of the Embassy of Food at Dutch Design Week, designer Merle Bergers will present her project Microbiota To Go.

Visual of The Moon Gallery: the first museum in space

The Moon Gallery: the first museum in space

The Moon Gallery aims to set up the first permanent museum on the Moon. Soon launching to the International Space Station, full of ideas worth sending to the Moon. The gallery is …

Visual of The information age is starting to transform fishing worldwide

The information age is starting to transform fishing worldwide

People in the world’s developed nations live in a post-industrial era, working mainly in service or knowledge industries. Manufacturers increasingly rely on sensors, robots, …

Visual of Afrofuturism explained by Professor Julian C. Chambliss

Afrofuturism explained by Professor Julian C. Chambliss

The new sci-fi musical “ Neptune Frost ,” set in a Rwandan village constructed with computer parts, tells the story of an intersex hacker and a coltan miner who lead an anarchist …

Visual of This satellite generates and sends solar energy to Earth

This satellite generates and sends solar energy to Earth

The next solar farms might be located in space, instead of on Earth. A prototype satellite by Caltech launched in January seems to be up and running, showing its capability to …

Visual of Carnerie is the grow your own meat device of the future

Carnerie is the grow your own meat device of the future

This speculative kitchen device shows us a future where growing meat at home is not just a possibility but a reality.

Visual of Using bacteria to create self-fired and biologically glazed ceramics

Using bacteria to create self-fired and biologically glazed ceramics

Embracing nature's ingenuity, designer Nicole Chrysikou harnesses the power of bacteria for her pottery practices.

Visual of What food design can do

What food design can do

Food design gives us a taste of innovation. It visualizes, speculates, challenges and problem-solves.

Visual of Geodesign

Geodesign

We have identified eight key defining moments that tell the story of geodesign, from ancient insight to artificial intelligence.

Visual of Nurturing architecture

Nurturing architecture

The way we currently build is not sustainable. We will have to develop a sustainable living environment that matches our human needs, intuitions and potential.

Visual of The solar home

The solar home

Today, solar is science. But why can’t energy be beautiful too?

Visual of 5 must see exhibitions in 2023

5 must see exhibitions in 2023

1. THE FUTURE IS PRESENT Design Museum Danmark How will contemporary design define the future? THE FUTURE IS PRESENT grasps the very essence of Danish artistry of material …

Visual of Cameleon concept car

Cameleon concept car

The GloCar uses LED lights to change body panel colours, intensity and frequency. A driver can thus choose at will to either stand out or blend in. Alongside the cosmetic value …

Visual of Excitement Clothing

Excitement Clothing

The body suit pictured above has LEDs that illuminate according to the wearer's state of excitement. Skin signals are measured and change light emission through biometric sensing …

Visual of How to grow an Orangina bottle.

How to grow an Orangina bottle.

Consider an Orangina bottle: shaped like an orange it is designed to look like one. But it does so in a very primitive way. Imagine the product is the packaging. Wouldn't it be …

Visual of Plant Sensors

Plant Sensors

One day you will step into the garden to look at the flowers - and the flowers will look back at you. Rich Fletcher, Nikolai Slavov, and Hiroshi Ishii from MIT Tangible Media …

Visual of Save our Next Nature! Buy the book

Save our Next Nature! Buy the book

A critical and visual take on culturally emerged Nature. Full of statements from designers and thinkers from around the globe. Wild systems, Genetic Surprises, Calm Technology, …

Visual of Bio inspired Architecture

Bio inspired Architecture

This cell-shaped building for the institute for Nanobiomedical Technology & Membrane Biology in Chengdu, China, is an unusual croos-disciplinary collaboration between MIT …

Visual of Brain-computer interface for Second Life

Brain-computer interface for Second Life

While recent developments in brain-computer interface (BCI) technology have given humans the power to mentally control computers, nobody has used the technology in conjunction …

Visual of Brainbow Mice

Brainbow Mice

In the 1960s, scientists found that a particular jellyfish makes a protein that glows, known as green fluorescent protein. In the 1990s, using genetic engineering, researchers …

Visual of Cockroach Controlled Mobile Robot

Cockroach Controlled Mobile Robot

By putting this cockroach in control over a mobile robot, our perception of the animal is changed. Technology empowers the little creature you would normally squash under your …

Visual of Deep in the Forest : Owls, Logs and Noise

Deep in the Forest : Owls, Logs and Noise

Starting as noise makers, the owlproject work on different products which are deeply rooted in nature. And electronics.With their logs the owlproject travel around the world, …

Visual of Hug T-Shirt

Hug T-Shirt

If you're longing for the touch of a loved one who is a few thousand miles away, what better way than to pick up the Hug Shirt for the both of you? This shirt is capable of …

Visual of Liquid armor

Liquid armor

The US Army Research Lab in collaboration with the University of Delaware developped a special liquid called s hear thickening fluid . It is actually a mixture of hard …

Visual of Philips Wake Up Light - Sunrise Alarm Clock

Philips Wake Up Light - Sunrise Alarm Clock

Philips hits the shops with a product that aims to naturalize alarm clocks. The annoying buzzing machines were once invented to cultivate our day/night rhythms, formerly connected …

Visual of The Desktop Factory - Do It Yourself

The Desktop Factory - Do It Yourself

Nowadays, most people can't make anything at home because it's too expensive. Roboticist Hod Lipson wants you to stop shopping and use his portable 3-D printer to make your own …

Visual of Tickle Massage Robot

Tickle Massage Robot

Tickle is a small robot that walks on the human body to generate a pleasant, tickling sensation.It has two motors and rubber feet for a good grip on the skin. When it encounters a …

Visual of Who wants to drive in a Fish?

Who wants to drive in a Fish?

Behold the BoxFish, Mercedes' bionic concept car. This tropical fish is outstandingly streamlined. Its engineers were able to achieve a wind drag coefficient of just 0.06 in the …

Visual of A Mobile Phone Embedded in Asphalt

A Mobile Phone Embedded in Asphalt

If future anthropologists would ever dig up this cellphone, they might identify it as some sort of mysterious pseudo-religious device carried around fervently by early 21th …

Visual of Car tech makes reality look like a game

Car tech makes reality look like a game

Tech company Fuijtsu released a new way to look around you while driving a car. Following the old fashioned neck turning and mirroring this tech has cameras around the vehicle to …

Visual of Catch and eat fishing by phone

Catch and eat fishing by phone

For mobile gamers in western Japan, a hearty seafood dinner awaits just a few key clicks away, thanks to a unique new cellphone fishing game that rewards successful players with …

Visual of Dogpause

Dogpause

According to the inventors of the dogpause bowl , slow eating dogs are happier than fast eating dogs. Having a dog in the first place is supposed to improve the quality of life, …

Visual of Gameboy Bricks a million years from now

Gameboy Bricks a million years from now

A million years from now that hand would probably look more evolved, but the idea is nice: What if we would mold objects of the now into stone or bricks to preserve them over time …

Visual of Smart Forests - EWAN

Smart Forests - EWAN

At Massachusetts Institute of Technology , Christopher Love and colleagues are working to find out whether energy from trees can be used to prevent forest fires. A sensor system …

Visual of Social Networking down to the Genetic Level

Social Networking down to the Genetic Level

If you've ever wanted to know just exactly how much DNA you share with your ridiculously tall brother or doppelganger best friend, you'll soon be able to find out. 23andMe , a …

Visual of Tail communicator

Tail communicator

'The LED Dog Tail Communicator' is an initiative of James Auger and Jimmy Loizeau, and it is part of the larger 'Augmented Animals' project. Its focus points to technological …

Visual of The Evolution of the Richer

The Evolution of the Richer

Are we on the verge of a future human evolution, one that isn’t, at least in it’s very core, “the survival of the fittest”, but rather “the evolution of the richer”? Think about …

Visual of 'Atlantis' Turns out to be Interfacial Artefact

'Atlantis' Turns out to be Interfacial Artefact

Since the days of Plato, the lost city of Atlantis has captivated the imagination of many.  The city, if you don’t already know, was said to be a naval power located roughly 600 …

Visual of Bioinstinct

Bioinstinct

Designer Laura Boffi envisions a future in which human instincts will leap behind on technological progress. For example, once the 'disease called mortality' is cured with …

Visual of Bioluminescent Trees will Replace Streetlights?

Bioluminescent Trees will Replace Streetlights?

Most people know about light emitting organisms such as jellyfishes, fireflies and mushrooms . Some time ago, genetic engineers transferred genes responsible for the luciferin and …

Visual of BioStream

BioStream

A renewable energy technology company in Australia designed this power generation system inspired by the shape of the tailfins of sharks, tuna and mackerel. The currents on the …

Visual of Brain Scan Replaces Job Interview in 5 Years?

Brain Scan Replaces Job Interview in 5 Years?

Forget about palmistry! MRI scans for candidates in top jobs such as bank directors could soon become part of the job-application package, says Erasmus University researcher Prof …

Visual of China limits use of 'virtual' currencies

China limits use of 'virtual' currencies

By DAVID BARBOZA SHANGHAI — China made public on Tuesday regulations aimed at cracking down on the use of virtual currencies amid worries that a huge underground economy was …

Visual of Computational Wood

Computational Wood

Dr. Herb Smokler teaches us how to husband and harvest Computational Wood. Omitting he jerky production value of the video, one has to appreciate the inventive idea of treating …

Visual of Designing for NextNature @ TU Eindhoven

Designing for NextNature @ TU Eindhoven

Starting February 2009 the Industrial Design department of the Eindhoven University of Technology takes Next Nature as one of its educational themes. The Industrial Design …

Visual of Do It Yourself Pet

Do It Yourself Pet

Image: A. Sidorov Have you ever fantasized about creatures which carry the biggest smile? Or creatures which are so deeply covered with fur that you wish they were real? Good …

Visual of Energy-aware Internet-routing

Energy-aware Internet-routing

Data-hungry companies like Google, Microsoft and Amazon could reduce their energy consumption with 40% by rerouting data to locations where electricity prices are lowest on a …

Visual of Freshness Label

Freshness Label

Japanese design agency To-Genkyo proposes a dynamic freshness label for meat products. The hourglass-shaped label contains special ink that changes color based on the amount of …

Visual of GPS influence on street signage?

GPS influence on street signage?

In the future, every street will be a Nokia street? Perhaps not, however we may expect some changes in street signage due to the arrival of mobile & gps technology. Once …

Visual of Growing a nano forrest

Growing a nano forrest

John Hart, assistant professor of mechanical engineering at the University of Michigan, is inventing techniques for growing carefully structured forests of high-quality carbon …

Visual of Implantable Silicon-Silk Electronics

Implantable Silicon-Silk Electronics

Scientists of the University of Pennsylvania are creating electronics that almost completely dissolve inside the body, through the use of thin, flexible silicon electronics on …

Visual of Melting polar bear reveals a metal skeleton

Melting polar bear reveals a metal skeleton

Unsure how this melting polar bear ice sculpture created by artist Mark Coreth fits in Next Nature mythology. The art piece was presented last week in Copenhagen and is sponsored …

Visual of Millions of gadgets unused in Britain

Millions of gadgets unused in Britain

Gadgets! You love them when you buy them, but what happens next? Over half of Brits have abandoned gadgets because they don't know how to use them properly.  Seventy-one per cent …

Visual of Nanocars

Nanocars

This smart-looking image is a model of what James M. Tour at Rice University (Texas) and his research team like to call a 'nanocar'. The clustered molecules can roll around on a …

Visual of Reprogramming Skin Cells into Stem Cells

Reprogramming Skin Cells into Stem Cells

A major breakthrough in the world of genetics: Researchers have successfully reprogrammed skin cells into stem cells. Using a technique called iPS cell reprogramming (developed in …

Visual of Scientists 'grow' pork

Scientists 'grow' pork

Scientists at the Eindhoven University of Technology are creating artificial pork. Prof. Dr Mark Post and his colleagues of the department of Biomedical Engineering have extracted …

Visual of Second Sight - Augmented Contacts

Second Sight - Augmented Contacts

Getting information as fast as possible and on the spot is the trend. So what could be more direct than having information fired directly into the eye? Today - together with his …

Visual of Virtual Money Is a Pleonasm

Virtual Money Is a Pleonasm

Have you heard the buzz on virtual money in online games? Some years ago the first virtual millionaire was announced, yet there have also been reports on people being practically …

Visual of Cough in Your Cell Phone, not Your Sleeve

Cough in Your Cell Phone, not Your Sleeve

Coughing into your cell phone could soon save you a trip to the doctor's office. Thanks to software currently being developed by Star Analytical Services , people may soon be able …

Visual of Digital Trashcan in a Physical Office

Digital Trashcan in a Physical Office

The Swedish design group Front brings the principle of the digital computerdesktop trashcan back to the physical world. When your trashcan basket is full it bulges outward. When …

Visual of Engineered Bacteria heal Cracks in Walls

Engineered Bacteria heal Cracks in Walls

Researchers have designed bacteria that can produce a special glue to knit together cracks in concrete structures. Technews Daily reports the genetically modified microbes have …

Visual of European Parliament goes Next Nature

European Parliament goes Next Nature

Alright the title "Making Perfect Life" ' may sound a bit 20th-century-modernistic-techno-optimistic-naive, but for the rest we are confident this conference is going to be pretty …

Visual of Google Earth Alphabet

Google Earth Alphabet

Language is communication technology. As Marshall McLuhan said, the spoken word was ‘the first technology by which man was able to let go of his environment in order to grasp it …

Visual of Hamster Powered Mobile Phonecharger

Hamster Powered Mobile Phonecharger

We would call this a sustainable technology if only the average pet's carbon footprint wouldn't be comparable to that of an SUV .

Visual of HappyLife

HappyLife

As our everyday living spaces are packed with electronics and become increasingly sentient, we might one day wake up in a house that knows more about your family's state than you …

Visual of How does your Graph feel today?

How does your Graph feel today?

With all the new health management gadgets available becoming more and more widespread and cheap (even in the form of free iPhone apps),  your brain, your stomach, your heart, …

Visual of MANKO & Plagiarism [#1]

MANKO & Plagiarism [#1]

In this first review of the works of Manko, we'll discuss the complex sorts of plagiarism in Augmented Reality art that are typical for our contemporary art scene. This introduces …

Visual of Manko & The Invitation [#3]

Manko & The Invitation [#3]

Last month we discussed how the vacuum played a big role in Manko's life since he lost his right leg. Soon he developed this idea further, beyond the mere notion of extensions …

Visual of Nano Care™ Blueberry Paste Wax

Nano Care™ Blueberry Paste Wax

Surely we are quite attuned to some unexpected flavors in these quarters, but this Nano Care™ Blueberry Paste Wax wins our syncretic mash-up award for combining technorethoric …

Visual of Nano Product: The Food Printer

Nano Product: The Food Printer

Are we creating the penicillin or the asbestos of the 21st century? In the months preceding our Nano Supermarket Project , we share some speculative nanotech products with you. …

Visual of One day at the Dentist

One day at the Dentist

Do you also have that feeling sometimes that your dentist is undertaking all kinds of activities in your mouth that aren't really necessary? Yet, you usually just trust the …

Visual of Palmtree Drilling Platform

Palmtree Drilling Platform

In our ‘ under the beach lies the pavement ’ series. Already in 1973, Steven M. Johnson drew cartoons of oil drilling platforms disguised to look like palm trees, in an attempt by …

Visual of Robo-fly

Robo-fly

Waiter, there's a robot in my soup! Weighing only 60 milligrams, with a wingspan of three centimeters, robo-fly's tiny movements are modeled on those of a real fly. While much …

Visual of Self-healing Surfaces

Self-healing Surfaces

What if a scratch on your car door could heal itself, just like the human skin does? Engineers are working on a way to transfer the self-healing ability of the skin to surfaces …

Visual of Nano Product: Spider Silk Condoms

Nano Product: Spider Silk Condoms

Are we creating the penicillin or the asbestos of the 21st century? In the months preceding our Nano Supermarket Project , we share some speculative nanotech products with you. …

Visual of Traces of Everyday Embedded in Textile

Traces of Everyday Embedded in Textile

The ‘Decay’ project explores how traces of time and use can be embedded in textile. By wearing a carbon fibre suit over a white blouse, textile designer Marie Ilse Bourlanges …

Visual of When Dreams become a Commodity

When Dreams become a Commodity

As neuroscience progresses, we gain access to previously inaccessible and unexplored areas of the human mind. Consequentially the intricate processes in our brain are cultivated …

Visual of A Savannah Inside the Dumpster

A Savannah Inside the Dumpster

For most of us, obtaining food is easy.  We go to the grocery store, where fruits are labeled and meats arranged by species.  We go to a restaurant, sit, and wait for our food to …

Visual of Allergen Beagle – A Home Foodscanner

Allergen Beagle – A Home Foodscanner

No shellfish, no peanuts, no soy, no milk, no eggs. An increasing number of people suffer from various food allergies, which force them to constantly scan food packages for …

Visual of Cheiracanthium drives a Mazda

Cheiracanthium drives a Mazda

In March, Mazda recalled 65,000 cars, not because of any structural faults in the vehicle, but because the engineers had inadvertently created the perfect habitat for a tiny …

Visual of Crickets Inspire New Sensitive Sensor

Crickets Inspire New Sensitive Sensor

Inspired by crickets, researchers of the MESA+ Institute for Nanotechnology of the University of Twente in the Netherlands have build a biomimetic sensor that can measure changes …

Visual of First Lab-Grown Organ Transplanted

First Lab-Grown Organ Transplanted

Another step in the fusion of the made & the born: Surgeons in Sweden have successfully transplanted a fully synthetic, tissue-engineered organ – a trachea– into a man with …

Visual of Manko & Nothing [#5]

Manko & Nothing [#5]

Manko was completely cut off from everything around him, virtually dead, buried alive inside of his own body. He remembered Zero's advice not to panic, but to no effect. He had no …

Visual of Manko & Soup  [#6]

Manko & Soup [#6]

When Nada returned as promised with a small bowl of soup in her hands, Manko was sitting upright with a grumbling stomach. Even now that Manko could see normal again, Nada's hair …

Visual of Manko & The Earth [#12]

Manko & The Earth [#12]

Zero: 'Where to begin? We've had many discussions in our Lab about the future of the children. The plan was simple: to raise the kids to the physical age to be 'frozen' in. Then, …

Visual of Nano Supermarket in Amsterdam

Nano Supermarket in Amsterdam

From Friday 28 January - Wednesday 2 Februari the Nano Supermarket will be opened at the Leidseplein in Amsterdam. Additionally, on the 27th of January we will be opened at the …

Visual of Nano Supermarket visits Pamplona, Spain

Nano Supermarket visits Pamplona, Spain

From 9 - 14 March 2011 the Nano Supermarket opens its doors in Pampona, Spain. The NANO Supermarket presents speculative nanotech products that may hit the shelves within the next …

Visual of Nintendo Portables Are Breeding Grounds For Sexy Fun

Nintendo Portables Are Breeding Grounds For Sexy Fun

Sexuality and sensuality are phenomena which have been a nature for us as long as we humans exist. Not only humans experience these phenomena; also animals experience sexuality …

Visual of Raptor in a Wrapper

Raptor in a Wrapper

The appliance company Bosch claims that its new technology keeps food so fresh that meat from the Ice Age (and presumably the Cretaceous as well) can be stored without incident …

Visual of Sin free for just €1.59

Sin free for just €1.59

For just £1.19 ($1.99, €1,59) you can download an app for your iPhone which offers tips and guidelines with the sacrament, "the perfect aid for every penitent" as the description …

Visual of The Monsters We Deserve

The Monsters We Deserve

Recently, a video clip has been circulating the web that  purportedly shows a rabbit born earless due to the radiation at Fukushima. BoingBoing has a convincing take-down of the …

Visual of The Story of our Food

The Story of our Food

Every time we eat a piece of food, we take a bite out of the world. All these small bites tell a dozen stories. A carton of eggs presents the story of contented hens, a bottle of …

Visual of Theriomorphous Cyborg

Theriomorphous Cyborg

The Animal Architecture Awards have just announced the winners of their 2011 contest. Taking first place is Simone Ferracina's Theriomorphous Cyborg , a (speculative) augmented …

Visual of Traditional Thanksgiving Meat

Traditional Thanksgiving Meat

Food technology in the overdrive: Pork molded in the shape of a piglet.

Visual of When Siri met Siri…

When Siri met Siri…

Like with pets and babies, we seem to like it when devices mimic our behaviour and social patterns. In the process of domesticating technology, we teach products to behave like …

Visual of 'Alp' Turns Containers into Refrigerators

'Alp' Turns Containers into Refrigerators

Transporting and displaying cold food is an incredibly wasteful and inefficient process. Current display refrigerators, like those that display meats or cheeses in supermarkets, …

Visual of Amazon Tribe lacks concept of Time

Amazon Tribe lacks concept of Time

A study, in Language and Cognition has shown that time does not exist as a separate concept for the Brazilian Amondawa  – an Amazon tribe first contacted by the outside world in …

Visual of Brain Implant Restores Memory to Cocaine-Addled Monkeys

Brain Implant Restores Memory to Cocaine-Addled Monkeys

A team of researchers from three universities have succeeded in creating the first device that boosts the brain power of primates. In the study, five rhesus macaques were trained …

Visual of Does Chocolate Milk Come From Brown Cows?

Does Chocolate Milk Come From Brown Cows?

Although chocolate milk producing cows may sound silly, scientists are seriously analyzing the feasibility of the idea. Why not add genes of cocoa and sugar to a cow, in order to create a cow that produces sweet chocolate milk?

Visual of Eating In-Vitro: Meat-Fruit

Eating In-Vitro: Meat-Fruit

La Pâte Meat Fruit aims to seduce and inspire diners with an entirely new eating experience that balances eating meat and fruit. In vitro technology is used to grow meat …

Visual of Meat, the Expectations

Meat, the Expectations

As the planet’s population speeds towards 9 billion, it’s becomes impossible to continue consuming meat like we do today. Will we all be eating rice and beans? Grasshoppers …

Visual of First

First "Farm"aceuticals Grown in Carrots

The United States Food and Drug Administration recently approved Elelyso, the first drug to be grown in genetically modified plant cells. Produced in carrot cells, this drug helps …

Visual of First tasting of Printed Meat

First tasting of Printed Meat

Biological physicist Gabor Forgacs normally works on the “printing” of new organs for use in clinical trials, however, his technology could also be used to bioprint meat. In the …

Visual of Jet Powered Barbecue

Jet Powered Barbecue

At first sight it seems plain wrong to roast your burgers on this utterly technological machine: barbecuing is supposed to be a nostalgic low-tech activity that brings us back to …

Visual of Nano Product: Conception Control

Nano Product: Conception Control

Using a condom impregnated with artificial nano-antigens, Conception Control only permits sperm with the right chromosome to pass through: X for girls, Y for boys. Conception …

Visual of Nano Product: Glo-Doo

Nano Product: Glo-Doo

Dog feces are an unsightly blemish on city streets. With Glo-Doo, dog food laced with bioluminescent bacteria transforms each pile into an appealing way to light up the night. As …

Visual of Nano Product: Keratin Ink

Nano Product: Keratin Ink

Using genetically modified bacteria, Keratin Ink turns your fingernail clippings into a highly personal ink for writing and drawing. The bacteria transform the keratin in your …

Visual of Nano Product: Menoé

Nano Product: Menoé

At the beginning of menopause, celebrate your reproductive past by giving “birth” to a unique peace of jewelry. By using Menoé’s nano-coated birth control pills over a lifetime, …

Visual of Nanotech Diatoms

Nanotech Diatoms

No, those aren't plastic trinkets or beads from a craft store. They're diatoms, a group of single-celled algae, and unlike almost all of our current technologies, they can rapidly …

Visual of Replacing Synapses with a Single Switch

Replacing Synapses with a Single Switch

Neural synapses in the human brain are extraordinarily complex structures. Responsible for relaying information between neurons, chemical synapses govern the release of over 100 …

Visual of

"Smart Highways" to Power Streetlights and Electric Cars

Roads are a ubiquitous, even defining aspect of our urban and suburban spaces. In the United States alone, parking lots and roads cover 16,000 square kilometers. So why must roads …

Visual of Spider-Man Gloves

Spider-Man Gloves

Imagine how much easier the job of window cleaners would be if they could simply scale walls like Spider-Man instead of using elevators, ladders and other gear. Ever since the …

Visual of Transfer Your Window!

Transfer Your Window!

Imagine you buy a special kind of window which you can place on your wall wherever you want, enabling you to get different views, not always looking at the same tree or house of your neighbors.

Visual of Turning Wind Farms into Seaweed Farms

Turning Wind Farms into Seaweed Farms

Closed to commercial shipping and fishing, offshore wind farms aren't put to much use besides generating clean energy. Ecofys , a Dutch sustainable consulting company, hopes to …

Visual of Using Nanoscale Wood Pulp to Replace Metal and Plastics

Using Nanoscale Wood Pulp to Replace Metal and Plastics

Nanocrystalline cellulose (NCC) sounds almost too good to be true. The same microscopic particles that help trees to stand up straight are also lightweight, non-toxic, stronger …

Visual of Watch Out Whales, Humans Want Your Krill

Watch Out Whales, Humans Want Your Krill

Krill, those tiny members of the ocean's planktonic community, have an importance disproportionate to their size. They are a vital food for whales, penguins and increasingly, …

Visual of Why It's Time to Calm Down about

Why It's Time to Calm Down about "Invasive" GM GloFish

Is the neon green tetra GloFish soon to be the florescent, transgenic terror of America's waterways? The internet hype machine has repeated ad infinitum the Washington Post's  …

Visual of Years

Years

Artist Bartholomäus Traubeck created a hyper-nostalgic record player that, rather than making music from vintage vinyl records, uses slices of woods to generate sound.

Visual of

"Algae Opera" Nourishes Algae with a Singer's Breath

Are you blessed with a Maria Callas kind of voice? If, like us, you don't go beyond croaking the occasional " I want to break free" in the shower, watch out. If the artists of …

Visual of Deliver us from Digital Bluntness

Deliver us from Digital Bluntness

Peoples attitudes online are wholly different from their behaviours in real life

Visual of From Eco-Apartheid to Earth Democracy

From Eco-Apartheid to Earth Democracy

Do humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.

Visual of Hire a Hyperreal Girlfriend to Look Better on Facebook

Hire a Hyperreal Girlfriend to Look Better on Facebook

Baudrillard intersects with social media in the world of fake online girlfriends.

Visual of How to Avoid a Global Wine Shortage

How to Avoid a Global Wine Shortage

A global wine shortage is looming. Never fear: Next Nature has a solution.

Visual of How to Grow a Beer Bottle

How to Grow a Beer Bottle

A so-called "natural" beer is marketed by portraying an utterly technological process.

Visual of I’ll Take A Variety of Fried Gadgets, Please

I’ll Take A Variety of Fried Gadgets, Please

Is a deep-fried iPad as unhealthy as a McDonald's meal?

Visual of Implanted into Bacteria, Synthetic DNA Functions as a Diagnostic Computer

Implanted into Bacteria, Synthetic DNA Functions as a Diagnostic Computer

In the movie Fantastic Voyage, a submarine and its crew were shrunk and injected into the body of a sick man in an attempt to save his life. Despite the fictional nature of this …

Visual of Internet Archeologists Reconstruct Vanishing Digital Artifacts

Internet Archeologists Reconstruct Vanishing Digital Artifacts

Data doesn't live forever – and a new breed of archeologists are trying to recover it.

Visual of Jason Silva and the Dawn of Nanotech

Jason Silva and the Dawn of Nanotech

Buckle up for a new series of videos from performance philosopher Jason Silva.

Visual of Kitchen of 2001 – Envisioned in 1967

Kitchen of 2001 – Envisioned in 1967

Retro futuristic vision from the sixties: "The menu is given to the automatic chef via typewriter or punched computer cards."

Visual of Making Fake Eggs to Beat the Real Thing

Making Fake Eggs to Beat the Real Thing

Tech experts are betting that they can make vegetarian eggs that outperform the real thing.

Visual of Moss Table Powers Its Own Lamp

Moss Table Powers Its Own Lamp

When moss photosynthesize, they release nutritious fats, carbs and proteins into their roots to feed colonies of helpful, symbiotic bacteria. In the process of breaking down these …

Visual of Mothership

Mothership

A ship shipping ship, shipping shipping ships.

Visual of Oranges Are Going Extinct – Unless a Gene from Spinach Can Help

Oranges Are Going Extinct – Unless a Gene from Spinach Can Help

Only genetic engineering can stop citrus from going commercially extinct. But is the public ready to accept GM orange juice?

Visual of Swallow a Pill to Turn Your Body into a Living Password

Swallow a Pill to Turn Your Body into a Living Password

Need a password that you'll never forget and can never be stolen? Try storing it in a pill in your gut.

Visual of The Future of Solar Power? Snail Teeth!

The Future of Solar Power? Snail Teeth!

The gumboot chiton snail produces the hardest biomineral known on earth - and it may hold the secret to better nanotechnology.

Visual of The Insect with Natural Mechanical Gears

The Insect with Natural Mechanical Gears

The first – and only – mechanical gears found in nature.

Visual of New Technologies to Make Us Sleep Less, and Better

New Technologies to Make Us Sleep Less, and Better

Having 50% more “conscious lifetime” might sound like an appealing proposition to anyone with a hectic schedule. This could be achieved not necessarily by living longer, but by …

Visual of The Technium

The Technium

Buckle up for another cinematic espresso shot from our favorite performance philosopher Jason Silva.

Visual of The Twitter Tooth Implant Becomes a Reality (Again)

The Twitter Tooth Implant Becomes a Reality (Again)

An implant equipped with an accelerometer can tell when you're chewing, chatting, smoking or sipping.

Visual of Wi-Fi Visualization: Surrounded by Waves

Wi-Fi Visualization: Surrounded by Waves

An artist visualizes WiFi waves across landmarks in Washington, DC.

Visual of Wipe with the World's First Transparent Toilet Paper

Wipe with the World's First Transparent Toilet Paper

New technology can make completely transparent paper.

Visual of Anti-Drone Tent

Anti-Drone Tent

Anti Drone Tent is a small construction of emergency blankets that blocks infrared sensing, making it invisible to drones.

Visual of Artificial Cells Built From Silicon

Artificial Cells Built From Silicon

Scientists designed artificial cells built from silicon, able to copy basic functions of life.

Visual of In Vitro Celebrity Meat, for Real this Time?

In Vitro Celebrity Meat, for Real this Time?

A company is working on culturing celebrity stem cells for cannibal cuisine.

Visual of Nano-motors in Living Cells

Nano-motors in Living Cells

Scientists succeeded in implanting non toxic nano-motors into living cells.

Visual of Retro Robot Band

Retro Robot Band

The '50s robot band, Le Trio Fantastique, is exemplary of human distant longing for technology that integrates with our body and senses, to the point of taking our place!

Visual of Save the Humans - Call for Quotes

Save the Humans - Call for Quotes

For our new book "Save the Human" we invite you to submit quotes that question the autonomy of mankind in the digital computer era and study the future of the independent creative spirit.

Visual of Three Points in Support of In Vitro Meat

Three Points in Support of In Vitro Meat

The top three aspects why people should support cultured meat.

Visual of Transportations Of The Future

Transportations Of The Future

A selection of nine enthralling and striking concepts of future way of transportation.

Visual of Wearable Technologies for Dummies

Wearable Technologies for Dummies

On the emerging field of technologies that are worn close to or on the body

Visual of Analogue vs Digital: Innovative Nostalgia

Analogue vs Digital: Innovative Nostalgia

Browsing through your virtual bookshelf gives you the feeling of having an easily accessible collection of books, just like your good old analog one.

Visual of Bioprinting in the Kitchen of the Future

Bioprinting in the Kitchen of the Future

Cultivator is speculative design project on how bioprinting could find its way into the kitchen of the future.

Visual of Drone Maps Christ the Redeemer

Drone Maps Christ the Redeemer

The current technology has not been able to replicate Christ the Redeemer perfectly, until now.

Visual of Ikea's Lab-Grown 3D Printed Meatballs

Ikea's Lab-Grown 3D Printed Meatballs

Ikea’s research laboratory was inspired by our Magic Meatballs to re-design their famous meatballs.

Visual of GM Salmon Approved for Consumption

GM Salmon Approved for Consumption

Time ago we wrote about the fact that  US Food and Drug Administration  was considering whether to approve the first genetically engineered salmon. We have a verdict: from now on …

Visual of A Wooden Floor that Follows the Curves of the Tree it's Made of

A Wooden Floor that Follows the Curves of the Tree it's Made of

A wooden floor that follows the curves of the tree it's made of, thanks to smart milling techniques.

Visual of Gene-Edited Micropigs Will Be Soon Sold As Pets

Gene-Edited Micropigs Will Be Soon Sold As Pets

Earlier this year, a group of Chinese scientists published a paper about the modification of the genome of human embryos with the cutting-edge powerful technique called CRISPRs. …

Visual of IBM Predicts Artificial Intelligence Future

IBM Predicts Artificial Intelligence Future

While the Watson technology is exponentially increasing its processing power on an annual basis and steadily moving from answering trivia questions, to cooking advice, onto medical advice, it is about time we confront it with the million dollar question: "Watson, what do you want?".

Visual of Should Intelligent Sex Robots be Banned?

Should Intelligent Sex Robots be Banned?

The Campaign Against Sex Robots, recently launched, is pushing towards banning the continuation of sex robots development.

Visual of Jewelry Harvests Energy from Veins

Jewelry Harvests Energy from Veins

Naomi Kizhner designed jewelry that can theoretically harvest energy from the body of the person wearing it.

Visual of Lab-Grown Shrimps Are Coming to Your Plate

Lab-Grown Shrimps Are Coming to Your Plate

A startup called New Wave Foods is developing artificial shrimp meat in the laboratory.

Visual of Tracking Employees' Body Functions to Improve Business Performance

Tracking Employees' Body Functions to Improve Business Performance

In the quest for competitive advantage, companies adopt wearable biometric technologies to monitor employees and improve business results.

Visual of NANO Supermarket Opens in Latvia

NANO Supermarket Opens in Latvia

The tour of our lustrous NANO Supermarket is coming to Riga, Latvia.

Visual of New Friends? Let Social Textiles Help You

New Friends? Let Social Textiles Help You

A group of students at the MIT Media Lab are working on an electronic textile that might help us interact with people more easily.

Visual of NNN Movement & the First ECO Coin

NNN Movement & the First ECO Coin

We officially launched the Next Nature Movement in The Netherlands. To seal the beginning of the Next Nature Movement, director Koert van Mensvoort donated the first symbolic ECO coin.

Visual of Shape your Second Skin Using your Mind

Shape your Second Skin Using your Mind

A 3D printed helmet able to translate brain activity into the movements of its shape-changing structure.

Visual of Bacteria and Drones: New Ways to Collect Samples

Bacteria and Drones: New Ways to Collect Samples

While a hipster-drink bacteria are hunting space organisms, robots are catching whale snot in the open ocean.

Visual of The Candle of the Future

The Candle of the Future

My New Flame uses LED technology to faithfully recreate the experience of light from the ancient past

Visual of The Emergence of 4D Printing

The Emergence of 4D Printing

An inspiring TED talk by computational architect Skylar Tibbits about 4D printing, where the fourth dimension is time.

Visual of Wireless Controlled Mouse, the Animal!

Wireless Controlled Mouse, the Animal!

A remote-controlled LED chip can make a mouse walk in circles.

Visual of 72h Offline Challenge for Teenagers

72h Offline Challenge for Teenagers

Around 100 Polish teenagers aged between 12 and 18 agreed to withstand 72 hours totally offline: no phone, no computer, no TV. What were the results?

Visual of Microsoft Is Betting on Mixed Reality

Microsoft Is Betting on Mixed Reality

The Microsoft HoloLens is a holographic computer that enables you to interact with high-definition holograms through augmented reality.

Visual of The Advent of Connected Toys

The Advent of Connected Toys

It is the era of smart toys, but they certainly raise difficult questions for parents.

Visual of Artificial Northern Lights

Artificial Northern Lights

Swiss artist Dan Acher created a replica of the Northern Lights by way of high-powered lasers.

Visual of Branded Dreams - The Future of Advertising?

Branded Dreams - The Future of Advertising?

What happens when our dreams become a commodity and advertisers gain the technology to enter our dreams?

Visual of Brexit: the Cultural Climate Warms Up

Brexit: the Cultural Climate Warms Up

On the aftermath of such a historic day for Britain and the EU, it's easy to get swayed into the polarities of political discourse, particularly on social media and the Internet, where things heat up and move fast. The results of the referendum have just come out, and the Internet is already burning with tension. This is called "climate change" - just not the one you are used to hear about.

Visual of A.I. Can Guess Exact Locations of Images

A.I. Can Guess Exact Locations of Images

Google's PlaNet will be soon able to tell you where a photograph was taken by simply looking at its contents.

Visual of Coming Soon: Video Face Hacking for All

Coming Soon: Video Face Hacking for All

team of computer scientists at the universities of Germany and California has created what they call photoshoping videos in real time.

Visual of The Coywolf: 65% Wolf, 25% Coyote, 10% Dog

The Coywolf: 65% Wolf, 25% Coyote, 10% Dog

The coywolf: an animal that has the DNA of the wolves, coyotes and dogs.

Visual of Difficulty in Voting for Trump or Hillary?</br>Elect an Artificial Intelligence for President

Difficulty in Voting for Trump or Hillary?
Elect an Artificial Intelligence for President

Would you vote for an artificial intelligence to govern our society?

Visual of The Digital Life Project

The Digital Life Project

Researchers are creating accurate 3D models of living organisms to preserve the heritage of life on Earth.

Visual of People, Use Your Drone to Map El Niño!

People, Use Your Drone to Map El Niño!

How to monitor the effects of El Niño ? The Nature Conservancy wants to take advantage of the massive image production that can be collected using smartphones and drones. From …

Visual of Egypt's First Solar-Powered Village

Egypt's First Solar-Powered Village

This village is powered by building-integrated solar panels and provides shelter for 350 people, putting sunlight to better use.

Visual of When FB Replaced Editors with Algorithm

When FB Replaced Editors with Algorithm

Facebook had just fired their curatorial team for the ‘Trending’ news section over an algorithm, resulting in false stories attacking a news anchor, a writer, and Mac Donald’s.

Visual of Feelling Information with Our Fingertips

Feelling Information with Our Fingertips

ching 64GB SD cards to each of our fingers challenges how we store and share information in a world were our digital privacy is at risk.

Visual of A Film to Double the Shelf-Life of Food

A Film to Double the Shelf-Life of Food

The eco-friendly food packaging material able to improve food safety, conservation and quality.

Visual of From Vegetable to Stroopwafel

From Vegetable to Stroopwafel

Chloé Rutzerveld presents a modern version of the iconic stroopwafel, fully made of vegetables.

Visual of Meat-Eating Made Us Humans

Meat-Eating Made Us Humans

Eating meat has made us who we are today: evolved, intelligent humans, able to use a verbal language.

Visual of Meet the Vaccinator Drone

Meet the Vaccinator Drone

The Vaccinator Drone will provide you with the medicine you need.

Visual of An Edible Drone for Humanitarian Aid

An Edible Drone for Humanitarian Aid

Nigel Gifford is developing a drone that will be relatively inexpensive, disposable and edible.

Visual of Racist Robots and Bloodthirsty Crowds

Racist Robots and Bloodthirsty Crowds

It took less than 24 hours for Twitter to corrupt an innocent AI bot and teach it morally repugnant things.

Visual of Rating the Reputation Economy

Rating the Reputation Economy

Our online reputation is becoming a valuable currency that is hard to earn and easy to lose.

Visual of ReGen, the Autarchic Off-Grid Village

ReGen, the Autarchic Off-Grid Village

Utopian off-grid ReGen Village produces all of its own food and energy is being implemented in Almere.

Visual of Solar Energy: the Hottest New Currency

Solar Energy: the Hottest New Currency

Energy-backed money could help transition humanity to a more sustainable world, both environmentally and economically.

Visual of The Supermarket with No Employees

The Supermarket with No Employees

This automated store in Sweden doesn’t have any human employees, only a smartphone app.

Visual of Towards a Post-Animal Bioeconomy

Towards a Post-Animal Bioeconomy

As emerging biotechnologies are blurring the lines between synthetic food and natural food, who will regulate cellular agriculture?

Visual of Virtual Reality Meditation

Virtual Reality Meditation

Spiritual leader Deepak Chopra just unveiled a 20-minute therapy session inviting us to come back to the present moment through virtual reality.

Visual of VR as a Tool for Social Change

VR as a Tool for Social Change

United Nations aims at turning a playful technology into a serious medium.

Visual of PC Problems? Better Call a Witch!

PC Problems? Better Call a Witch!

Meet the witch who casts viruses out of computers with magic.

Visual of The World's First Invisible Train

The World's First Invisible Train

Japanese architect Kazuyo Sejima is designing the world's first invisible train.

Visual of Xian'er, When Religion Meets A.I.

Xian'er, When Religion Meets A.I.

A robot monk has been created in China, mixing spirituality with artificial intelligence.

Visual of 1896 - Baby Incubators in Coney Island

1896 - Baby Incubators in Coney Island

In 1896 Dr Couney incubated premature babies. He saved at least 6.500 premature infants from death by putting them on display in Coney Island.

Visual of 1996 - First Artificial Womb Experimented

1996 - First Artificial Womb Experimented

In 1996, Yoshinori Kuwabara at Juntendo University in Tokyo incubated a premature goat fetus by using extrauterine fetal incubation.

Visual of 2016 - Human Embryo Lives 13 Days in Lab

2016 - Human Embryo Lives 13 Days in Lab

In 2016 a team of biologists has successfully kept a human embryo alive in the lab for 13 days, breaking the previous record of nine days.

Visual of 2017 - Artificial Womb Incubates Fetal Lamb

2017 - Artificial Womb Incubates Fetal Lamb

A lamb born at the equivalent of 23 weeks in a human gestational period was kept alive in an artificial womb and developed just as if it was in a normal womb.

Visual of AI Defeats Human at Go

AI Defeats Human at Go

Go world champion Ke Jie has lost two games of 'Go' against Google's DeepMind AI system AlphaGo.

Visual of Priests Bless Server Rooms

Priests Bless Server Rooms

Sanctifying servers with knowledge and power from digital demons.

Visual of Cyborg Dragonfly for Special Service

Cyborg Dragonfly for Special Service

A Biomedical solutions company is developing a system for insects to wear, allowing engineers to steer it remotely.

Visual of ECO Coin Award Interviews: Shubhendu Sharma

ECO Coin Award Interviews: Shubhendu Sharma

We asked Shubhendu Sharm, our first ECO coin award nominee about his method, business and hopes for the future.

Visual of The Birth of a Digital Nation in Estonia

The Birth of a Digital Nation in Estonia

Due to its digital citizenship program, something interesting is happening in Estonia. In July there were more new applications for e-citizenship than newborn babies. Are we …

Visual of Experience Death with VR

Experience Death with VR

Virtual reality experiment tries to help people frightened of death with outer-body experience.

Visual of Cyborg Cabin Crew

Cyborg Cabin Crew

Air New Zealand is equipping its flight attendants with AR headsets to explore in-flight optimization, giving its passengers a glimpse of what the future air travel service might look like.

Visual of HUBOT: Take the Jobtest!

HUBOT: Take the Jobtest!

The robots are coming! They’re getting smarter, cheaper and more reliable. How long will I have my job before a robot steals it? The industrial revolution made muscular power …

Visual of How a Hummingbird Creates Green Energy

How a Hummingbird Creates Green Energy

A start-up company build a wind turbine inspired by the hummingbird.

Visual of New AI Model Can Mimic Any Human Voice

New AI Model Can Mimic Any Human Voice

Lyrebird is an AI model capable of synthesizing anyone’s voice from just a one-minute audio sample.

Visual of NEW: Next Nature Academy

NEW: Next Nature Academy

The Next Nature Academy offers the philosophy, the tools and the methods that will shift the way you think about nature and technology.

Visual of The Next Nature Guide to Games in 2017

The Next Nature Guide to Games in 2017

In the next nature, many people spend as much time in the digital world of gaming as they do in the real world. We have covered video games before, but this year we thought it …

Visual of NNN Is Hiring: Managing Director

NNN Is Hiring: Managing Director

NNN is looking for a Managing Director to join our office in Amsterdam.

Visual of Otra Nation: Make Walls Great Again

Otra Nation: Make Walls Great Again

This group of 14 designers, engineers, builders and architects make a proposal of a wall for Trump's ambitious project.

Visual of Put Your Phone on Theatre Mode in Cinemas

Put Your Phone on Theatre Mode in Cinemas

A new feature rumored to be in the next iOS update called Theater Mode could dim smartphone usage in cinemas.

Visual of FarmVille Turns into Real-Life Agriculture

FarmVille Turns into Real-Life Agriculture

A Japanese Start up brings Farmville back into real life by letting players grow physical food.

Visual of Robo-Bee Pollinated a Japanese Lily

Robo-Bee Pollinated a Japanese Lily

A video of a robotic bee pollinating a flower (looking more like Loopin' Louie spinning off the board game and hitting a flower) recently caught our attention. What at first sight …

Visual of Jobs for Facilitators - Robots at Work #3

Jobs for Facilitators - Robots at Work #3

This is post number three of our serie 'Robots at Work'. In this episode we present you five jobs for facilitators, the ones who love to work with technology.

Visual of GM Self-Destroying Moths

GM Self-Destroying Moths

Open-air tests of self-destructing moths mark a new frontier for GMOs.

Visual of Selfie Time with Your Dead Beloved One

Selfie Time with Your Dead Beloved One

Forever by your side. Elrois a South Korean firm developed an app that allows you to engage with your dead friends lovers or idols.

Visual of When the Sun Casts Its Vote

When the Sun Casts Its Vote

Space weather can influence elections on Earth.

Visual of Chat with Plants in the Botanical Garden

Chat with Plants in the Botanical Garden

Exploring methods to better connect people to the natural world, Waag Society, in collaboration with the Dutch Botanical Gardens Association, have developed an app that allows visitors to talk with plants.

Visual of Robotic Tarzan Controls Crops

Robotic Tarzan Controls Crops

A robot inspired by a sloth was developed in order to control crops growing in our fields.

Visual of Tiny Food Made in a Tiny Kitchen

Tiny Food Made in a Tiny Kitchen

A small introduction to tiny cooking.

Visual of A Virtual Reality Retreat

A Virtual Reality Retreat

Are we sleepwalking into our technological future?

Visual of This 3D-Printed Structure Can Fold Itself

This 3D-Printed Structure Can Fold Itself

Researchers at the University of Technology in Delft have created flat structures able to fold themselves into three-dimensional constructions.

Visual of MIT's new voiceless interface can read the words in your head

MIT's new voiceless interface can read the words in your head

The way we interact with the technology in our lives is getting progressively more seamless. If typing terms or addresses into your phone wasn’t easy enough, now you can just tell …

Visual of AR City: Paving the Way for Augmented Reality Navigation

AR City: Paving the Way for Augmented Reality Navigation

Augmented reality applications are a promising alternative to GPS. At least that is what Blippar’s AR City app claims to be.

Visual of This artwork lets trees tell the story of climate change

This artwork lets trees tell the story of climate change

In our ongoing battle against climate change, it's hard to transcend from our human position and ‘think’ like nature. Given, nature doesn't think the way humans do, but it does …

Visual of Drones Protect Indonesia from Volcanic Danger

Drones Protect Indonesia from Volcanic Danger

In Bali, volcanic danger looms large. Scientists are trying to use drones to forestall the danger and make the invisible workings of the volcano visible.

Visual of Flock of Drones fly over Amsterdam

Flock of Drones fly over Amsterdam

Tonight a flock of drones can be seen in the skies of Amsterdam.

Visual of Interview: Jeremy Bailenson on his latest book

Interview: Jeremy Bailenson on his latest book "Experience on Demand"

Virtual reality has come a long way. Like most technological leaps, it’s had a huge push from the entertainment industry, but current applications span a wide range of social and …

Visual of Next Nature baby care

Next Nature baby care

Babies' needs aren't complex. And yet, they are. Over the years, parents have found some tricks to ease their babies as well as themselves. Taking a baby for a drive to make them …

Visual of Researchers are developing a device that can edit brain activity

Researchers are developing a device that can edit brain activity

Neuroscientists at the University of California Berkely are building a device that’ll hack our brains so we can ‘edit’ what we feel and remember. It looks like we’ve drawn “ Total …

Visual of Making Seawater into Clean Fuel

Making Seawater into Clean Fuel

Scientists have been hard at work searching for renewable energy sources. Now, a new breakthrough: the ability to produce hydrogen fuel from seawater.

Visual of 'Listen' to your genetic heritage: Curate a playlist based on your DNA

'Listen' to your genetic heritage: Curate a playlist based on your DNA

Genealogy services have exploded over the past few years, and Spotify is capitalizing on the boom by providing curated playlist based on users’ DNA. Here's what you should know. …

Visual of This tiny tooth sensor tracks what you eat, and it could help you be healthier

This tiny tooth sensor tracks what you eat, and it could help you be healthier

The South Beach diet. The Atkins diet. Eating paleo. Cutting out gluten. Going vegan. The list of fad diets and health crazes goes on, yet health statistics in the US and around …

Visual of Aleph Farms grew meat in space

Aleph Farms grew meat in space

Hello meat lovers! In vitro meat innovator Aleph Farms has taken the saying 'one small step for man and one giant leap for mankind' to a whole new level. The startup has succeeded …

Visual of 5 must-see exhibitions before the end of the year

5 must-see exhibitions before the end of the year

A large-scale asian food market serving in vitro meat, a transatlantic expo on the future of nature and a travelling exhibition that explores our relationship with AI. These five …

Visual of 5 things to do at DDW19

5 things to do at DDW19

Lining up plans for Dutch Design Week ? Once more, 2600 designers gather in over 120 locations during 450 events. So whether you're a local, new in town, or just passing through, …

Visual of How to biofabricate leather

How to biofabricate leather

Leather is one of the oldest and most versatile materials in the world. It’s a supple, tough, relatively strong and durable material and it’s relatively impermeable, yet …

Visual of Discussing bio-based material experiences with Elvin Karana

Discussing bio-based material experiences with Elvin Karana

The world of design is in need of new materials that align with the urgency for sustainability. Issues such as climate change, plastic waste and harmful materials require us to …

Visual of NATURE is an exhibition where biology and design meet

NATURE is an exhibition where biology and design meet

Cube Design Museum in Kerkrade and Cooper Hewitt in New York present the comprehensive exhibition NATURE - in which internationally renowned designers, artists and inventors …

Visual of Recap of the Next Nature book launch

Recap of the Next Nature book launch

The new Next Nature book is here ! Next Nature fellows, ambassadors, members and newly interested people came together on the 4th of June to celebrate the book launch with a …

Visual of 3 ways Virtual Reality is revolutionizing teaching

3 ways Virtual Reality is revolutionizing teaching

You’ve probably heard how Virtual Reality (VR) is going to change everything: the way we work, the way we live, the way we play. Still, for every truly transformative technology, …

Visual of Work with us!

Work with us!

We are a network of makers, thinkers, educators and supporters. With members in 44 countries, we are the international network for anyone interested in the debate on our future – …

Visual of Shahar Livne wins ECO Coin Award 2020

Shahar Livne wins ECO Coin Award 2020

Each year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honour them with our ECO Coin Award . We …

Visual of Her is an outlook on the possible future of dating a chatbot

Her is an outlook on the possible future of dating a chatbot

With most of us stuck at home because of lockdown, for the singles around us intimacy may have turned into a distant dream. Could we find our salvation in technology? And what …

Visual of (Im)possible bodies: responsiblity and care in our cyborg future

(Im)possible bodies: responsiblity and care in our cyborg future

What does it mean to become a cyborg? Better yet, aren't we cyborgs already? What then, does it mean to have a body? Is a 'standard' desirable, what does that even mean, and what …

Visual of Marjan van Aubel wins ECO Coin Award

Marjan van Aubel wins ECO Coin Award

Each year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honor them with our ECO Coin Award . We …

Visual of Next Generation: Designing modular fashion with Mathilde Rougier

Next Generation: Designing modular fashion with Mathilde Rougier

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Next Generation: Simulating textile ecosystems with Scarlett Yang

Next Generation: Simulating textile ecosystems with Scarlett Yang

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of Discussing non-human centered design with Kelvin Godee and Simon Wijrdeman

Discussing non-human centered design with Kelvin Godee and Simon Wijrdeman

What if design began to put everything but the human first? The needs of the human not paramount to the design process, but instead the other entities that we cohabit planet earth …

Visual of The Ouroboros Steak is a steak made out of human cells

The Ouroboros Steak is a steak made out of human cells

You are what you eat; a quite common message in the midst of our self-growth society. We have to eat well to become the best version of ourselves - more productive, healthier …

Visual of Showcase your work on Next Nature!

Showcase your work on Next Nature!

Are you a recent graduate or young maker who feels your work deserves a spotlight? Does your project seek to understand how technology becomes so omnipresent, complex, intimate …

Visual of Have you thought about your social media death?

Have you thought about your social media death?

Recently, Twitter announced it would be clearing all inactive accounts in an effort to free up dormant usernames and prevent the risk of old accounts being hacked. The new policy …

Visual of Virtual makeup: maybe they're born with it, maybe it’s XR

Virtual makeup: maybe they're born with it, maybe it’s XR

As our reality exists increasingly within digital realms, our virtual world demands a virtual identity. Our work is hybrid, our social identity is online and our connection is …

Visual of COVID-19 is a virus, corona is a meme

COVID-19 is a virus, corona is a meme

As the viral pandemic continues to spread, so too does the world’s collective uncertainty. As a result, people are turning to media for some levity. And can you blame them. …

Visual of It's been fifty years since we took the first full photo of Earth from space

It's been fifty years since we took the first full photo of Earth from space

The image of the whole Earth as seen from space has become a symbol of the environmental movement. Time for an update?

Visual of How bacteria can recover precious metals from EV batteries

How bacteria can recover precious metals from EV batteries

There are more than 1.4 billion cars in the world today, and that number could double by 2036 . If all those cars burn petrol or diesel, the climate consequences will be dire. …

Visual of Can we grow wood in a lab the same way we grow meat?

Can we grow wood in a lab the same way we grow meat?

In old nature, wood is grown in the forest. In the next nature, wood might be grown in a lab. Akin to the process of growing in-vitro meat , researchers in Velásquez-García’s …

Visual of An artificial skin to breathe underwater

An artificial skin to breathe underwater

The human world often sees itself as separate from the rest of the natural world. Because we have deemed ourselves, ironically, as higher functioning beings over all others on …

Visual of Cooling buildings with ultra-white paint

Cooling buildings with ultra-white paint

From icy tundras to billowing clouds, the colour white crops up repeatedly in our planet’s palette. This colour provides a natural way for light from the sun to reflect back from …

Visual of Cyborg mythologies #1: plastic surgery & techno-futuristic foretellings

Cyborg mythologies #1: plastic surgery & techno-futuristic foretellings

This is #1 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …

Visual of This podcast aims to help design better food systems

This podcast aims to help design better food systems

The podcast Food by Design was created by Sarah Codraro and Sandeep Pahuja, and is hosted by Sandeep. According to the makers "Our food system is not 'broken'. It’s working …

Visual of How to turn your 3D printer into a food printer

How to turn your 3D printer into a food printer

While the pandemic has restricted us from doing many activities we like, household hobbies such as DIY , baking and crafts have become more popular. Now there’s a way to combine …

Visual of Next Generation: Pursuing digital tactility with Studio PMS

Next Generation: Pursuing digital tactility with Studio PMS

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Join us at the Embassy of Food Conference

Join us at the Embassy of Food Conference

Promising food design projects do not always find their way to producers, the market and ultimately to consumers. Why is that and what can we do to advance these ideas? Why is it …

Visual of Lab or nature: scientists are debating the origins of COVID-19

Lab or nature: scientists are debating the origins of COVID-19

We need to talk about COVID-19. Again (or, still). One of the main questions about SARS-CoV-2, the virus that causes COVID-19, has for a while been about its origins. Most viruses …

Visual of Leonardo DiCaprio is investing in future meat startups

Leonardo DiCaprio is investing in future meat startups

Globally, humanity consumes almost 350 million tons of meat a year. In the next 10 years, this number is expected to increase by a significant percentage. Scientists believe that …

Visual of Knitting sweaters from human hair

Knitting sweaters from human hair

The textile industry is the second largest polluter in the world that leads to a chain reaction of nasty results: loss of biodiversity, water pollution and soil erosion are just a …

Visual of How a starfish inspires robotic design

How a starfish inspires robotic design

In a feat of biomimicry that seamlessly marries biology with physics, tests carried out at the University of Southern California’s Viterbi School of Engineering made fascinating …

Visual of How the ECO Coin could bridge the gap between sustainable farming and monetary returns

How the ECO Coin could bridge the gap between sustainable farming and monetary returns

For the last six months millions of Indian farmers have been marching through the national capital in an effort to repeal the laws that they believe would end guaranteed pricing …

Visual of Roman Krznaric contemplates on becoming a good ancestor

Roman Krznaric contemplates on becoming a good ancestor

Roman Krznaric's ultimate guide to radically change our perception of time and become good grand-grandparents

Visual of The Next Nature book is now available in Chinese

The Next Nature book is now available in Chinese

In Next Nature: Why Technology Is Our Natural Future , Koert van Mensvoort takes us on an epic exploration through the wonderful world of culturally emerged nature. It offers a …

Visual of The Next Nature book is now available in Italian

The Next Nature book is now available in Italian

In Next Nature: Why Technology Is Our Natural Future , Koert van Mensvoort takes us on an epic exploration through the wonderful world of culturally emerged nature. It offers a …

Visual of The Next Nature Magazine is here!

The Next Nature Magazine is here!

It’s our pleasure to announce the first issue of the Next Nature Magazine. Indeed, a good old fashioned magazine. Next Nature Magazine presents 176 pages of thought-provoking …

Visual of Colonizing Mars with plants, not humans

Colonizing Mars with plants, not humans

The idea of colonizing Mars has become the big speculative future of humanity on Earth. But, artist Alexandra Daisy Ginsberg has radically different ideas to contribute to the …

Visual of What Julia Watson is reading this summer

What Julia Watson is reading this summer

In an era of high-tech and climate extremes, we are drowning in information while starving for wisdom. Architect Julia Watson imagines a design movement building on indigenous …

Visual of The next generation xenobots are here

The next generation xenobots are here

In 2020, scientists made global headlines by creating “ xenobots ” – tiny “ programmable ” living things made of several thousand frog stem cells. These pioneer xenobots could …

Visual of Visit the Embassy of Food conference during DDW22

Visit the Embassy of Food conference during DDW22

Will there still be a supermarket as we know it today in 2050?

Visual of The long history of the metaverse

The long history of the metaverse

Many aspects of the current metaverse were already familiar 143 years ago.

Visual of Making an AI supermarket with Nonhuman Nonsense

Making an AI supermarket with Nonhuman Nonsense

What does the supermarket of the future look like? The Embassy of Food at Dutch Design week.

Visual of Next Generation: Mending mycelium with Emma Huffman

Next Generation: Mending mycelium with Emma Huffman

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Next Generation: Demonstrating non-human narratives with Lindsey Bundel

Next Generation: Demonstrating non-human narratives with Lindsey Bundel

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Next Generation: Designing ecological webs with Miriam Lellek

Next Generation: Designing ecological webs with Miriam Lellek

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of The Cyborg Foundation is fighting for cyborg rights

The Cyborg Foundation is fighting for cyborg rights

Cyborgs - part human, part machine - are becoming more present in society, but their rights are not yet established.

Visual of Next Generation: Changing the oceans chemistry with Santa Ramaherison

Next Generation: Changing the oceans chemistry with Santa Ramaherison

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Next Generation: Fantasising about fashion with ShirpShiro

Next Generation: Fantasising about fashion with ShirpShiro

Finding realistic solutions to the humanitarian and environmental issues in the textile and fashion industries.

Visual of The Solar Biennale brings new perspectives on the energy of the sun

The Solar Biennale brings new perspectives on the energy of the sun

The sun lies at the heart of our solar system, providing life-giving light, heat and energy to Earth. The sun always gives, without asking for anything in return. In the …

Visual of The Furby threat to national security

The Furby threat to national security

We are now so used to communicating with some robotic device in our homes. But this skill cost Furbies a national ban in the US.

Visual of Building Floriade 2022

Building Floriade 2022

We met at the Floriade grounds in Almere with Xander de Bruine, program manager Floriade Expo 2022, with project manager Jennifer Palumbo. Along with head curator William Myers we …

Visual of This billionaire wants to live forever

This billionaire wants to live forever

From the mythical fountain of youth to the many anti-aging procedures available today: humans have dreamed of internal youth for a long time already. At lot of us perceive aging, …

Visual of A shoebox of fractal flowers

A shoebox of fractal flowers

It's not every day that someone walks into your office with a shoebox, and even more rare when that shoebox contains a potential future.

Visual of Hurray! There are now vaccines for honeybees

Hurray! There are now vaccines for honeybees

A significant milestone has been reached as the US Department of Agriculture has granted approval to a vaccine for insects for the very first time. An important breakthrough, …

Visual of Next Generation: Going viral with lab-grown meat and Leyu Li

Next Generation: Going viral with lab-grown meat and Leyu Li

To explore the public opinion towards cultured meat, speculative food designer Leyu Li created fictional influencer “Meaty Auntie” and turned to TikTok.

Visual of Hedgehog's robotic fungi farms

Hedgehog's robotic fungi farms

Beyond being little umami bombs, mushrooms are: protein-packed and nutritious. But here's the pitfall: their cultivation can be pricy. Especially gourmet mushrooms such as …

Visual of Gigantic lab-grown mammoth meatball feeds an entire family

Gigantic lab-grown mammoth meatball feeds an entire family

Researchers used genetic information from an extinct mammoth to create a lab-grown meatball.

Visual of Meat the future: the Netherlands might soon become a global hub for in vitro meat

Meat the future: the Netherlands might soon become a global hub for in vitro meat

Remember when we created a little petition back in 2018 in the hope to legalise the tasting of in vitro meat? About 4000 of you agreed with us and signed it. If you were one of …

Visual of This coffee is prepared without coffee beans

This coffee is prepared without coffee beans

The Netherlands is a real coffee country. With the amount of coffee Dutchies drink per year, they have been in the top 10 of most coffee drinkers for years. Drinking so much …

Visual of Tooth fairy alert: Japanese company tests drug that can regrow human teeth

Tooth fairy alert: Japanese company tests drug that can regrow human teeth

Toregem Biopharma designed an antibody drug that can possibly regenerate teeth using the body's own tissues.

Visual of We now have satellite traffic jams in space

We now have satellite traffic jams in space

It seems that traffic jams aren't just a problem confined to Earth's highways and byways. How did this happen? And should we be concerned?

Visual of Enter the memesphere

Enter the memesphere

Why memes might be the next tool to make sense of on our increasingly hybrid virtual and physical environment.

Visual of Wild wild space

Wild wild space

When Earth goes south, cowboys go all the way up. The Space Rush of 2020s has something to do with settler colonialism.

Visual of Next Nature is ancient

Next Nature is ancient

Uli Westphal's Seed Series is an ongoing attempt to document the seeds of all edible plants, one seed at a time.

Visual of Next Gen: De-exctincting the mammoth with Wendi Yan

Next Gen: De-exctincting the mammoth with Wendi Yan

What if an ancient mammoth found herself resurrected by humans into our modern age?

Visual of Interruptions

Interruptions

Every ecology needs balance. So that's also true for the ecology of the office. The office is a ecology that is highly regulated: temperature, light, humidity, distance to other …

Visual of 20k human chip

20k human chip

AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …

Visual of Ambient bathtub

Ambient bathtub

I am sorry I couldn't be there— I had an important meeting with my bathtub that could not be rescheduled. This bathtub with an internal multicolour LED light fitting, creating a …

Visual of Artvertising: pixel ads become physical

Artvertising: pixel ads become physical

In the early days of digitalization many metaphors from the physical world were translated to the digital world; think desktop folders, trashcan and shopping cart. Now we have …

Visual of Better than the real thing

Better than the real thing

Written by Debbie Mollenhagen PART 1: FROM LINEAR TO CIRCULAR Designer living has become designing life. I often ask myself: did it taste like the real thing? But when I open my …

Visual of Bird radio

Bird radio

Instruction for the Birds: Land on perch->trigger sound file->observe human response-->behave accordingly. Instructions for People: Listen, you'll be able to understand. The sound …

Visual of Bit.fall Aquadisplay

Bit.fall Aquadisplay

A screen of water displays images by controlling drops of water falling down. Density creates light/dark shades that create the image— Project site

Visual of Blur Building

Blur Building

The pavilion is made of filtered lake water shot as a fine mist through 13,000 fog nozzles creating an artificial cloud that measures 300 feet wide by 200 feet deep by 65 feet …

Visual of Child Care Robot

Child Care Robot

NEC corporation is developping a "Childcare Robot PaPeRo" capable to play with and watch over children. The Childcare Robot is capable of recognizing and verbally communicating …

Visual of Crowd counter

Crowd counter

Crowd counter is a piece of software able to track moving features within a video clip. It works on the assumption that points that move together are most likely part of the same …

Visual of Datafountain: Money translated to water

Datafountain: Money translated to water

"In the morning paper, I can read the weather report as well as the stock quotes. But when I look out of my window I only get a weather update and no stock exchange info. Could …

Visual of Dataplant: Money translated to plants

Dataplant: Money translated to plants

Remember the datafountain ? Of course there are many other applications of information decoration: datawallpaper, datasounds, datafurniture and dataclimate. The picture above …

Visual of Dreamkeeper

Dreamkeeper

Skin conductivity sensors are used to deduce the emotional state of the sleeper. This information is brought to 3-D studio where a script is used to transform this into physical …

Visual of e-Paper

e-Paper

Will our mobile devices look like this in two years time? This is an example-application of the featherweight QVGA (320x240 pixels) active-matrix display: Phillips e-paper . (It …

Visual of Eat this!

Eat this!

Sushi made up of flavoured sheets printed out on an inkjet printer. Using ink-jet printers and lasers in the kitchen may seem like a futuristic vision but at Moto restaurant in …

Visual of Entry 2006 closing weekend

Entry 2006 closing weekend

This weekend is the last change to visit the Entry 2006 exhibition in the coalwashe building, Zollverein. Over 300 exhibits from more than 20 countries are on display. Next nature …

Visual of Erkundungen im Nächste Natur (D)

Erkundungen im Nächste Natur (D)

Die Natur verändert sich mit uns (English version: Exploring Next Nature ) by Koert van Mensvoort , published in Entry Paradise, Neue Welten des Designs, Gerhard Seltman, Werner …

Visual of Eternal Sunset

Eternal Sunset

Eternal Sunset endeavours to ensure you can enjoy the sunset live from any location, at any time. As the sunset moves westward, Eternal Sunset continuously tunes into different …

Visual of Excuse me, is Your Tooth Ringing?

Excuse me, is Your Tooth Ringing?

The 'tooth phone' consists of a tiny vibrator and a radio wave receiver implanted into a tooth during routine dental surgery. Sound, which comes into the tooth as a digital radio …

Visual of Eye 2.0

Eye 2.0

Now with Google smart look. Don't worry, it is science fiction (still). Created by Sean Hamilton Alexander.

Visual of Featherless Chicken

Featherless Chicken

Behold the featherless chicken, created by Scientists at the genetics faculty at the Rehovot Agronomy Institute near Tel Aviv, Israel. The idea behind the development of this …

Visual of GloFish

GloFish

  A tropical fish that fluoresces bright red is set to become the first genetically modified pet to go on sale in the US. Alan Blake and colleagues at Yorktown Technologies …

Visual of Handsets gets taken to the grave

Handsets gets taken to the grave

More people than ever are asking to be buried or cremated with their mobile phones when they die. The trend, which began in South Africa, has now spread to a number of countries, …

Visual of 3D rendered bunnies prefer calm diesels

3D rendered bunnies prefer calm diesels

Kenichi Nagahiro, Honda's chief engine designer, hated diesel engines. When asked to design Honda's first diesel he flatly refused - unless he was allowed to start completely from …

Visual of Hotspot Bloom

Hotspot Bloom

Hotspot Bloom is a wearable flower that glows and changes color to indicate the signal strength of a nearby wireless network (802.11b/g). With its mobile interface, Hotspot Bloom …

Visual of Infant Pillow - Simulates a Mother's Hand

Infant Pillow - Simulates a Mother's Hand

  If you've ever wished for a "hand" to leave behind so that your baby would feel as if you've never left the room, your prayers have been answered with the Zaky Infant …

Visual of Info Toaster

Info Toaster

Toasted bread as an information display device (originally developed in 2001 but somehow still intruiging): a toaster that parses meteorological information from the web and then …

Visual of Inner life of a cell

Inner life of a cell

You know.. cells have feelings too... and friends.. Check the video here

Visual of Lifestyle pets

Lifestyle pets

ALLERCA has produced the world's first scientifically-proven hypoallergenic cats. These cats allow some of the millions of people with feline allergies to finally enjoy the love …

Visual of Metalosis Maligna

Metalosis Maligna

Metalosis Maligna is a documentary by Floris Kaayk about a disease which affects patients with medical implants. Sourcing from such implants a wild metal growth ultimately …

Visual of Radio controlled human

Radio controlled human

Think of this sonic vibe-technology inside any MP3 player ;)

Visual of Instant privacy

Instant privacy

Please leave me alone, I'm writing a message.

Visual of More leg = more money

More leg = more money

The Stock market skirt Nancy Paterson made a blue taffeta & black velvet party dress that represents the real-time stock market situation by lowering or raising its hemline. …

Visual of N is for Nature

N is for Nature

There are people who think what makes a good wine comes from nature - factors like rain and soil and temperature. Then there are those who think it's a matter of second nature - …

Visual of WiFi-enabled Ambient Rabbit

WiFi-enabled Ambient Rabbit

There may even come a moment that our connection with an industrially manufactured coke bottle may be richer and more mythical that our relation with a genetically analysed and …

Visual of Art versus Nature

Art versus Nature

Amsterdam Weekly featured an article about the Natural Habitat exhibition (pdf) , currently on display at Montevideo/Timebased Arts. In the exhibition artists play with the …

Visual of Nature So-called

Nature So-called

Nature is not what it used to be. Or at least that is what we may think, when we look at the way humans and their technologies have treated nature. When we speak of "nature", …

Visual of Need for Speed

Need for Speed

A transformation of the big flashing arrows from the computer game Need for Speed Underground 2, NFSU 2 to physical space. Although computer games generally try to imitate the …

Visual of Next n8 Nature

Next n8 Nature

During the upcoming Amsterdam Museumnight, the Institute for Timebased Arts (Montevideo) will be hosting a show called Natural Habitat, in which artists play with the borders …

Visual of Plantimals

Plantimals

Finally! Some creative uses of cloning discovered. Photoshop technology makes flora and fauna join hands. www.worth1000.com

Visual of Post History

Post History

Jos de Mul (Erasmus University Rotterdam), published in Next Nature Paperback, 2005 For someone whose main instrument is a computer, the world becomes a gigantic database. We see …

Visual of Power Aware Cord

Power Aware Cord

The Power Aware Cord transports electrical power while simultaneously visualizing energy usage. Electrical transfer is represented through glowing pulses, flow, and intensity of …

Visual of Real Nature is not Green

Real Nature is not Green

At the edge of the woods along the motorway near the Dutch town of Bloemendaal, there stands a mobile telephone mast disguised as a pine tree. This mast is not nature: at best, it …

Visual of RFID Chips: Is your cat infected with a Computer Virus?

RFID Chips: Is your cat infected with a Computer Virus?

A group of computer researchers from Amsterdam have demonstrated that it is possible to insert a software virus into radio frequency identification tags, part of a microchip-based …

Visual of RFID ladybag

RFID ladybag

a purse that visually keeps track of valuable items such as keys, wallets, personal identification cards, & cellular phones through various sensors embedded in the bag. if …

Visual of Sababa

Sababa

The Sababa is the first real time lava visualiser kit of global city flows. It takes the lava lamp one step further by reconstructing it according to the language of the current …

Visual of Sequoiaview - harddisk visualisation

Sequoiaview - harddisk visualisation

Did you ever wonder where all that hard drive space went too? Sequoiaview generates organic-like views of the files and folders on your hard drives using cushion treemaps. …

Visual of Shapeshifting memory plastic

Shapeshifting memory plastic

Scientists have invented a plastic memory material that can change into three different shapes based on heat. Researchers demonstrated a plastic tube with three "programmed" …

Visual of Sixties last

Sixties last

The flower depicted in the image is a good example of Hypernature. While fake nature is always a flatter surrogate of old nature, hypernature is a simulation of an old nature that …

Visual of Sky-catcher

Sky-catcher

Luna Maurer has launched her long-expected website on december 18th 2006: From July 2005 a camera on the roof of De Balie (famous building in Amsterdam) is 'catching the sky' in a …

Visual of The Animal Sweater

The Animal Sweater

The pattern on the Animal Sweater suggests a new way to experience commercial imagery. The Animal sweater, designed by Karl Grandin, was first shown at The Biggest Visual Power …

Visual of The infoBreath

The infoBreath

A flower arcing from a frosted pane of glass. Rigged with a breath sensor and connected to an internet packet sniffer, the flower is cued in to the wireless network flowing in the …

Visual of Tree-climbing robot

Tree-climbing robot

I wonder what task this little fellow 's creators had in mind for him. Rescuing cats? Pruning branches? Picking coconuts? Found here. I'm glad there's a robot for every surface …

Visual of Tree traffic light

Tree traffic light

Funded and produced by the Public Art Commissions Agency. On roundabout just beyond the Canary Wharf estate there are three trees, two are London planes; the third is a traffic …

Visual of Cellphone Treemasts

Cellphone Treemasts

Mobile phone operators go to extraordinary lengths to conceal the masts that form their networks. They are being disguised as chimneys, clocks, drainpipes, telegraph poles, and …

Visual of Walls with Ears

Walls with Ears

A traditional textile heritage is celebrated with flocked wallpaper that comes to life as it reacts to ambient noise levels. The louder the space the brighter the wallpaper glows. …

Visual of Typing With Water

Typing With Water

A technique developed by the German Claus Winterfor an installation artist makes whatever word you type into a computer visible by a "water-curtain". The video shows the World …

Visual of Weather forecasting umbrella

Weather forecasting umbrella

An umbrella that provides information about the likelihood of rain so that users can make a simple, informed decision about whether to take the umbrella with them as they leave …

Visual of When there's smoke, there's nature

When there's smoke, there's nature

When I was a kid, I thought that people that could make smoke circles were really cool. Now I think machines that can do that are even cooler!Â? Made by Takeshi Ishiguro

Visual of Wifi SM: Feel the global pain

Wifi SM: Feel the global pain

You have the impression that the disasters of the world do not touch you anymore? You feel vaguely sorry for other people's misfortunes but you don't feel the inner urge which …

Visual of Wildgruen

Wildgruen

Mandy Meißner's "Wildgruen", a plant that can move and communicate. In her view, plants need to be freed from their isolation, both in the way that they can only lean towards the …

Visual of Wind Shaped Pavillion

Wind Shaped Pavillion

The Wind Shaped Pavilion is a design proposal for a large fabric structure that can be used as a public or private pavilion. As a lightweight fabric structure, the wind slowly and …

Visual of Would You Like a Bouquet of Nanoflowers?

Would You Like a Bouquet of Nanoflowers?

These crystalline 'nanoflowers' were developed by Cambridge University PhD student Ghim Wei Ho. The nanostructures of silicon carbide are grown from droplets of gallium on a …

Visual of A hunt for hightech

A hunt for hightech

In "A Hunt for High Tech", Bart Hess seeks to harness both nature and technology and create armoured skin and fur for a new human archetype incorporating animalistic and …

Visual of Contour door

Contour door

Silly inventions like these make me wonder why man continuously seeks interaction with the things surrounding him. Should buildings or offices be allowed to talk? "This door was …

Visual of Augmented Animals

Augmented Animals

Animals do not shape their living environment as radically as humans, but why don't we give them some help. James Auger envisions animals, birds, reptiles and even fish becoming …

Visual of Augmented Fish Reality

Augmented Fish Reality

Augmented Fish Reality is an interactive installation of five rolling robotic fish-bowl sculptures. These sculptures allow Siamese Fighting fish (Betta Splendons) to use …

Visual of Ball of Being

Ball of Being

Ball of Being is an online dance film featuring atoms, planets, footballs, globes, foam and molecules. It is uncertain whether we are entering a microscopic nanoworld, virtual …

Visual of Big Ass Browser

Big Ass Browser

First we had the internet. We stored all our texts and images in databases. Then came search engines to locate the data. Now is the time to interconnect it all; to share knowledge …

Visual of Botanic Artists

Botanic Artists

Where other trees grow their branches towards the light, willows seem to want to touch the surface. Tim Knowles creates drawings independent of his own hand and when he attaches …

Visual of Brain biometric key

Brain biometric key

Using electrodes positioned around a person's scalp, scientists from the Centre for Research and Technology Hellas in Greece are developping a method for electronic identification …

Visual of Bright blind

Bright blind

Made of electroluminescent (EL) sheets, Makoto Hirahara's Bright Blind simulates a window where none exists. In all other respects, the artificial blind functions in exactly the …

Visual of Car Navigation - Just Follow the Red Cable

Car Navigation - Just Follow the Red Cable

Just follow the yellow brick road ... thin red cable and you know where to go! Instead of looking at a small 6 inch screen, or listening to less than exact turn by turn …

Visual of Chewing = Browsing

Chewing = Browsing

Japanese researchers have developed head gear that lets people control devices such as an iPod using their teeth. Now that is not really new, except when you take in mind that …

Visual of Compubeaver

Compubeaver

Compubeaver by Kasey McMahon "I am interested in the way we interact with nature. As we become increasingly reliant on technology, we become disconnected from our natural …

Visual of Can't handle your machine? Just eat it!

Can't handle your machine? Just eat it!

Visual of Super Mario Cloud

Super Mario Cloud

Cory Arcangel hacked and modified a piece of hardware'the cartridge on which the game "Super Mario" is stored, or rather, was stored to produce "Super Mario Cloud" This is …

Visual of Die Hard - Vilcus plug dactyloadapter

Die Hard - Vilcus plug dactyloadapter

Many people get a kick out of a direct contact with AC power supply. To that end, people normally use U-shaped fragments of bare wire, paper clips or even usual metal forks. All …

Visual of Dishmaker

Dishmaker

This "printer" is all about creating, storing and recycling householdproducts on demand. link | video

Visual of Ferrari Tomato

Ferrari Tomato

Do you happen to know the Dutch Tomatoes? They look like Ferrari's and taste like shit. They are redder, rounder, larger, and maybe even healthier than the ones from our gardens. …

Visual of Edible RFID tags

Edible RFID tags

Inventors keep coming up with new ways to exploit RFID (Radio Frequency Identification) tags. Now Kodak wants to use them to probe a person's digestive system. RFID tags are tiny …

Visual of Email Flight Sim

Email Flight Sim

This must be the best worst software concept I've seen this year.. An email mailbox represented as a 3D, virtual LAX airport. in this world's coolest email program, based on the …

Visual of Evolution in the Bathroom

Evolution in the Bathroom

I have been conducting some attempts to backtrack the evolution of Gillette shaving razors appearing in my bathroom. Whereas older shavers were simple sticks with a blade on top, …

Visual of Fake for Real: Digital Trashcan

Fake for Real: Digital Trashcan

At the beginning of the digital era, several metaphors from the physical world were transferred to the digital environment in order to make, otherwise incomprehensible, technology …

Visual of Fake for Real: Phone Trees

Fake for Real: Phone Trees

For a long time in the history of painting, the landscape functioned merely as a backdrop for people, buildings or symbols. But in the 17th century, artists started making …

Visual of Fake for Real: QWERTY, the Right Order

Fake for Real: QWERTY, the Right Order

Did you ever wonder why the letters on the keyboard are in the order they are? The reason for QWERTY goes way back. This order was chosen to reduce the probability that mechanical …

Visual of Fake for Real: Romantic Sunsets

Fake for Real: Romantic Sunsets

Sunsets are loved by people all around the globe. Could this universal aesthetic preference be linked to a deeply rooted understanding of the sunset's importance? Life on earth …

Visual of Fire fighting beetle - OLE

Fire fighting beetle - OLE

Just like centipedes OLE can roll up into a ball when danger threatens and retract its six legs. Its heat-resistant shell is made of a ceramic-fibre compound which can withstand …

Visual of Flesh Nike

Flesh Nike

A Nike shoe stapled together with human flesh, created by Adam Brandejs .

Visual of Food for Thought

Food for Thought

Food is no food. Food is scent. Food is temporary experience. Food is message. Welcome to this magical gastronomy tour. You will enjoy the tasty (video)links below: Works by Chef …

Visual of Forest clock

Forest clock

TiWalkMe is a clock (still in conceptual stage) designed to track 1,000 years using a forest seeded along a ribbon of land to tell time. Annual tree plantings set the pace, …

Visual of Furry Display

Furry Display

I applaud any new display technique that isn't emitting light. A recent patent application by Philips for a new type of screen based on "furry" pixels , or physical pixels made …

Visual of Grass Wheel

Grass Wheel

If you've gotta run the wheel, you might as well do it in bare feet. Many of us are so busy being good little hamsters that we never have face time with green space. A group of …

Visual of Hamster Shredder

Hamster Shredder

Tom Ballhatchet introduces mice and hamsters into the officegarden. tomballhatchet.com

Visual of Human LCD

Human LCD

New media technology from South Korea: a gigantic human display compiled from supporters cheering their soccer teams . One pixel per supporter. See also: Skyscreen , A4 e-paper .

Visual of Humans to Blame for Global Warming

Humans to Blame for Global Warming

Global warming is "very likely" a human-caused problem that will last for centuries and require concerted international action to reduce its potentially devastating impacts, a …

Visual of iBiogenetics

iBiogenetics

In 1998 at the introduction of the iMac , Apple declared that the "i" stood for "internet". Apple later adopted the "i" prefix across its consumer hardware and software lines. …

Visual of Information Decoration: Our Environment as an Information Carrier

Information Decoration: Our Environment as an Information Carrier

Picture this: it's 40,000 years ago, and you are an early Homo sapiens. You are standing on the savanna. Look around you. What do you see? No billboards, no traffic signs, no …

Visual of IVY - hard disk cover evolves with your data

IVY - hard disk cover evolves with your data

IVY is an external hard disk which shows the content of the hard disk on its skin. When no data is stored on IVY, its skin will remain blank. When you purchase IVY, it appears to …

Visual of Kite ship

Kite ship

The world's first commercial merchant ship using a high-tech kite system will sail across oceans - and help fight climate change. "MV Beluga Skysails" cargo ship has been fitted …

Visual of MemorySticks / USB-tree

MemorySticks / USB-tree

Now here's a nice piece of dead old nature I would like to stick in my computer! Notice the beautiful micro-organism-patterns. Designed by Oooms.nl Related posts: Sunflower …

Visual of p2p spiders

p2p spiders

It looks like spiders are learning from the web and use peer-to-peer technology to build their web: "Entomologists are debating the origin and rarity of a sprawling spider web …

Visual of Today: Paradise by the Laptop Light

Today: Paradise by the Laptop Light

Eat the fruit. Kiss the Snake. Today 16:30-18:00: Paradise by the Laptop Light at STRP Festival .

Visual of Sao Paulo vs Billboards

Sao Paulo vs Billboards

The mayor of Sao Paulo decided that he was tired of the wildgrowth of billboards in the city. So he decided to take them all down (not personally). This creates a very pre (or …

Visual of Skyscreen - largest urban LED screen in Asia

Skyscreen - largest urban LED screen in Asia

Alright, we can agree most of old nature has been altered by human activity. We're not just talking rain forest, icecaps and genetically modified fruit and kittens . Now you might …

Visual of Slogan of the Week

Slogan of the Week

The media are disappearing, Nature takes over. Our slogan of the week.

Visual of Stoneage noodles

Stoneage noodles

15.000 Years ago we lived in caves, wore animal-fur and ate mammut- noodles !? Oh well, though our knowledge has grown a bit, the human nature hasn't changed that much: every …

Visual of Surfing with nothing but brainwaves

Surfing with nothing but brainwaves

I couldn't believe the news? Scientist are working on a system that allows you to surf the web with nothing but brainwaves . I thought surfing was a rich physical experience of …

Visual of TeleBombing

TeleBombing

The MQ-9 Reaper is loaded, but there's no one on board. Its pilot, as it bombs targets in Iraq and Afghanistan, will sit at a video console 7,000 miles away in Nevada. Although …

Visual of The objectuals

The objectuals

The Objectuals is a series of work by artist Hyung Koo Lee , it features an interesting mix of visual distortion apparatus for the human body. Lee says that he experienced …

Visual of The Tissue Engineered Meat of Tomorrow

The Tissue Engineered Meat of Tomorrow

The meat in the supermarket is abstract, square and habitually made from wickedly manufactured animals. A friend once told me he only eats meat if he "can not recognize the animal …

Visual of The Top 10 New Organisms of 2007

The Top 10 New Organisms of 2007

Genetic engineering isn't just for scientists in ivory towers or corporate R&D labs anymore. Researchers are still creating new mice and crops every week, but the tools and …

Visual of Typosperma

Typosperma

Another project by Oded Ezer, Typosperma is the second experimental typo project in his 'Biotypography' series. As a paraphrase on the biotechnology definition, 'Biotypography' is …

Visual of Urban Camouflage II

Urban Camouflage II

Aaron Larney made these urban camouflage printed hoodies, just in case you need to blend into your dorm's notice-board. See also: Urban Camouflage I .

Visual of Vanity ring

Vanity ring

For all you self-Googlers out there. And yes.. that means you too! Back in the old days (pre-next-nature) you used to wear gold rings and lots of bling you show off your wealth …

Visual of Vin Memoriam

Vin Memoriam

The Vin Memoriam concept introduces a new ritual in the mourning process after losing a loved one. When a person has passed away, a small amount of blood can be processed into a …

Visual of Waterworld - Old nature meets next nature

Waterworld - Old nature meets next nature

Atkin's Architecture Group recently won the first prize award for an international design competition with this hyperreal entry. Set in a spectacular water filled quarry in …

Visual of What does 200 Calories look like?

What does 200 Calories look like?

Everyone knows some foods have more calories than others. For many people eating turned into an information science, having to continuously read the amount of calories of the …

Visual of A view beyond

A view beyond

Imagine the impossible… a secret transatlantic tunnel running between New York and London, that has lain undisturbed for a hundred years. And imagine an extraordinary optical …

Visual of Agro-Veillance

Agro-Veillance

This summer researchers from technology firm QinetiQ and from Aberystwyth University flew an autonomous unmanned aerial vehicle (UAV) over fields in England and Wales to map the …

Visual of Feelings Translated to Plants

Feelings Translated to Plants

Ambient Biomedia is an investigative project about using living beings, in particular plants, to display human lifestyle problems information. The working principle of our systems …

Visual of Ambient Umbrella

Ambient Umbrella

The Ambient Umbrella shows when rain or snow is in the forecast by illuminating its handle. Light patterns intuitively indicate rain, drizzle, snow, or thunderstorms. Local …

Visual of As real as it gets

As real as it gets

Art Directors Andreas Junus and Irawandhani Kamarga; copywriter Darrick Subrata and photographer Anton Ismael (Indonesia) went through some trouble , visualizing Photoshop's …

Visual of Asus introduces scented laptops

Asus introduces scented laptops

Integrating nature in our technology. There are four different laptops: Floral Blossom (pink), which has a tropical, flowery scent; Musky Black (black), which incorporates a waft …

Visual of Back to Nature?

Back to Nature?

Now this is how you do it. First you take the meat of a hundred animals; chickens (19%), turkeys (17%). Secondly, you blend them in a large tank with water, mais, wheat, oil, fat, …

Visual of Banksy Pet Store

Banksy Pet Store

Famous street artist Banksy left his grafitti spraycans at home and sets to opening a pet store. The difference with this pet store is that instead of looking at pets, you look at …

Visual of Blendie - the voice controlled blender

Blendie - the voice controlled blender

Blendie is an voice controlled blender with a mind of its own. Materials are a 1950’s Osterizer blender altered with custom made hardware and software for sound analysis and motor …

Visual of Boxing the Desert

Boxing the Desert

With his Waterboxx , Pieter Hoff (The Netherlands) won the Bèta Dragons Award 2008. It is an instrument that supports plants and trees in order to survive in difficult …

Visual of Ceci n'est pas une Potato Chip

Ceci n'est pas une Potato Chip

Proctor and Gamble, the maker of Pringles , has successfully argued in a British court that their product is ‘not a potato chip’. Pringles are also officially now, not potato …

Visual of Cell phone cooking

Cell phone cooking

Popping corn with your handheld? Pity this recently discovered cellphone feature is a hoax , created by a company to promote bluetooth headsets (thanks Teun ).

Visual of Clear Blue Sky

Clear Blue Sky

Who likes clouds anyway? Especially for the people still living in the suburbs of Venray (small town in the Netherlands), artist Helmut Smits made this billboard depicting a clear …

Visual of Click me

Click me

Humans become web-banners. Click me! By Irina Blok.

Visual of Cloudmaker

Cloudmaker

Always dreamed of creating your own clouds? You can now create them... from text. Wordle is a toy for generating 'word clouds' from any text, url or rss stream you provide. The …

Visual of Composting Bottle

Composting Bottle

Don't you just love that vanishing bioplastic bottle! It is our peculiar object of the week.

Visual of Consuming Illusions

Consuming Illusions

So you thought the 'consumption of illusions' was a typical digital world activity of second life residents and gaming addicts? Never underestimate virtuality in everyday life. …

Visual of Crash–Test Pizzas?

Crash–Test Pizzas?

Schwan Consumer Brands, a leading frozen pizzas brand, has launched a challenging brand: UGLY. The design embraces the rising trend for natural, honest food and the notion that …

Visual of Dashboard Tree

Dashboard Tree

What is that growing on my car dashboard? Is that a tree? Indeed, Ford and Honda's next-generation dashboard instrument clusters feature trees (a vine in Ford's case) that grow …

Visual of Designing for Next Nature: selected proposals

Designing for Next Nature: selected proposals

Some months ago we sent out a call for proposals asking for visions, statements & ideas on we how we can design, build and live in next nature. We received an overwhelming …

Visual of Driving on Algue

Driving on Algue

Green bubbles? Yes, they seem to be everywhere nowadays. But for a change we aren't talking about those greenish marketing bubbles of the flourishing sustainability cult. …

Visual of Playing with Dry Water

Playing with Dry Water

The Waterboard is an interactive installation by Mike Burton giving the user a chance to play with water without getting wet. By drawing lines on the whiteboard, the water will …

Visual of Fake-Space Race

Fake-Space Race

Some weeks ago we pondered over the oddity of a space race in cyberspace . Rockets and jet-packs –so cool in the previous century– don't make sense in a virtual environment. The …

Visual of Find Brain, replace with GPS

Find Brain, replace with GPS

So far, over-dependence on GPS devices has resulted in more inconvenience than actual danger, but earlier a U.K. woman sent her £96k Mercedes flying into a river, trusting the …

Visual of Genetic Map of Europe

Genetic Map of Europe

European biologists have constructed a genetic map of Europe showing the relations between its various populations. The right part of the map shows the location in Europe where …

Visual of Google DNA search

Google DNA search

Last year Google invested four million in 23andme , a commercial research center that maps out your DNA for 1000 bucks. Now Google also invested in Navigenics , a company that …

Visual of High Heels

High Heels

Is this the plastic surgery of the future? Peculiar image by Julie Rrap .

Visual of Honeycomb vase

Honeycomb vase

This Honeycomb vase was made from a vase-shaped hive that 40.000 bees colonized for one week, building a hexagonal comb to encompass the existing form. Created by Studio Libertiny …

Visual of Hurricane Control Causes a Storm of Lawsuits

Hurricane Control Causes a Storm of Lawsuits

Controlling hurricanes could save lots of lives and dollars. According to a study published in by climate physicist Daniel Rosenfeld , adding dust to Hurricane Katrina's base …

Visual of Organic Coca-Cola

Organic Coca-Cola

Whoever you are, whatever you do, wherever you may be. You can’t beat the real thing. It really refreshes and brings real satisfaction in every glass. It was not until America’s …

Visual of Image Consumption Continues...

Image Consumption Continues...

"Do you know what it really reminds me of? ... Tasty Wheat . Did you ever eat Tasty Wheat ?" – from The Matrix. This is a project by pundo3000.com , in which 100 products were …

Visual of iWater

iWater

Somehow I feel there is some deeper meaning in this cheesy video. No? See also: Water in my Phone .

Visual of Banana Juice Box

Banana Juice Box

This Japanese Juice box is camouflaged from modern box designs and tries to convince consumers with its appealing 'natural' look. A schoolbook example of biomimicmarketing ; …

Visual of Just right for the garden: Mini-Cow

Just right for the garden: Mini-Cow

Rising supermarket prices are persuading hundreds of families to turn their back gardens into mini-ranches stocked with miniature cattle. For between £200 and £2,000, people can …

Visual of Let the plants do the dirty work.

Let the plants do the dirty work.

Mathieu Lehanneur created a plant-powered indoor filtration system, that pulls in filthy air to be processed through a plant's leaves, roots, and humidity, reintroducing purified …

Visual of Light weeds

Light weeds

Lightweeds is a project by Simon Heijdens and currently exhibited at the MoMA - part of the Design and the Elastic Mind exhibition . The organisms - plants, weeds, trees - exist …

Visual of Michelangelo's David After his Stay in the US

Michelangelo's David After his Stay in the US

I got this in my email from my uncle who lives in Australia. "After a short stay in America, David returns to Italy" . You know what's coming before you even open the picture. …

Visual of Million dollar burger

Million dollar burger

PETA –People for the Ethical Treatment of Animals– has posed a challenge to the world's scientific community: The first person to come up with a method to produce commercially …

Visual of Recycled Books

Recycled Books

A lot of dead books were used to make this piece of tree trunk. By Jacqueline Rush Lee | Related: Modernistic Tree | Modernistic Chair

Visual of Multicultural Gourmet Pack

Multicultural Gourmet Pack

Multicultural Gourmet Pack is a new meat package that contains a variety of butchered meat products based on different religions and believes. The pack contains a total of 4 …

Visual of Paradise by the Laptop Light

Paradise by the Laptop Light

Paradise by the Laptop Light is a next nature event with short films, speedlectures, special guests and one laptop. It will be held on 12 September 2008 16:30-17:30, as the …

Visual of Power Ivy

Power Ivy

Cochran’s sustainable design group, SMIT (Sustainably Minded Interactive Technology) came up with a project called GROW. It's an Ivy-like covering of a building that generates …

Visual of Reconstructing Faces

Reconstructing Faces

The video below is featuring a computer-generated replica of actress Emily O’Brien’s face at high-definition resolution. The Image Metrics process takes a captured video and …

Visual of Robomonk

Robomonk

An industrial robot has been given an unusual production task; writing out the full Martin Luther bible "by hand" in a calligraphic style. The robot arm appears to be a fairly …

Visual of Roboswift, Eyes in Disguise

Roboswift, Eyes in Disguise

With its 50 cm wing span and 80 grams of weight, this high tech bird is ready to infiltrate swift surveillance squads next summer. Aerospace engineering students at TU Delft , …

Visual of Robotic Red Snapper

Robotic Red Snapper

Just because you're feeling paranoid, doesn't mean the fish aren't actually spying on you. Engineers at the University of Kitakyushu created an underwater survey robot that looks …

Visual of Search Engine

Search Engine

"Google has stationed approximately a million computers worldwide to be able to process the 40 billion searches per month. One search request uses as much energy as a low-energy …

Visual of Second Skin Trailer

Second Skin Trailer

Second Skin takes an intimate look at computer gamers whose lives have been transformed by the emerging genre of Massively Multiplayer Online games (MMOs). World of Warcraft, …

Visual of Selling soap

Selling soap

You eat what you touch. via: scaryideas.com

Visual of Small Talks

Small Talks

An installment in the series of: " Things I have learned in my life so far ". sagmeister.com These dividing pages for Austrian magazine .copy spell out:"Starting / a / charity / …

Visual of Solar Trees

Solar Trees

Welsh designer Ross Lovegrove ('Captain Organic') placed several glowing Solar Trees in the streets of Vienna (October 2007). These solar powered streetlights could save cities …

Visual of Speaking at the Wall

Speaking at the Wall

I used to hear voices in my head, but now they seem to be coming from the walls – am I back in to the womb? No wait.. it's a wall that reacts to the spectators voice (quicktime) . …

Visual of Surrogate Sushi Unmasked with DNA Test

Surrogate Sushi Unmasked with DNA Test

These two teenagers, Kate Stoeckle and Louisa Strauss, just found out many New York sushi restaurants and seafood markets are playing a game of bait and switch with their sushi. …

Visual of The Blogging Houseplant

The Blogging Houseplant

Meet midori-san ,  the first blogging houseplant! Through sensors connected to the leaves of this Sweetheart Hoya reads bioelectric currents through the plant, this gives …

Visual of The peoples gardens

The peoples gardens

Volkstuintjes (or peoples gardens) might be a typical Dutch / European tradition, offering gardening space in urban environments in which people don't have their own gardens. It's …

Visual of The Presidential Harvest

The Presidential Harvest

" Eat the View " is a campaign to plant healthy, edible landscapes in high-impact, high visibility places, whether it's the "First Lawn" or the lawn in front of your child's …

Visual of Third Life

Third Life

Long after Second Life servers have been shutdown, Augmented Reality is a common place . Thanks to our bioengineered eyes, or our electronic contact lenses , and years of data …

Visual of Type trousers

Type trousers

Beauty and the Geek jeans by Erik de Nijs. The trousers offer a full Querty keyboard layout as well as a mouse, speakers and a little joystick. As he calls it: "Beauty is skin …

Visual of Soft Drinks for Suckers

Soft Drinks for Suckers

Tru Blood is a synthetic nutrient for vampires that completely eliminates the need to seek sustenance from any living creature. Packaged as a consumer good at your local …

Visual of Vegetarian Nike

Vegetarian Nike

No animals were hurt or injured in the production of these vegetarian Nikes. Created by Paul van Barneveld . Thanks Floris . See also Flesh Nike .

Visual of Virtual Transgender Suit

Virtual Transgender Suit

A study by psychologists at Nottingham Trent University has found that 54 percent of all males and 68 percent of all females "gender swap" – or create online personas of their …

Visual of Wallpaper Blooms When the Heat is On

Wallpaper Blooms When the Heat is On

Now this is a spot on example of  information decoration : a heat–sensitive wallpaper of which the printed flowers will be blooming when the radiator is on. Created by Shiyuan .

Visual of Waterdrop

Waterdrop

Imagine: your walking in the park about 15 years from now, water shortage is rising and public water fountains and ponds are becoming scarce. Why not settle for the next best …

Visual of Wear Your Social Network

Wear Your Social Network

Get Wickd (props for the name boys – totally wicked!) is a tech-fashion brand that sells basic clothes with barcodes that can link your mobile phone to any page on the web, from a …

Visual of Work in progress

Work in progress

"I think we are all "work in progress", this necklace is featuring a cool progress bar to indicate that." Nice work Irina!

Visual of Your grand-grand-parents new media

Your grand-grand-parents new media

19th century people needed some explanation to understand the difference between the regular candlelight and the electrically simulated candlelight. Note the disclaimer at the …

Visual of Agenda Wallpaper

Agenda Wallpaper

Using thermochromatic ink, which changes color when the temperature exceeds a specific degree, designer Josien Pieters created a prototype of a dynamic wallpaper that …

Visual of Apple Salad

Apple Salad

Tasty realization of the classic Apple rainbow logo, made entirely out of fresh fruit. The clever creation was made by Richard Thomas from sliced kiwis, bananas, oranges, …

Visual of Ars Electronica Festival goes Next Nature

Ars Electronica Festival goes Next Nature

This years edition of the Ars Electronica festival , which has been hangout for international experts from the arts and sciences for almost three decades, focuses on the nature …

Visual of Artificial 'Trees' to Stop Climate Change

Artificial 'Trees' to Stop Climate Change

The fabrication of forests with artificial trees is one of the best strategies to stop climate change, according to scientists of the Institution of Mechanical Engineers . The …

Visual of Autimacy

Autimacy

Autimacy [aw-tih-muh-see] - noun, plural - cies. The term was coined by Simona Kicurovska .

Visual of Back to Where it Came From

Back to Where it Came From

Fish sticks are among the most wondrous modernistic inventions of the previous century. They are easy to eat, efficient in their packaging & transport and the greatest of all: …

Visual of Biodiversity in the Supermarket

Biodiversity in the Supermarket

Some say global biodiversity is decreasing. I am not entirely sure.

Visual of Biomimicmarketed Strawberry Juice

Biomimicmarketed Strawberry Juice

Peculiar object of the week. See also Banana Juice box , Modernistic Watermelon , Cubic Fruit , How to grow an Orangina Bottle .

Visual of Boomeranged Metaphors

Boomeranged Metaphors

At the start of the digital era, metaphors from everyday life were used – in what was then the new computer environment – in order to make otherwise incomprehensible technology …

Visual of Counterfeit Crab

Counterfeit Crab

Engraved Hairy Crab: fake or real? ??? (Dazha crab), or more widely known as Shanghai Hairy Crab, is in season right now. This typical Shanghai delicacy is particularly sought …

Visual of Crowdsourced drink

Crowdsourced drink

Remember the days when the flavor of a fruity drink was simply connected to an apple, orange, strawberry, kiwi, or perhaps – if you felt really exotic – an acai berry? Nowadays we …

Visual of Cyborg Insects

Cyborg Insects

Scientists at the University of California created a neural implant for a beetle that gives them wireless control over the insect. Electrical signals delivered via the electrodes …

Visual of Dandella Shows You the Way

Dandella Shows You the Way

How to navigate the urban jungle? Adopting the metaphorical image of a dandelion in flight, Dandella is a GPS device that shows you the way. Inspired by how young sunflowers …

Visual of Digital Overruns Nature: Pixel Attack

Digital Overruns Nature: Pixel Attack

Apparently, camouflaging oneself with digital patterns rather than nature-imitated patterns functions as a better camouflage within "old-nature" situations. So the digital …

Visual of Egg improvements

Egg improvements

Since it is Sunday, let's have a genetically photoshopped egg with a handy integrated eggholder. Not sure if these should be mass produced (if possible): Too painful for the …

Visual of Energy Saving Chandelier

Energy Saving Chandelier

I deem you have to be over sixty to have an object with so many historical layers of media in your house. Let's analyze. We are looking at a chandelier in which the candle …

Visual of Epidermits – The Tissue Engineered Toy

Epidermits – The Tissue Engineered Toy

The world of tissue engineering is usually associated with medical applications . But how about some tissue engineered toys? The Epidermits toy is the Karten Design firm 's …

Visual of Feeding the world: oh not organic

Feeding the world: oh not organic

Daring talk by agriculture expert Louise Fresco , who has the guts to break the organic trance of the fashionably-natural-farmers-market people at TED . During her talk she is …

Visual of Field of Waves

Field of Waves

Parks are not nature. Parks are culture: man-made simulations of nature, carefully constructed to provide walkers, runners and mountain bikers with a recreational, yet confined – …

Visual of Four environmental 'heresies'

Four environmental 'heresies'

TED talk by Steward Brand – the man who helped usher in the environmental movement in the 1960s and '70s – has been rethinking his positions on cities, nuclear power, genetic …

Visual of French Hyperbodies

French Hyperbodies

"Paris, printemps 2019: Oh Darling, you look gorgeous." Nowadays we are so used to Hollywood hyperbodies – a simulation of a body that never existed – it is good to see a …

Visual of Fruit4Day

Fruit4Day

Fruit does wonders for your health. No doubt about it. It is recommended to consume two pieces of fruit each day. One.. Sorry, I've lost count? How convenient to have the two …

Visual of Games Become Jobs: Gold Farming in China

Games Become Jobs: Gold Farming in China

Chinese workers slaying monsters to earn gold for western consumers. It sounds surreal, but it is a far from virtual reality for the so-called 'gold farmers', who are working in …

Visual of Growth Assembly

Growth Assembly

Though the example product seems a little far-fetched; growth assembly could be quite revolutionary. Worldwide shipping of manufactured things is very inefficient. Why not ship …

Visual of Hamburger sneaker

Hamburger sneaker

We are unsure whether it is just an accidental evolutionary recombination, or that the hamburger sneaker was bound to happen – somehow, it feels natural. Our peculiar object of …

Visual of Get it out of Your Head

Get it out of Your Head

Talking about image consumption ... Via scaryideas.com | Related: Some Kids Don't Like Chicken | Banksy Pet Store   | Featherless Chicken | Confetti Chicken | FFR Image Consumption

Visual of How to Grow your Own Toaster

How to Grow your Own Toaster

Now here is an experiment any one can do at home: Look around in your house and try to find a consumer product of which you know where it was made and by whom. Got any? Indeed, …

Visual of Hyper Fruit

Hyper Fruit

Imaginary advertizement for genetically engineered hybrid hyperfruits featuring an 'limwi', 'kiwange' and a 'strawblackberry'. Imagine a taste of things to come. Makes you want to …

Visual of I'm loving it

I'm loving it

Sometimes you just need to settle with the surrogate. Peculiar image of the week. See also (in the baby series): Infant pillow , We are all born in a world . Thanks Hendrik-Jan .

Visual of Kiwi Juice Packaging

Kiwi Juice Packaging

What you see is what you get – at least that is what you hope – with this biomimicked kiwinut juice packaging designed by Naoto Fukasawa. See also: Image consumption , Image …

Visual of Laptop Pillow

Laptop Pillow

With who or what do we have contact the most in our daily life routines? Our family, our bed pillow, doorknobs maybe? The answer is probably: Display. And now there is even a …

Visual of Lucky Fruits

Lucky Fruits

A Chinese farmer, Gao Xianzhang, has invented baby-shaped buddha pears and he is planning to export his idea. The produce became a success in his local province since people seem …

Visual of Genomics & the mapping of a wine grape

Genomics & the mapping of a wine grape

What is genomics? How will it affect our lives? Serial entrepreneur Barry Schuler explains the genomics revolution. We are now not just reading genomes, we are writing them. …

Visual of Meat Pork

Meat Pork

This meat pig was reconstructed by Ton Meijdam . See also: Get vegetarian teeth and eat less meat , Million Dollar Burger , Back to where it came from ,

Visual of Modern Fossils

Modern Fossils

Remember the Gameboy Bricks by Gijs Gieskes? The same vibe must have been picked up by Christopher Locke (Chicago, US) as he opened his Modern Fossils Shop with many more peculiar …

Visual of Modernistic Meat

Modernistic Meat

This slightly uncanny piece of modernistic meat is actually not made from meat, but from wax, oil, paint polystyrene, stage blood & latex, by artist John Isaacs , who titled …

Visual of Nano snowman

Nano snowman

This snowman is 10 µm across, 1/5th the width of a human hair. The snowman was made from two tin beads used to calibrate electron microscope astigmatism. The eyes and smile were …

Visual of Not so Happy Meals

Not so Happy Meals

This week a Brazilian prosecutor asked a judge to nationally ban toys sold with meals in fast-food outlets like McDonald's and Burger King, because it can lead children to develop …

Visual of OOMouse versus Magic Mouse

OOMouse versus Magic Mouse

Recently were introduced, the OOMouse ... ...and the Magic Mouse . Both tools are developed to browse the ones and zeros more easily. It almost seems unfair to compare them, so I …

Visual of Orthorexia Nervosa: the

Orthorexia Nervosa: the "healthy" eating disorder

Following anorexia nervosa (under eating) and bulimia nervosa (overeating and compensating), orthorexia nervosa (obsessively healthy eating) is the latest eating disorder in the …

Visual of Plant Plays First-Person Shooter

Plant Plays First-Person Shooter

After the plant that glows when thirsty , the plant that calls when thirsty , the dataplant , plantvertizing , the emphatic plant and the blogging houseplant , there is now a …

Visual of Robot hand meets Sushi

Robot hand meets Sushi

We are anxiously waiting for the robot that makes the sushi, but at Squse , they have created the hand that can carefully place the delicacies in a box without crushing them. …

Visual of Sunlight-shaped Furniture

Sunlight-shaped Furniture

Austrian designers Katharina Mischer and Thomas Traxler have created a solar powered machine that makes arrays of furnishings that vary based on how much sunlight it receives over …

Visual of Tangible hologram projector

Tangible hologram projector

Using ultrasound technology, researchers at the University of Tokyo have developed a holographic projector that displays three-dimensional virtual objects you can feel with your …

Visual of Branded Pigs

Branded Pigs

What are these people doing? Of course! They are tattooing a pig with the pattern of the luxury bag brand Louis Vuitton. For those who want something more special than the mundane …

Visual of The Nanosong

The Nanosong

The American Chemical Society is holding a contest seeking short videos that answer the question: "What is nano ?" UC Berkeley graduate student Patrick Bennett and his colleagues …

Visual of The Trillion Node Network

The Trillion Node Network

"I think there is a world market for maybe five computers" , a remark made by Thomas J. Watson of IBM in 1943. But what if the number of computing devices connected to each other …

Visual of Everyday...

Everyday...

... a new McDonalds opens somewhere in the world. Via RebelArt , via Ekosystem . Related: post-apocalyptic religious artefact , hamburger sneaker , Image consumption .

Visual of Triceracopter

Triceracopter

The Triceracopter is half Triceratops, half helicopter. If dinosaurs and technology evolved at the same time, this is what the helicopter might have look like? Built as a …

Visual of Urban Camouflage

Urban Camouflage

Laurent La Gamba makes photographic installations dealing with camouflage. His work juggles with the idea of natural procrypsis in the urban space and deals with the relations …

Visual of USB Finger

USB Finger

No this isn't photoshopped. After a motor accident Finish hacker Jerry Jalava decided not to use a normal prosthesis and felt that a prosthesis usb memory stick would enhance his …

Visual of WakeUp light tested on Roosters

WakeUp light tested on Roosters

://nextnature.net I tend to think of the Philips Wake Up Light as a product of missed opportunity: Good concept, implementation too cheap and illustrative. Especially the crappy …

Visual of Water Shows When the Heat is On

Water Shows When the Heat is On

Designer Carlijn Compen upgraded her watertap with some LED's that shift color along with the heat of the water. A simple yet effective example of information decoration that will …

Visual of Wetware [definition]

Wetware [definition]

Though its exact definition has shifted over time, the term "wetware" and its fundamental reference to "the physical mind" has been around from the mid-1950s. In its original, …

Visual of Where newspaper racks go to die

Where newspaper racks go to die

These photos of disused newspaper racks in a San Francisco storage yard – taken March 13, 2009 by AP/Noah Berger – are pretty much all you need to know about the state of the …

Visual of Where the Green Grass Grows

Where the Green Grass Grows

It grows freshly in your windowsill; a lawn to linger. By hyock.com | Related: Grass Wheel | Office Grass | Caravan Garden | Parking

Visual of Who designed the banana?

Who designed the banana?

Looking at a banana from a design perspective, one immediately notices the fruit is highly ergonomic and sophisticated: Bananas fit perfectly in the human hand, they come with a …

Visual of You are what you eat

You are what you eat

Evolution according to Ted Sabarese . Via Trendbeheer .

Visual of You Are What You Eat, part II

You Are What You Eat, part II

Mark Menjivar created a series of portraits of people across the United States, by taking pictures of their refrigerators content. Quote: "For three years I traveled around the …

Visual of 3D Bioprinter promises tissue on demand

3D Bioprinter promises tissue on demand

Behold "the world's first production model 3D bio-printer." A machine capable of arranging human cells and artificial scaffolds into complex three-dimensional structures, which …

Visual of Acoustic Botany

Acoustic Botany

With his speculative ‘acoustic garden’ David Benqué tries to explore our cultural and aesthetic relationship to nature. He states that the current debate around Genetic …

Visual of Brand Environmentalism: The Augmented Reality Sneaker

Brand Environmentalism: The Augmented Reality Sneaker

Once, we wore footwear to protect our feet from the hostile influences of our natural environment. But with the replacement of our natural environment by a world of design, the …

Visual of Augmented Reality Maps

Augmented Reality Maps

Since a few years the internet in combination with mobile phone technology brought us something that we refer to as augmented reality : A digital projection that is placed over …

Visual of BMW's Flexible Skin Concept GINA

BMW's Flexible Skin Concept GINA

This extraordinary concept model that came out of the batcave of BMW shows how textile might be the future of car design. By replacing metal bodywork with a strong but flexible …

Visual of Breathe, Believe, Surf the Web

Breathe, Believe, Surf the Web

A while ago a plan was proposed within the European Union to add a  “Three Strikes, Out” law regarding to copyright infringement. After three accuses of copyright infringement by …

Visual of Car Skin

Car Skin

Our peculiar image of the week was created by artist Olaf Mooij . Seen at Discovery Festivals Cabinet of Curiosities .

Visual of Clothes from a Can

Clothes from a Can

Frequent readers of this website might be familiar with our claim that Next Nature emerges from a fusion between the Born and the Made. But now we can add another: the fusion of …

Visual of Death: An in your Face type of Business

Death: An in your Face type of Business

Everyone wants to be remembered after his or her death. Some choose to be buried, others to be cremated. The company Cremation Solutions has a new service which ensures you will …

Visual of Digital Gastronomy

Digital Gastronomy

The food printer seems to be one of those lustrous concepts that continues to pop-up in the fantasy of techno-connoisseurs. Some years ago James King already proposed a printed …

Visual of Engineering Mosquitoes into Flying Vaccinators

Engineering Mosquitoes into Flying Vaccinators

Scientists have developed a mosquito that spreads vaccine instead of disease. The researchers, led by molecular geneticist Shigeto Yoshida of Jichi Medical University in Tochigi …

Visual of Genetically Modified Salmon moves to Kitchen Table

Genetically Modified Salmon moves to Kitchen Table

The US Food and Drug Administration is considering whether to approve the first genetically engineered animal that people would eat — salmon that can grow at twice the normal …

Visual of Goodbye, Nature vs Nurture

Goodbye, Nature vs Nurture

Talking about nature and nurture as separate, clear-cut forces is far adrift from the complexities of developmental science, says Evelyn Fox Keller in NewScientist . ONE of the …

Visual of Hay Baling Fun

Hay Baling Fun

It is a widespread belief that, contrary to people living in urban areas, farmers have a strong connection with 'nature'. One seriously starts to doubt that after watching this …

Visual of In Pursuit of Artificial Flavoring

In Pursuit of Artificial Flavoring

Following in the footsteps of a Marco Polo-esque spice trade, next nature explorers Jon Cohrs and Ryan Van Luit travel by canoe past massive cargo ships and factories in search of …

Visual of Infobesity

Infobesity

Could this 2.0-bird be suffering from Infobesity ? Then it must be the result of excessive infocalorie consumption. Following people and news-sources on microblogservices like …

Visual of Keep it cool with the Bio-Robot Fridge

Keep it cool with the Bio-Robot Fridge

The Bio Robot fridge is a speculative product that uses a non sticky, odourless gel to envelope stored food as individual pods. The idea is that the gel cools by absorbing heat …

Visual of Kosher Coke

Kosher Coke

Last week I opened a bag of potato crisps that read: "We know the origins of all our ingredients" . As some crisps had already disappeared down my throat, this made me suddenly …

Visual of Let the Bacteria do the Cleaning

Let the Bacteria do the Cleaning

Dusting furniture and floors should be history in forty years time, as special bacteria in a yet to develop cleaning product will be eating the dirt. The speculative cleaning …

Visual of Manko & Zero [#4]

Manko & Zero [#4]

The way down was slow and somehow greasy. Total darkness surrounded them. Gill turned on the car radio and the LED's lit up their faces in a green pulsating glow. 'Jovi Rocks!', …

Visual of Meet the Cellphone that drinks Coke

Meet the Cellphone that drinks Coke

Chinese designer Daizi Zheng created a conceptual mobile phone for Nokia that could be powered by cola. The idea is the phone could run on a battery that uses enzymes to generate …

Visual of Mind Expanding Lead

Mind Expanding Lead

These pencils release allegedly mind-expanding aromas, letting you 'smell your way to smartness while you write'. According to the creators , the fragrance is encapsulated using …

Visual of Nano-Silver Foam Condom For Women

Nano-Silver Foam Condom For Women

As we are calling for debate-provoking nanotech products that might hit the shelves of the Supermarket in the next ten years , some products much crazier than the ones we could …

Visual of Nano Supermarket – Opening Pictures

Nano Supermarket – Opening Pictures

Last Saturday, our Nano Supermarket opened its doors in a pleasurably crowded atmosphere. Below are some snapshots of the opening event. If you happen to be in the neighborhood, …

Visual of NANO Supermarket – Introducing the Jury

NANO Supermarket – Introducing the Jury

Ten days left to submit your speculative product idea for the Nano Supermarket . The jury that will select the finest submissions – to be exhibited in the Nano Supermarket this …

Visual of Natural-Born Junkies

Natural-Born Junkies

Hippopotamus: a 2,5cm-long tablet-shaped nonliving chewable animal, member of a multi-species flock known as the Animal Parade, which tastes like fruit and is found in little pill …

Visual of Next Nature Movie #10 – Idiocracy

Next Nature Movie #10 – Idiocracy

As we are nearing the end of the year, and anticipate you might have some time to watch a film, we discus our top 10 Next Nature movies. Idiocracy (2006) is not a great film, …

Visual of Next Nature Spotter – iPhone application

Next Nature Spotter – iPhone application

While the spotting of old nature phenomena in our surroundings – birds, insects, trees, stars, etc – has a large tradition enjoyed by millions, the spotting of next nature …

Visual of Nomadic Plants

Nomadic Plants

Nomadic Plants are a species assembled from a group of robotic-electronic-biological organisms living in symbiosis in order to survive in habitats affected by human activity. The …

Visual of Outer-Space as Local-Space

Outer-Space as Local-Space

In 1977, NASA launched Voyager 1 and Voyager 2, two unmanned interplanetary space probes that were sent out to explore the outer space. Aboard each was a record which intended to …

Visual of Runaway Robots Hunted by the Mammals They Were Designed to Replace

Runaway Robots Hunted by the Mammals They Were Designed to Replace

Last week, the U.S. Navy announced that four of their “ REMUS 100 ” unmanned underwater vehicles sailed off-radar and stopped responding to commands. The ‘bots were part of a …

Visual of Seashells are becoming Unnecessary

Seashells are becoming Unnecessary

At the beach, I'm always on the look-out for seashells big enough to hold against my ear to hear the sound of the sea . This child-like behavior still resonates with me. But I got …

Visual of Self Catching Fish

Self Catching Fish

Researchers at the Marine Biological Laboratory at Wood's Hole, Massachusetts, are testing a plan to train fish to catch themselves by using a sound broadcast to attract them into …

Visual of Sex or Cellphone? Survey says 29% prefers the phone

Sex or Cellphone? Survey says 29% prefers the phone

Samsung has released the results of a consumer study that indicated nearly a third of Denver–area residents would sooner give up sex for a year that go without a cell phone for …

Visual of Skin Paper

Skin Paper

Skinpaper is a speculative work by Tommaso Lanza and Vanessa Harden that explores the cross section between a living specimen and paper. "Skin paper is made of breathable …

Visual of Smart vending machine

Smart vending machine

  At Tokyo's Shinagawa Station visitors can now select beverages from a 47-inch touch panel. An embedded camera will recognize your gender and age, allowing the machine to …

Visual of Social Networking with Plants

Social Networking with Plants

Using energy is not a social activity. Every electrical device we use has its own carbon “foorpint” which, in excess, can harm other living beings. How and to what extent you’ve …

Visual of Stephen Hawking: Übermensch

Stephen Hawking: Übermensch

This sculpture of scientist Stephen Hawking – who is both highly intelligent as well as highly dependent on technology – is our peculiar image of the week. Created by by Dinos …

Visual of Sign Out Forever

Sign Out Forever

An earlier post on Next Nature learned that The Good People behind Webwill provide us with a service to extend our lives on social networks after our physical death. But what if …

Visual of Technostalgia

Technostalgia

In Next Nature, not only old nature is being idealized. Because of the rapidness of new emerging technologies, we have a tendency to dwell on earlier prototypes. To recall …

Visual of The Anthropocene Debate: Marking Humanity’s Impact

The Anthropocene Debate: Marking Humanity’s Impact

  Is human activity altering the planet on a scale comparable to major geological events of the past? Scientists are now considering whether to officially designate a new …

Visual of The Keyboard for a new generation

The Keyboard for a new generation

Peculiar object of the week. Via

Visual of Transgenic Stingrays for Fashionable Feet

Transgenic Stingrays for Fashionable Feet

Rayfish Footwear, a company based in Thailand, has recently produced what may be the world's first genetically modified stingray. This ray exhibits an unusual, colorful pattern …

Visual of Transnatural Expo + Symposium

Transnatural Expo + Symposium

If you happen to be in the neighborhood you might want to attend the Next Nature lecture I will be throwing at the Transnatural symposium this Saturday 13-03-2010 at the Trouw …

Visual of Unlimited Urban Woods

Unlimited Urban Woods

What to do when you have a small city with limited space, and you rather turn available space into parking lots instead of parks? You turn to DUS Architects for an unlimited …

Visual of Washable Tattoo

Washable Tattoo

So we know now that we can embed the traces of our every day lives in our clothes . Well, some might find this strategy unsatisfying and would like to embed the traces of their …

Visual of A day made of glass

A day made of glass

This video shows the design vision of Corning, a company that specializes in glass. Not just any glass, but glass incorporating technology, electronics and displays. And it sure …

Visual of Animal-Free Meat Could Put a Hold on Global Warming

Animal-Free Meat Could Put a Hold on Global Warming

Growing meat in the lab, rather than slaughtering animals, could become a viable alternative for people who want to cut the environmental impact of their food consumption, but …

Visual of Beetle Egg

Beetle Egg

Our peculiar image of the week presents us the lustrous uncannyness of a Beetle car in its embryonic stage. Rest assure: this is fiction, however, metaphorically the sculpture by …

Visual of Blue, Belgian and Beefy

Blue, Belgian and Beefy

The Belgian Blue is a unique cattle breed that was developed quite accidentally in the late 1800s. An chance mutation lead the cattle to develop 'double muscling,' which occurs …

Visual of Bulletproof Skin

Bulletproof Skin

Recent work of artist Jalila Essaïdi exemplifies of how science and art can meet and create meaningful inventions for society. Jalila Essaïdi used the spider silk produced by …

Visual of City Rats Love Ethnic Food

City Rats Love Ethnic Food

City rats, it seems, prefer the same foods that humans do: Greasy, fatty, sweet, and salty. Although rats are usually seen as the billy goats of city life, ready to chow down on …

Visual of Conquering the Skies

Conquering the Skies

Everywhere we go, we conquer the land and shape it to our preferences. The next place to build might as well be the clouds. Tiago Barros , designer and architect, has decided to …

Visual of Did Nature Cease to Exist in the '60s?

Did Nature Cease to Exist in the '60s?

Our historical snippet of the moment is a Canadian television fragment from 1968 featuring a debate between Norman Mailer and Marshall McLuhan on the implications of media …

Visual of Drugs are Nuts

Drugs are Nuts

Thinking about Next Nature can sometimes result in a feeling of vertigo. Normal standards are eroded and slowly replaced by next natural ones. A bewildering example can be found …

Visual of Egg Sausage

Egg Sausage

Our food production is much more technological than we typically realize. My appologies for disturbing your trance; I realize that sometimes you'd rather linger in the illusion. …

Visual of Fly Paper Clock

Fly Paper Clock

Bionic horror by designers James Auger and Jimmy Loizeau , who have created a clock that traps insects on flypaper before depositing them into a vat of bacteria. The resulting …

Visual of Gamers Solve Enzyme Riddle

Gamers Solve Enzyme Riddle

In a vivd example of the blur between culture and nature, players using an online game called Foldit have helped solve complex questions for researchers about enzyme models. The …

Visual of Glowing Glucose

Glowing Glucose

Maybe you still remember the tattoo which helps to monitor a diabetic’s glucose level. A permanent solution. Now Japanese scientists from the University of Tokyo created a new way …

Visual of Information Decoration Scarf

Information Decoration Scarf

Remember the Information Decoration essay which argued our so-called information society barely employs our human bandwidth, as most of the data in our lives is presented in …

Visual of Is that a hamster in your pocket or are you just pleased to see me?

Is that a hamster in your pocket or are you just pleased to see me?

Mobile phones may be the most affective technology we own but researchers at the Design Research Lab in Berlin have taken this notion to its most outlandish limit. Their cellular …

Visual of Manko & Dinner [#7]

Manko & Dinner [#7]

Manko blinked. Then blinked again, and again and again. While he did, he went through various layers at once and he was dazzled and amazed, his jaw dropped at all that he saw. He …

Visual of Manko & The Children [#9]

Manko & The Children [#9]

As they went down the elevator shaft, going deeper underground, neither Nada nor Manko spoke a word. To Manko it seemed to take forever. In his mind, he went over the long …

Visual of Meet the New Meat

Meet the New Meat

What do you think of lab-grown meat? "Yuck" might be your first reaction. One day, however, it could become the environmentally friendly alternative for breeding cows and pigs for …

Visual of Mushrooms in the Mokum

Mushrooms in the Mokum

Mediamatic  is hosting a pop-up urban mushroom farm in the middle of Amsterdam. Rows and rows of shiitake, oyster, and the elusive almond-flavored  Agaricus subrufescens are …

Visual of My Fetal Pony:  Neoteny in Girls' Toys

My Fetal Pony: Neoteny in Girls' Toys

It's no secret that Mickey Mouse has evolved in response to consumer pressures. Once a violent river-rat, he became the boy scout of rodents with good looks to match. Steven Jay …

Visual of Parks & Planes

Parks & Planes

Along with a library and museum, Amsterdam's Schiphol Airport recently added a park to its list of attractions. Officially opened by Princess Irene, the first Airport Park in the …

Visual of Peelable Ice Cream

Peelable Ice Cream

Filed under Biomimicmarketing . Pleases your inner monkey. Peelable banana ice cream by Nesle . Thanks Jurrian.

Visual of People are better at growing Limbs than Lizards

People are better at growing Limbs than Lizards

Whereas lizards have the extraordinary ability to regenerate lost limbs – meaning that if the lizard loses a limb through conflict with a predator, it will grow back – people have …

Visual of Phone Camouflage

Phone Camouflage

In twenty years , the mobile phone has become man's closest utensil. Can you imagine living without this umbilical box? Too bad it's often still a box that we hold to our ears... …

Visual of Plastic Planet

Plastic Planet

We tend to think of plastic as a cheap, inferior and ugly material used to make children’s toys, garden furniture and throwaway bottles. But as an experiment, imagine for a moment …

Visual of Remediation

Remediation

This disposable aluminum barbecue on top of an original Weber barbecue nicely illustrates how people – time after time – employ technology to make life more convenient while …

Visual of Resizing Daddy

Resizing Daddy

A little girl gets angry at her father, and uses her index finger and thumb to make a pinching motion . No, she's not trying to hurt him. She's using iPad sign language to say, "I …

Visual of Shopping in 2015?

Shopping in 2015?

A panacea Yoghurt? Cures athlete’s foot, acne and dandruff! Triple irradiated Spinach? Three-week shelf life! Funa sushu? Asian carp fresh from Lake Superior! Minority Report …

Visual of Shrink

Shrink

You are what you eat, taken seriously. Shrink is a work by the artist Lawrence Malstaf . Visitors place themselves between two large, transparent plastic sheets. The air gets …

Visual of Skyscrapers for Pandora

Skyscrapers for Pandora

We've previously featured architecture that imitates nature by opening its walls like a flower , or drifting like a cloud . However, maybe this is not imitation enough. The next …

Visual of Snapshots from the Next Nature Lab

Snapshots from the Next Nature Lab

Last week, the young and talented designers of the Next Nature lab at the Eindhoven University of Technology presented their end of term works in an internal exhibition. There are …

Visual of Soundmixtree

Soundmixtree

Diego Stocco is sound designer and composer from Burbank CA/US. He plays a tree as a rhythmic musical instrument, recording its sounds using a custom stethoscope. I suggest him to …

Visual of Spidergoats & Superskin

Spidergoats & Superskin

While some of us might have heard of the humorous but fictional ' spider pig ,' spidergoats are the real deal. Although you might expect to see them lounging in giant webs or …

Visual of Steve Jobs 1955 -2011

Steve Jobs 1955 -2011

Steve Jobs , former Apple CEO, passed away on Wednesday October 5th after a long battle with pancreatic cancer. Technology conceived from his vision has changed the world …

Visual of Sympathy for the Device

Sympathy for the Device

Tweenbots are small robots that depend on the kindness of strangers. They are only able to move straight forward and do this constantly. Once they get stuck in a hole or at a …

Visual of System Animals

System Animals

What animal is so naive to come into this world as a naked and crying infant, completely vulnerable, helpless, and an easy prey for any predator? Newborn lamb or giraffe’s babies …

Visual of Tattoo 2.0

Tattoo 2.0

As a child you probably had one of those temporary tattoos that come packed with over-sweetened chewing gum. It was a nice decoration, and a way to stand out. Recently researchers …

Visual of The Afterlife of PIG 05049

The Afterlife of PIG 05049

Christien Meindertsma spent three years tracking down every product made from a single pig. Pork made a showing, but the more strange goods were "ammunition, medicine, photo …

Visual of The Nauga's Hyde

The Nauga's Hyde

Sometimes new technology has to bio-mimic old nature to be accepted. In the late 1960s and early 70s, Uniroyal Engineered Products invented the 'nauga' a beast that gives its name …

Visual of The Neighborhood's DNA

The Neighborhood's DNA

I've noticed DNA spray notices springing up around Amsterdam.  I assumed it was a fairly standard anti-theft device:  A crime is committed, a little nozzle is activated by the …

Visual of The Search for the

The Search for the "Real" Thanksgiving

Thanksgiving is fake-for-real. While it's true that there was a minor harvest feast in 1621, held by English immigrants and Wampanoag Indians, the event was never celebrated …

Visual of The Sound of the Blue Canary

The Sound of the Blue Canary

Blue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …

Visual of Vertical Farming

Vertical Farming

Columbia professor Dickson Despommier imagines filling New Yorks skyscrapers with farms. As over 50% of the world population now lives in urban areas, this scenario could solve …

Visual of Think Breast is Best?  Try Udder

Think Breast is Best? Try Udder

Scientists in China have created transgenic cows that produce 'human' milk.  The researchers boosted the fat content of the milk and added three types of proteins, unique to …

Visual of Transgenic Jell-O, more human than ever!

Transgenic Jell-O, more human than ever!

The American Chemical Society has announced a new method of producing gelatin that sounds like good news for cannibals and the canni-curious. Researchers are able to create …

Visual of Trips to the Moon

Trips to the Moon

When watching a science fiction flick, it can be hard to determine what time in the future it is set, although this is a usually an integral part of the movie. However, it is …

Visual of Typically Dubai

Typically Dubai

Presumably the only place on Earth where burkas & protein supplements coincide in jolly harmony. Peculiar image of the week. Photo by me .

Visual of Typing Out Evolution

Typing Out Evolution

From the exhibit "What Machines Dream Of" in Berlin comes Life Writer , a work by Christa Sommerer and Laurent Mignonneau. As the participant types, letters are projected on a …

Visual of Using Pigeons as Protestors

Using Pigeons as Protestors

Artist Jaroslav Kyša has invented a novel form of social protest . By scattering seed in front of targets in London, he can attract droves of pigeons that disrupt shoppers and …

Visual of Visualizing Wifi Landscapes

Visualizing Wifi Landscapes

This project explores the invisible terrain of WiFi networks in urban spaces by light painting signal strength in long-exposure photographs. A four-metre long measuring rod with …

Visual of Want Ketchup with those Flies?

Want Ketchup with those Flies?

Industrial-scale in vitro meat may be a long way off, but for meat-lovers looking for a cheap, eco-friendly source of protein, there's no need to wait. We just have to swear off …

Visual of Windmill Trees

Windmill Trees

A new Dutch landscape with windmills up to 120 meters. Designed by NL Architects .

Visual of A Space-Faring Backup for Earth's Biota

A Space-Faring Backup for Earth's Biota

Elon Musk, the chief executive of spacecraft company SpaceX, believes we need to reinvigorate popular interest in space colonization, not just to boldly go where no man has gone …

Visual of Algae in the Supermarket

Algae in the Supermarket

As mentioned  earlier , the world seems obsessed with algae. Not limited to producing light or energy , algae has also found its way to our plate as a new vegetable, and maybe …

Visual of Antifreeze from Fish Blood Keeps Low-Fat Ice Cream Rich and Creamy

Antifreeze from Fish Blood Keeps Low-Fat Ice Cream Rich and Creamy

Fat is what makes ice cream taste rich and creamy. It's called ice cream, after all, not ice skim milk. So how have some manufacturers managed to make reduced fat ice cream that …

Visual of As Corn Withers in the Drought, Farmers Fatten Their Cows on Candy

As Corn Withers in the Drought, Farmers Fatten Their Cows on Candy

Farmers have long made frugal use of their table scraps, feeding their leftovers to hogs, dogs and now, cows. In a bizarre sign of our cash-strapped and climate-changing …

Visual of Bacteria Inspire Magnetic Hard Drive

Bacteria Inspire Magnetic Hard Drive

Certain types of bacteria can navigate using magnetic nanoparticles as tiny compasses. Researchers at the University of Leeds have extracted the protein that controls this process …

Visual of Book as Human-Computer Interface

Book as Human-Computer Interface

In combining the classic feeling of handling a book with the interactivity of the computer, Waldek W?grzyn of the Academy of Fine Arts in Katowice, Poland, has created a new human-computer interface.

Visual of Bunny Doesn't Grow on Trees

Bunny Doesn't Grow on Trees

Having trouble getting the kids to eat their fruits and vegetables? Try turning their 5-a-day into a trendy, collectible toy. We've seen Buddha fruit  and square watermelons …

Visual of Map of Emerging Technologies

Map of Emerging Technologies

This nice interactive map makes it clear what’s awaiting us in the near future. Presumably.

Visual of Complete Computer Simulation of a Bacterium Holds Hope for Medicine

Complete Computer Simulation of a Bacterium Holds Hope for Medicine

Researchers at Stanford and the J. Craig Venter Institute  recently created the first complete computer model of an organism. The simulation models the genome and life processes …

Visual of Complexity and Evolving Synthetic Soil

Complexity and Evolving Synthetic Soil

Twenty-first century society draws from a world that is less determined by objects and increasingly shaped by connectivity. The clear either/or distinctions that formerly informed …

Visual of Corpus 2.1

Corpus 2.1

Could you imagine yourself having QR-code freckles, or a chlorophyl skin? Dutch artist Marcia Nolte visualises these kind of speculative scenarios in a very non-spectacular yet …

Visual of Creating the World's Cutest Fruit

Creating the World's Cutest Fruit

Just like corn, bananas , and essentially any other plant we cultivate, the Cutie mandarin is the result of a concerted effort to produce an ideal food. Mandarin oranges come from …

Visual of Don't turn that page, it's patented

Don't turn that page, it's patented

Apple's recent work on iOS has been using as much references to "natural" elements as possible, making the digital as physical as possible. Doing how they do, they have been …

Visual of Dumpster Fish the Future of Farming

Dumpster Fish the Future of Farming

Cities have seen guerilla gardens, rooftop honey production, and fire escape chicken coops. Now, urban farmers may be adding aquaculture to the mix. Headed by ex-banker …

Visual of Dyeing Salmon Pink for Farms and Profit

Dyeing Salmon Pink for Farms and Profit

Wild salmon gets its robust pink color from a diet rich in red-hued krill. Farmed salmon are fed on fish meal, chicken byproducts, soybeans, wheat and a long list of other …

Visual of Eating In-Vitro: Kitchen Meat Incubator

Eating In-Vitro: Kitchen Meat Incubator

The Kitchen Meat Incubator does for home cooking what the electronic synthesizer did for the home musician. It provides its users with a set of pre-programmed samples that can be …

Visual of Eating In-Vitro: Knitted Meat

Eating In-Vitro: Knitted Meat

Rather than growing whole steaks in bio-reactors, Knitted Meat assumes that it is more feasible to create thin threads of protein. Supermarkets sell balls of meat fiber seasoned …

Visual of Eating in Vitro: Magic Meatballs

Eating in Vitro: Magic Meatballs

Magic Meatballs are designed to playfully familiarize children with lab-grown meat.

Visual of Eating In-Vitro: Rustic In Vitro

Eating In-Vitro: Rustic In Vitro

Many people still find in vitro meat too alien and artificial to put it in their mouths. With the Rustic In Vitro incubator, this outdated perception is about to change. Similar …

Visual of Edible Deodorant Candy

Edible Deodorant Candy

Remember Lucy McRay's swallowable perfume ? Well, now you can buy it. Annu Alpi has developed a piece of deodorant candy which presumable makes women smell like roses for up to …

Visual of Enjoy Udder Milk

Enjoy Udder Milk

Imaginary infomercial on the hypernatural udder cows, optimized for milk production

Visual of Enter the self-driving car

Enter the self-driving car

This promo video for the Google autonomous car is pretty exciting. I'm sure in a decade driving our own car will seem so old-fashioned,thinking how we ever trusted the physical …

Visual of Gordan Savicic - Facebook Suicide

Gordan Savicic - Facebook Suicide

Slowly but steadily the digital environment is becoming the primary living space where we interact and define ourselves. According to Gordan Savicic however, some things are still …

Visual of Fake Leaf is Twice as Efficient as the Real Thing

Fake Leaf is Twice as Efficient as the Real Thing

Improving on photosynthesis has long been a dream for scientists. The so-called artificial leaf – which wouldn't necessarily look like one – would run on only solar energy and …

Visual of Photoshop Your Way to Beauty

Photoshop Your Way to Beauty

Filmmaker Jesse Rosten shows his critical views on body standards by presenting the exclusive beauty breakthrough Fotoshop by Adobé. This revolutionary product features pro-pixel …

Visual of Free Range Robot Filters Out the Ocean's Plastic

Free Range Robot Filters Out the Ocean's Plastic

Whale sharks are great at filtering; plastic needs to be filtered. For now, however, whale sharks only have an appetite for plankton. Industrial designer Elie Ahovi has jumped …

Visual of Frying Nemo

Frying Nemo

Image consumption in the overdrive. Peculiar image of the week. Created by Erin Murphy, Victoria Bellavia, Yong Jun Lee & Sanggun Park . Thanks Jeroen van der Meij.

Visual of Genetic Screening for Christmas Trees

Genetic Screening for Christmas Trees

If you've turned to plastic Christmas trees because the real ones leave piles of needles behind, science is working to bring live conifers back into your holidays. A $1.3 million …

Visual of Glass Gem Corn Looks Like Jewelry

Glass Gem Corn Looks Like Jewelry

Most corn has been selectively bred over the centuries to be a single color: yellow, white or blue. Glass gem corn, a varietal grown by Greg Schoen , harkens back to the days when …

Visual of Growing Fruit into Its Own

Growing Fruit into Its Own "Juice Box"

Brazilian ad agency  AGE Isobar  spent two years experimenting in order to grow fruits into the shape of Camp's juice boxes. Immature limes, guavas and passionfruit were packed …

Visual of Growing Plants in the Dark

Growing Plants in the Dark

While sunlight contains all colors, the dominant type of chlorophyll in plants only needs purple light to function. This simple fact has big implications for the future of …

Visual of Helmet Crafted from Wood and Cork is just as Safe as Your Plastic and Foam One

Helmet Crafted from Wood and Cork is just as Safe as Your Plastic and Foam One

Back to the natural future? A startup company in Oregon is manufacturing bike helmets made of wood and cork that should meet or surpass the impact performance of plastic and foam …

Visual of Herons Eat at the Local Snack Bar

Herons Eat at the Local Snack Bar

Originally herons are migratory birds, in the winter they leave to warmer habitats. In the city there is enough food to survive the winter. Some herons are even too lazy to find their own food and try to collect it from the local snack bar.

Visual of Humans Caused Mass Extinctions Before There Were Even Humans

Humans Caused Mass Extinctions Before There Were Even Humans

Humans and other hominids have a reputation for bringing about mass extinctions. Homo erectus  has been blamed for the disappearance of many African carnivores, our ancestors …

Visual of Hybrid Meat

Hybrid Meat

On society's search to becoming a meatless one, several new kinds of 'meat' pop up in the food industry. From so called 'hybrid' meatballs, to 'the chicken that isn't', when will …

Visual of Implanted Magnets to Keep Your iPod Close

Implanted Magnets to Keep Your iPod Close

Body-mod enthusiast David Hurban has decided to make a lifelong commitment to his iPod Nano. By implanting magnets in his wrist, Hurban has created a permanent bracket to hold his …

Visual of Inside the Fastfood

Inside the Fastfood "Photokitchen"

Why does your food look different in advertising than it does in the store? A Canadian McDonald's marketing manager tries to answer this common question with a behind-the-scenes …

Visual of Eating In-Vitro: Instant Meat Powder

Eating In-Vitro: Instant Meat Powder

The number one argument for eating meat: it provides nutritious proteins that cannot be entirely supplied by vegetarian alternatives. Like it or not, humans are omnivores. Meat is …

Visual of Latro Algae Lamp

Latro Algae Lamp

As advances in nanotechnology bring us increasingly energy efficient products, plant life such as algae could become attractive sources for tapping energy. The Latro lamp by …

Visual of Mainstream Perceptions on In Vitro Meat

Mainstream Perceptions on In Vitro Meat

Nothing wrong with a bit of juicy television on 'In Vitro' meat. We propose to lock this video in a time capsule so that our kids can watch it and be horrified in 30 years or so.

Visual of Making Deserts Flourish

Making Deserts Flourish

Using only plastic sheets and an irrigation-nutrient system, a Japanese researcher has found a way to change agriculture as we know it. Professor Yuichi Mori argues in his talk at …

Visual of Mark Post - Meet the New Meat

Mark Post - Meet the New Meat

According to professor Mark Post, lab-grown meat could become the environmentally friendly alternative for breeding cows and pigs for meat consumption. Watch his talk!

Visual of Meanwhile in the Next Nature Lab

Meanwhile in the Next Nature Lab

Last week, the young and talented designers of the Next Nature lab at the Eindhoven University of Technology presented their end of semester works in an internal exhibition. There …

Visual of Meat the Future

Meat the Future

This promotional video for in-vitro meat was brought to you by the bureau for in-vitro meat promotion students of the Beckmans College of Design .

Visual of Mice Reporting For Duty

Mice Reporting For Duty

Researchers have developed genetic manipulated mice, with extra smell receptors that make them highly sensitive to the smell of explosives. Scientists hope to use these mice in the future to discover land mines

Visual of NANO Supermarket - Introducing the Jury

NANO Supermarket - Introducing the Jury

Little over two weeks left to submit your speculative product idea for the Nano Supermarket . The jury that will select the finest submissions – to be exhibited in the Nano …

Visual of NANO Supermarket Unveils New Products

NANO Supermarket Unveils New Products

From sleek fashion to life-saving medicines. During the forthcoming Dutch Design Week , our lustrous NANO Supermarket debuts a new line of speculative nano products that might hit …

Visual of Natura Prossimo a Milano

Natura Prossimo a Milano

This week our NANO Supermarket will be visiting Milan as part of the Salone Internazionale del Mobile.

Visual of New Museum Preserves

New Museum Preserves "Extinct" Noises

Growing up, I had a cockatiel that could mimic the bleeping cacophony of a dial-up connection with dead accuracy. I never stopped to think that my bird (still alive) preserves a …

Visual of Organic Drink Dispenser

Organic Drink Dispenser

I didn't need to insert a coin before collecting my refreshment!

Visual of Playing With Pigs

Playing With Pigs

Besides children and pets , it turns out that pigs are also attracted to interactive interfaces. Pig Chase is a computer game in which pigs and people can play together. The aim …

Visual of Portable Data Silence

Portable Data Silence

Experience full data silence with the Faraday Bag. Made from electromagnetic shielding silver coated fabric, it prevents devices inside it from being contacted. Made by artist …

Visual of Put on your Pixelhead

Put on your Pixelhead

A while ago we wrote about the Pixelhead mask by artist Martin Backes . Now he informs us that the masks are for sale. Get one while they last!

Visual of Real Vanilla is Natural, but Natural Vanilla is Fake

Real Vanilla is Natural, but Natural Vanilla is Fake

What most gourmands would define as "real" and "natural" vanilla flavoring is simple: Vanilla beans steeped in alcohol. But vanillin, the chemical responsible for vanilla's taste …

Visual of Regrowing Bones with Silk

Regrowing Bones with Silk

Time to add another superpower to insect silk, which already includes  bulletproof skin  and  implantable microelectronics .  Recent research  indicates that silk may be an ideal …

Visual of Ronald van Tienhoven - Techno Animism

Ronald van Tienhoven - Techno Animism

Once upon a time animism ruled people's beliefs: both organisms and objects were imbued with a conscience. Artist Ronald van Tienhoven states that as technology closes the gap …

Visual of Should I be Afraid of...

Should I be Afraid of...

For doom-mongers delight, the Berlin-based design studio Bold Futures made a handy interactive graph of the fatal disasters that might snuff us.

Visual of Cake Made from Human Skin

Cake Made from Human Skin

Cake or death? Cake! The Slice cake is a (vegetarian) vision of the forms lab-grown meat may take in the future.

Visual of Slurpee Machines Add a New Flavor: Mashed Potato

Slurpee Machines Add a New Flavor: Mashed Potato

Convenience store chain 7/11 is serving up the latest in a line of futuristic near-foods: Instant mashed potatoes from a Slurpee-style spigot. The machine dispenses a stream of …

Visual of Spray On Liquid Glass

Spray On Liquid Glass

Now here is a product that should soon find its way into the NANO Supermarket soon. At least, if supermarkets are willing to put it on their shelves, as they currently make huge …

Visual of Structuring biomimicry, improving building's resiliency

Structuring biomimicry, improving building's resiliency

The same way Einstein assumes the speed of light to be a constant of reference for his Theory of Relativity, the philosophy of biomimicry assumes Nature as a constant of reference …

Visual of The Action Plant Runs Away from Your Touch

The Action Plant Runs Away from Your Touch

Plants have it tough. They're tasty, silent, and stuck to the spot. With  Jurema Action Plant, artist Ivan Henriques has given plants the mobility they deserve . Henriques' pieces …

Visual of The NBIC Convergence: When Machines and Matter ‘Have Sex’

The NBIC Convergence: When Machines and Matter ‘Have Sex’

The Singularity , as popularized by Ray Kurtzweil, refers to a near term, theoretical time when machine intelligence greatly surpasses our own. At this point we will experience a …

Visual of The

The "Plantascraper" Sprouts in Sweden

We're used to seeing proposals for high-tech vertical farms that never seem to translate to real life, but the city of Linköping in Sweden has finally taken these buildings out of …

Visual of The Relative Size of Old Nature

The Relative Size of Old Nature

Created by Cary Huang, this interactive scale of the universe shows the relative sizes of everything from quarks to the Hoover Dam. Be prepared for some cosmic gee-whiz moments …

Visual of Those Blueberries in Your Cereal, Muffins and Baking Mixes? All Fake.

Those Blueberries in Your Cereal, Muffins and Baking Mixes? All Fake.

What do blueberries have in common with sugar, corn cereal, modified food starch, partially hydrogenated vegetable oil, artificial flavor, cellulose gum, salt and and Blue …

Visual of Tiny Amounts of Alcohol Might Extend Life

Tiny Amounts of Alcohol Might Extend Life

A new study on the effects of cholesterol on the life span of Caenorhabditis elegans, a tiny worm often used in experimentation, resulted in some surprising finds. The life span …

Visual of Twitter Implant becomes a Reality

Twitter Implant becomes a Reality

You all probably know the ' Twitter implant ' from the Nano Supermarket . Scientist at the University of Princeton now created the first working prototype. The implant is actually …

Visual of Using Simple Scents to Trick Shoppers into Buying

Using Simple Scents to Trick Shoppers into Buying

Retailers have long known that certain smells get us into the buying mood – cinnamon or warm cookies around the holidays, for instance – even if we're shopping for completely …

Visual of What is Next Nature?

What is Next Nature?

At the Next Nature Power Show 2011 our master of ceremony, Koert van Mensvoort gave a mini lecture on our changing notion of Nature.

Visual of Where Have All the Cucumbers Gone?

Where Have All the Cucumbers Gone?

This stunning graphic, courtesy of Nature & More , shows the astonishing drop in food crop diversity from 1903 to 1983. Lettuces available from commercial seed houses now …

Visual of Why does a Salad Cost More Than a Big Mac?

Why does a Salad Cost More Than a Big Mac?

Remarkable infographic by pcrm.org . Via NY Times , via Consumerist.com .

Visual of 33% of All Seafood in the United States Is Fraudulently Labeled

33% of All Seafood in the United States Is Fraudulently Labeled

A new study from the marine conservation group Oceana reveals that a full one-third of seafood across the US is mislabeled. Not surprisingly, the most expensive fish is also the …

Visual of 3D Pizza Printer for Astronauts

3D Pizza Printer for Astronauts

Printable pizza. The next big food innovation after sliced bread.

Visual of 3D Print Your Body in Gummy Candy

3D Print Your Body in Gummy Candy

FabCafe in Tokyo offers a sweet new way to make self portraits.

Visual of 3D Printed Food, Meet Willy Wonka

3D Printed Food, Meet Willy Wonka

Exploring the possibilities of a new 3D food printer.

Visual of 3D-Printed Skin Cells as an Aesthetic Statement

3D-Printed Skin Cells as an Aesthetic Statement

An exploration of one way we might use 3D printed stem cells for body modification.

Visual of A Frankenstein-esque System

A Frankenstein-esque System

The boundary between humans and machines is slowly but steadily blurring. The Immortal is a machine which exists out of several life-support machines connected with wires and electric cords.

Visual of A More Interesting, More Depressing Theory of Easter Island's Downfall

A More Interesting, More Depressing Theory of Easter Island's Downfall

A new theory claims it wasn't human deforestation that caused the ecological collapse of Easter Island, but something smaller and squeakier.

Visual of Anthropo-scene #1: From Rocks to Thoughts

Anthropo-scene #1: From Rocks to Thoughts

How geology and humanity turn ancient algae into high-tech gadgets.

Visual of Anti-BP Diseased Dolphin Ride

Anti-BP Diseased Dolphin Ride

In what's probably the most fun form of environmental protest ever, Banksy has created a morose-looking dolphin ride to protest the BP oil spill. The ride is complete with fish …

Visual of Are We Seeing the Same Thing?

Are We Seeing the Same Thing?

A fundamental philosophical question, how do we know my blue isn't your yellow? The current human and "natural" understanding of color is fundamentally based on a …

Visual of Artist Creates Portraits of Strangers Using DNA in Discarded Hair

Artist Creates Portraits of Strangers Using DNA in Discarded Hair

Heather Dewey-Hagborg just needs a strand of your hair to know what you look like.

Visual of Bacterioptica

Bacterioptica

Living lamps like Latro Algea Lamp by Mike Thompson are nothing new. But design studio MADLAB has created Bacterioptica , a lamp that contains organisms and bacteria from the …

Visual of Microchips Learn to Repair Themselves

Microchips Learn to Repair Themselves

Taking a cue from the human brain, a new microchip can rewire itself after damage.

Visual of Bizarre Retro-Futuristic Visions of Meat

Bizarre Retro-Futuristic Visions of Meat

Illustrators from the 1800s to the 1950s offer strange prediction for the future of meat.

Visual of Can This Virtual World Save the Real One?

Can This Virtual World Save the Real One?

A Dutch artist designs a Utopian eco-socialist online society.

Visual of Cockroach Farms Do Big Business for Food and Pharmaceuticals

Cockroach Farms Do Big Business for Food and Pharmaceuticals

Big bugs make big bucks for Chinese farmers turning to roach ranching.

Visual of Dad Hires Virtual Hitman to Kill Son's Online Avatars

Dad Hires Virtual Hitman to Kill Son's Online Avatars

A 23-year-old in China was recently puzzled why his online avatars were being killed off at disproportionate rates. After asking around, the young man eventually discovered that …

Visual of Now Dads Can Experience Pregnancy Too

Now Dads Can Experience Pregnancy Too

A new device replicates the kicking and moving of a baby inside a mother's womb.

Visual of Did Forks Really Give Modern Humans an Overbite?

Did Forks Really Give Modern Humans an Overbite?

The food writer Bee Wilson, author of Consider the Fork , has put forth a surprising theory about forks and teeth that has received widespread online coverage. According to …

Visual of Diet-in-a-Pill Promises Weight Loss with Synthetic Genes

Diet-in-a-Pill Promises Weight Loss with Synthetic Genes

Fat rats with unrestricted access to high-calorie food still lose weight with the help of a genetic implant.

Visual of Eating In Vitro: Meat Paint

Eating In Vitro: Meat Paint

Paint with meat! is a product for children of 5-10 years old. It allows them to prepare a meat dish on their own and in a very creative, fun and safe way: by painting with meat!

Visual of

"Ento" Brand Normalizes Eating Insects

While Next Nature is hard at work normalizing the idea of eating lab-grown meat , a group of British design students are working to bring insect-eating into the mainstream. Though …

Visual of Food Familiarization #2: Celebrity Endorsement

Food Familiarization #2: Celebrity Endorsement

How "celebrity endorsements" transformed the potato from the devil's tuber into a global staple.

Visual of Food Familiarization #3: Mimicry

Food Familiarization #3: Mimicry

Beware the vegetarian sausage in the grass...

Visual of Free Electricity from the Technosphere

Free Electricity from the Technosphere

Scientists learn how to harvest electricity from radio waves.

Visual of Frisky Whisky: Radioactive Booze from the Atomic Age

Frisky Whisky: Radioactive Booze from the Atomic Age

The world's first – and hopefully last – whiskey aged with radioactivity.

Visual of From Fast Food Packaging to Flowerpot

From Fast Food Packaging to Flowerpot

Designer Michal Marko created a biodegradable food bowl. Can you imagine this bowl being used in fast-food restaurants?

Visual of Fuel Your Body With Algae Headgear

Fuel Your Body With Algae Headgear

Algae as the future alternative fuel for the human body.

Visual of Green Colors Make Food Seem Healthier

Green Colors Make Food Seem Healthier

Which candy bar you choose depends on the color of the packaging.

Visual of Grossed Out by Lab-Grown Meat? Here's 7 Reasons Why You Shouldn't Be

Grossed Out by Lab-Grown Meat? Here's 7 Reasons Why You Shouldn't Be

In vitro meat is creepy, unnatural and downright disgusting – and so is every other kind of food we eat.

Visual of Have We Passed

Have We Passed "Peak Automobile"?

You’ve heard about peak oil, but what about peak automobile?

Visual of How Food Scientists Engineer the

How Food Scientists Engineer the "Bliss Point" in Junk Food

Cheetos and other junk foods are more carefully engineered than the average bridge.

Visual of In-Vitro Meat Visions in The Guardian

In-Vitro Meat Visions in The Guardian

Last weekends edition of the Guardian featured some of the In-Vitro Meat Visions developed at Next Nature Lab.

Visual of Ingestible Microchips Monitor Medication

Ingestible Microchips Monitor Medication

Digestible Microchips are now approved by the US Food and Drug Administration.

Visual of Invasive Sushi from Invasive Species

Invasive Sushi from Invasive Species

Chef Bun Lai of Miya's Sushi in New Haven, Connecticut, has a cheeky solution to invasive species: he eats them. His menu regularly features lionfish and Asian shore crabs, …

Visual of iTypewriter

iTypewriter

Miss the soothing clacking of typewriter keys? Long for satisfying clang of a carriage return? Get iTypewriter for iPad.

Visual of Jellyfish Ice Cream Glows When Licked

Jellyfish Ice Cream Glows When Licked

$220 ice cream glows thanks to synthetic bioluminescent proteins derived from jellyfish.

Visual of Kid Convinces Mother to go Vegan

Kid Convinces Mother to go Vegan

While most children nowadays believe the woods smell of shampoo, there are still those critical young minds out there eager to question things.

Visual of La Surconsommation

La Surconsommation

For those who "eat meat, but don't like in-vitro meat, because it is so unnatural" . Please spend 5 min to watch this video and change your thinking. You were watching the …

Visual of Living Food

Living Food

Minsu Kim created a wonderful series of living dishes that wiggle and wave on your plate.

Visual of 3D Print Your Thoughts

3D Print Your Thoughts

How incredible would it be to imagine a thing and have it magically appear in concrete form? After food , organs  and virtuality , here comes the thought printer!  Thinkerthing , …

Visual of Manufacturing Imperfection in Processed Luncheon Meats

Manufacturing Imperfection in Processed Luncheon Meats

Food companies are hard at work inventing processes to make luncheon meat look "deli fresh".

Visual of Maya YogHurt: Fermented Drink Made with Human Lactic Acid

Maya YogHurt: Fermented Drink Made with Human Lactic Acid

Artist Maja Smrekar modified yeast with her own DNA to produce human lactic acid.

Visual of Moments in Meat History Part III- Preservation

Moments in Meat History Part III- Preservation

The oldest evidence of cold food storage dates back to 1700 BCE.

Visual of Moments in Meat History Part IV- Substitutes

Moments in Meat History Part IV- Substitutes

The story goes that in the 7th Century, Buddhist monks in China stumbled upon the product now known as "wheat gluten" while cooking. Noting that it looked, felt and tasted …

Visual of Moments in Meat History Part IX - In-Vitro Meat

Moments in Meat History Part IX - In-Vitro Meat

In 1995, the US FDA (Food and Drug Administration) approved the use of in-vitro techniques for commercial meat production, paving the way for lab-grown meat products to make their way to the market.

Visual of Moments in Meat History Part V- Industrialization of Farming

Moments in Meat History Part V- Industrialization of Farming

In 1876, the first cattle feedlot was established near Chicago.

Visual of Moments in Meat History Part VI - Meat the Future

Moments in Meat History Part VI - Meat the Future

By the turn of the century, some people began raising questions about our meat consumption habits.

Visual of Moments in Meat History Part VII - Factory Farming

Moments in Meat History Part VII - Factory Farming

In the 1950s, the transition towards what is now known as factory farming picked up speed with farmers.

Visual of Moments in Meat History Part VIII- Fast Food

Moments in Meat History Part VIII- Fast Food

The very first restaurant to typify the modern fast food genre was White Castle, who opened their first location in 1916 in Witchita, USA. Ironically, at the time fast food was …

Visual of NANO Supermarket nominated for Dutch Design Award

NANO Supermarket nominated for Dutch Design Award

Our traveling NANO Supermarket is nominated for a Dutch Design Award. Winners will be announced late October.

Visual of Nanoscale Bouquet of Flowers

Nanoscale Bouquet of Flowers

Roses are red, violets are blue. Nanoscale flowers are what some scientists grew.

Visual of

"News Machine" Illustrates the Effects of Media Distortion

The  News Machine  is a contraption that explains the news distortion that happens when a message is broadcast through different media. The starting point is a tweet sent from a …

Visual of Next Nature Interview on London Real

Next Nature Interview on London Real

London Real interviewed Koert Van Mensvoort on the concept of Next Nature and its implications on our planet.

Visual of Next Nature saves Old Nature

Next Nature saves Old Nature

Conservation workers ask synthetic biologists to help them save the world's endangered creatures and habitats.

Visual of Now Your Smartphone Can Smell Like Barbecue and Buttered Potatoes

Now Your Smartphone Can Smell Like Barbecue and Buttered Potatoes

An olfactory device for Smartphones that spreads the aroma of barbecue using an app.

Visual of Paint by Numbers, then Eat It

Paint by Numbers, then Eat It

An innovative workshop points out future directions for in-vitro meat products.

Visual of Purple GM Tomatoes Prevent Cancer

Purple GM Tomatoes Prevent Cancer

A new strain of purple GM tomatoes last longer on shelves and help out cancer-prone mice.

Visual of Rural India's Next Nature Testimonial

Rural India's Next Nature Testimonial

Video testimonial for our Next Nature appzine, all the way from India!

Visual of Scientists Implant False Memory in Mice

Scientists Implant False Memory in Mice

Manipulations of the mind that were once the terrain of futuristic fantasy are now one step closer to becoming reality. Scientists at the Massachusetts Institute of Technology   …

Visual of Sitting on Tofu

Sitting on Tofu

Italian Designer discovers new material. A ideal throne for a vegan king.

Visual of Sniffer - Meet the Google Nose

Sniffer - Meet the Google Nose

The Sniffer – aka Google Nose – visualizes odors using a smell sensor, which is as good as a dog’s nose, and a glass in front of your eyes.

Visual of Space Farming for Astronauts

Space Farming for Astronauts

Space Farming: NASA plans to grow a vegetable garden 230 miles above the Earth.

Visual of Swap Your Bones for an Improved, 3D-Printed Version

Swap Your Bones for an Improved, 3D-Printed Version

3D printed organs are on the way. Could they be designed to be aesthetically appealing?

Visual of The 10th Anniversary of the World's First Lab-Grown Steak

The 10th Anniversary of the World's First Lab-Grown Steak

Many people don't know that growing and cooking in vitro meat is a decade old.

Visual of The birth of the artificial womb

The birth of the artificial womb

Researchers in Tokyo have developed an artificial womb (for goats).

Visual of The First Recorded Attack on a Cyborg

The First Recorded Attack on a Cyborg

Looking back on the first recorded attack on a human cyborg.

Visual of The Pulsating Heart of Tokyo

The Pulsating Heart of Tokyo

An astounding tangle of multi-colored water flowing throughout 18 arteries represents what happens every day in the pulsating heart of Tokyo. This is how Takatsugu Kuriyama , from …

Visual of The Sci-Fi Prehistory of

The Sci-Fi Prehistory of "Victimless" Meat

A (very) short history of a century's worth of "disembodied" meat in fiction.

Visual of The Talking Window: a New Audio Medium

The Talking Window: a New Audio Medium

Advertisers have figured how how to induce auditory hallucinations into your morning commute.

Visual of The Woods Smell of Meat

The Woods Smell of Meat

Steak doesn't grow on trees. Except when it does.

Visual of This Color-Changing Glass Could Stop Date Rape

This Color-Changing Glass Could Stop Date Rape

Because date rape drugs are odorless, colorless and tasteless, victims don't normally realize they've been attacked until it's too late. In a clever, necessary bit of information …

Visual of 'Victimless Shelter' Grown from Pig Cells

'Victimless Shelter' Grown from Pig Cells

While Next Nature was busy dreaming up new in vitro meat (IVM) foods, the mad scientists of Terreform ONE in New York went ahead and designed an entire dwelling made of IVM pig cells.

Visual of We Are Not Alone Eating Fast Food

We Are Not Alone Eating Fast Food

Beekeepers in France have been puzzled by their bees producing blue and green honey. Turned out the bees were eating waste from an M&Ms factory.

Visual of Why Isn't Cream Cream-Colored?

Why Isn't Cream Cream-Colored?

Our language preserves evidence of a type of food that's all but extinct.

Visual of World's Worst Job? Being a Human Robot at Amazon's Fulfillment Center

World's Worst Job? Being a Human Robot at Amazon's Fulfillment Center

Workers are completely controlled by algorithms in Amazon's fulfillment center

Visual of A Net will Collect Debris from Outer Space

A Net will Collect Debris from Outer Space

JAXA developes a net that could collect debris from outer space.

Visual of Acoustic Instrument That Sounds Digital

Acoustic Instrument That Sounds Digital

Yaybahar is an acoustic instrument that emits sounds like a music synthesizer.

Visual of Ambulance Drone

Ambulance Drone

The ambulance drone: an autonomously navigating mini aeroplane that can quickly deliver a defibrillator.

Visual of Belief System Meets Operating System

Belief System Meets Operating System

The façade of an Indian temple constructed from a large-scale print of a Facebook Wall.

Visual of Biofabricate – NN Lecture in New York

Biofabricate – NN Lecture in New York

4th of December Dr Van Mensvoort lectures in New York at the BIOFABRICA summit. Other speakers include Paola Antonelli and Andras Forgac.

Visual of Breathing Lights

Breathing Lights

Inspired by the movement of spider webs in the wind, Dutch designer Jeroen Van Der Meij created Breathing Lights.

Visual of Bugs Developed Immunity to GMO Corn

Bugs Developed Immunity to GMO Corn

The Western Corn Rootworm has evolved to eat genetically engineered corn, designed to kill it.

Visual of Confused Wings Flapping in Electrosmog

Confused Wings Flapping in Electrosmog

Electromagnetic fields confuse European robins.

Visual of Design by Termite

Design by Termite

Why not outsource your laser engraving jobs to termites?

Visual of Drone Crash

Drone Crash

During a triathlon ace a drone operated by a local photographer hit one of the athletes.

Visual of E.T. Video Games are Real Modern Fossils

E.T. Video Games are Real Modern Fossils

An unsuccessful piece of video gaming history became an archeological record.

Visual of Food To Eat With Your Eyes

Food To Eat With Your Eyes

In Japan, fake food industry represents a century of old crafting tradition and a multi billion business.

Visual of Glow in the Dark Trees

Glow in the Dark Trees

Daan Roosegaarde is exploring possibilities to replace streetlights with luminous trees.

Visual of Graffiti Drones

Graffiti Drones

Last month graffiti artist Katsu presented his graffiti drone called the ‘’spray copter’’.

Visual of H / AlCuTaAu: a New Artificial Mineral

H / AlCuTaAu: a New Artificial Mineral

A new artificial mineral made of technological artifacts, such as computers, tools and machinery.

Visual of High-Tech Cemetery

High-Tech Cemetery

In the Ruriden cemetery, in Tokyo, over 2.000 Buddhas statues are illuminated by high-powered color changing LED lights.

Visual of In Memory of New Materials Gone

In Memory of New Materials Gone

A deceased scrollbar in a Church. What does it mean?

Visual of In Vitro Recipe #10: Home Incubator

In Vitro Recipe #10: Home Incubator

The home incubator does for cooking what the electronic synthesizer did for musicians.

Visual of In Vitro Recipe #11: Meat Fruit

In Vitro Recipe #11: Meat Fruit

Meat fruit combines the femininity of fruit with the masculine sensibilities of red meat in a hybrid celebration of our post-patriarchal, post-gender society.

Visual of In Vitro Recipe #12: Meat Flowers

In Vitro Recipe #12: Meat Flowers

If vegetarian products can mimic meat, then why not the other way around?

Visual of Invisible Girlfriend

Invisible Girlfriend

Virtual for Real relationship.

Visual of Lab-Grown Bread for Your In Vitro Burger

Lab-Grown Bread for Your In Vitro Burger

A novel process turns wood into tasty, edible starch

Visual of Living in the Forest in the 21st Century

Living in the Forest in the 21st Century

Portraits of people who live alone in the forest.

Visual of Living Portraits

Living Portraits

An alive portrait made of of microscopic algae.

Visual of Lonely Sculpture Your Next Tinder Match?

Lonely Sculpture Your Next Tinder Match?

Tinder users beware: somewhere out there a mechanical finger is surfing the popular dating smartphone app. This could be your next match.

Visual of Microwave VS Food Printer

Microwave VS Food Printer

3D food printer or microwave oven?

Visual of Nano Product: Bake 'n Spray

Nano Product: Bake 'n Spray

Bake 'n Spray: the oven in a can.

Visual of Nano Product: Catad'Or

Nano Product: Catad'Or

Catad'Or: the allergy sensitive cutlery.

Visual of Nano Product: CloudCrayons

Nano Product: CloudCrayons

CloudCrayons: cloud coloring rockets.

Visual of Nano Product: Google Nose

Nano Product: Google Nose

Wear the Google Nose and amplify your sense of smell!

Visual of Nano Product: The Healing Game

Nano Product: The Healing Game

The Healing Game: a playful medicine.

Visual of New Plant Paradigms

New Plant Paradigms

In this approaching era, what might be biologically possible for plants?

Visual of Our Tribal Gut Bacteria Are Disappearing (And Why We're Getting Fat)

Our Tribal Gut Bacteria Are Disappearing (And Why We're Getting Fat)

Healthy gut bacteria may hold the key to weight loss – but only isolated communities may preserve "natural" intestinal biomes.

Visual of OUT NOW: The In Vitro Meat Cookbook

OUT NOW: The In Vitro Meat Cookbook

On the 5th of August, one year after the lab grown hamburger, the In Vitro Meat Cookbook was launched.

Visual of Reinventing Nature with Synthetic Biology

Reinventing Nature with Synthetic Biology

Bioengineer Drew Endy shares his idea of biology as a precision manufacturer that could potentially transform civilization as we know it.

Visual of Retro-Futuristic Society of Simulations

Retro-Futuristic Society of Simulations

In 1930 Germans envisioned our Society of Simulations.

Visual of Share the Smell of Your Delicious Dish

Share the Smell of Your Delicious Dish

The oPhone and oSnap allow you to send pictures with aromatic vocabularies.

Visual of Shark Deterrent Wetsuits

Shark Deterrent Wetsuits

A new way to project yourself against sharks while enjoying your favorite watersport!

Visual of Technosphere Interference

Technosphere Interference

Does Technosphere stop humans from sexual replication?

Visual of The Bacterial Lamp

The Bacterial Lamp

Ambio: a lamp that lights up by activating the bacteria.

Visual of The Bottle of The Future is an Edible Blob

The Bottle of The Future is an Edible Blob

What if we could drink from a giant drop of water? The bottle of the future has the shape of a soft, hygienic, biodegradable and edible blob.

Visual of The Human Hamster Wheel Desk

The Human Hamster Wheel Desk

The Human Hamster Wheel Desk is the latest result of workspace evolution. Office work has domesticated us!

Visual of The Mood Ring of the 21th Century

The Mood Ring of the 21th Century

The Moodmetric ring measures the autonomous nervous system signals that can be used to understand emotional reactions and improve quality of life.

Visual of The Tribes We Lead

The Tribes We Lead

Seth Godin argues the Internet has ended mass marketing and that it brings us back to the tribe.

Visual of To Be Human Is To Be Transhuman

To Be Human Is To Be Transhuman

Buckle up for a new video from our favorite performance philosopher Jason Silva: To Be Human Is To Be Transhuman.

Visual of Traffic Ballet

Traffic Ballet

If only next nature would be this perfectly harmonic.

Visual of Using Tomato Skins to Make Car Parts

Using Tomato Skins to Make Car Parts

Heinz and Ford team up to use tomato skins in car parts.

Visual of Veggie Burger That Bleeds Like Real Meat

Veggie Burger That Bleeds Like Real Meat

Prof. Patrick Brown developed a meatless burger that look and taste like meat, made out of plant ingredients.

Visual of Virtual Reality Headset for Chickens

Virtual Reality Headset for Chickens

A virtual reality headset could give chickens the freedom to roam without the roaming.

Visual of What Will Life Be Like Inside A Computer?

What Will Life Be Like Inside A Computer?

Many scientists believe that we will soon be able to preserve our consciousness indefinitely. This could be done by copying and transferring these contents into a computer, or by piecemeal replacement with parts of the brain gradually replaced by hardware.

Visual of You Push the Button, It Does the Rest

You Push the Button, It Does the Rest

A button to simplify your internet affairs!

Visual of A Robot Scientist Could Cure Malaria

A Robot Scientist Could Cure Malaria

Although there seems to be no effective drug in use to cure malaria, a scientist robot named Eve may have found a cure.

Visual of A Self-Aware Mario Able to Learn and Feel

A Self-Aware Mario Able to Learn and Feel

Super Mario is now able to learn and feel in the confines of his 8-bit universe.

Visual of A Wind Turbine That Looks Like a Tree

A Wind Turbine That Looks Like a Tree

The wind turbines of the future will look like post-modern tree sculptures.

Visual of AI is as Intelligent as a Four-Year-Old Kid

AI is as Intelligent as a Four-Year-Old Kid

Computer can already beat us in many tasks. Complicated calculation, processing speed and chess, to name a few. However, generally speaking, you’re still likely to be more …

Visual of An Adblocker for Your Eyes

An Adblocker for Your Eyes

Most VR concepts and products are coming from big tech companies. With their ad-driven business models they are likely to fill your Glass, Hololens or Oculus with ads at some …

Visual of Analogue vs Digital: Basic Parts of Matter

Analogue vs Digital: Basic Parts of Matter

Do you think you are made from bits and bytes? Stop playing video games and spend some more time offline! Both atoms and bits are basic parts of matter.

Visual of Analogue vs Digital: Boomeranged Metaphors

Analogue vs Digital: Boomeranged Metaphors

Is it analog, or is it digital? It’s a boomeranged metaphor!

Visual of Analogue vs Digital Memory Game

Analogue vs Digital Memory Game

The Analogue vs Digital Memory Game explores the different ways of seeing, thinking and experiencing across the digital divide.

Visual of Art Experiment Allows to Kill with a Click

Art Experiment Allows to Kill with a Click

Florian Mehnert, A German artist, has launched an experiment that will give internet users the power to shoot a rat with a single click on their keyboard or smartphone. A …

Visual of Artificial Intelligence Able to Create Music

Artificial Intelligence Able to Create Music

Emily Howell is an interactive interface able to compose and perform her own pieces of music.

Visual of Could Biomimicry Help us Solve the Refugee Crisis?

Could Biomimicry Help us Solve the Refugee Crisis?

From nutrients within an organism, to organisms within collectives, to populations within a territory and so on - nature offers models on how to deal with highly complex systems.

Visual of Biomimicry in Action

Biomimicry in Action

An inspiring topic about recent developments in biomimicry, Janine Benyus gave a talk on how nature influenced our future.

Visual of Bistro In Vitro to Be Launched

Bistro In Vitro to Be Launched

Inspired by the award winning In Vitro Meat Cookbook , Next Nature Network and Submarine Channel present  Bistro In Vitro : an online design fiction documentary about the future …

Visual of Botox Makes it Harder to Feel Emotions

Botox Makes it Harder to Feel Emotions

Studies suggest that Botox impairs the ability to process the emotional content of language, limiting the quality of emotional experiences.

Visual of Do Kids Know Where Dinner Comes From?

Do Kids Know Where Dinner Comes From?

Swimming salmon fillets confuse educate children about where dinner comes from.

Visual of Cities Evolve in Similar Ways as Galaxies

Cities Evolve in Similar Ways as Galaxies

Scientists think the laws governing the structure of galaxies in outer space are the same laws underlying the growth of cities.

Visual of Controlling the Weather with Drones

Controlling the Weather with Drones

The Federal Aviation Administration (FAA) picked six test sites throughout the US to experiment with drone-based cloud seeding.

Visual of Did a Robot Grow your Vegetable?

Did a Robot Grow your Vegetable?

The world’s largest indoor farm  is not the only firm developing vertical agriculture. Japanese company  Spread plans to grow more than ten million heads of lettuce a year by …

Visual of Modernist Food

Modernist Food

This modernist food makes the future of 3D printed food look pretty tasty!

Visual of

"The End": a Virtual Opera Singer, Millions of Fans and the Meaning of Death

Sixteen-year-old Japanese singer Hatsune Miku grew in short time to a worldwide popstar. With her colourful appearance she counts millions of followers on social media, she …

Visual of Eventually, Drones Will Be Everywhere

Eventually, Drones Will Be Everywhere

City of Drones puts you in a first person view of a drone drifting through an abstract futuristic cityscape.

Visual of Everything Stew from the Home Incubator

Everything Stew from the Home Incubator

The home incubator you can prepare a stew made with thirteen different sorts of meat, is heaven for carnivores.

Visual of Experience Van Gogh in Virtual Reality

Experience Van Gogh in Virtual Reality

America artist Mac Cauley created a new way to experience the painting in virtual reality.

Visual of Experiencing Animal Vision Through Virtual Reality

Experiencing Animal Vision Through Virtual Reality

Eyes of the Animal is an interactive project that invites the public to an uncommon virtual reality setting conceived especially for experiences in actual forests, giving the opportunity to see the world as an insect would.

Visual of Fast Food = Lower Test Scores

Fast Food = Lower Test Scores

The amount of fast food children eat may be linked to how well they do in school, a study suggests.

Visual of First Entirely Transparent Solar Panel Could Transform our Cities

First Entirely Transparent Solar Panel Could Transform our Cities

Our constant need of new, cleaner energy led a Michigan State University research group to conceive a fully transparent solar panel that could replace ordinary windows.

Visual of From the Super Muscular Pig to the Hypoallergenic Cow: New GMOs May Soon Be on Your Plate

From the Super Muscular Pig to the Hypoallergenic Cow: New GMOs May Soon Be on Your Plate

The acronym that keeps Europe awake at night is TTIP (Transatlantic Trade and Investment Partnership), a trade and investment deal that the EU is negotiating with the US. From …

Visual of Grow your Dinner in a Kitchen Insect Farm

Grow your Dinner in a Kitchen Insect Farm

The Kitchen Insect Farm enables people to grow their own protein source (read: larvae) at home.

Visual of Happy Next Nature!

Happy Next Nature!

Time measurement tools are perhaps among the most inventive technologies mankind has produced, as it enables us to articulate ‘natural’ time (in the form of lunar years, sun …

Visual of This Headset Will Widen Your View of Reality

This Headset Will Widen Your View of Reality

This augmented reality helmet allows the wearers to see all around them without having to turn their head.

Visual of Hunger Games for Robots

Hunger Games for Robots

How would you feel if robots inherited ethical complications of existence?

Visual of In Vitro Meat Godfather Dies at Age of 91

In Vitro Meat Godfather Dies at Age of 91

Dutch researcher and entrepreneur, Willem van Eelen, has died in Amsterdam. For more than half a century, Van Eelen relentlessly researched and promoted In Vitro Meat.

Visual of Junk Food or Tobacco?

Junk Food or Tobacco?

An article about the future position of junk food.

Visual of Knotty Objects Summit @ MIT

Knotty Objects Summit @ MIT

The Knotty Object summit promises to be a paradise of anti-disciplinary delight. The event held at the renowned MIT Media Lab gathers designers, scientists, engineers and writers …

Visual of Forget Google Street View, Here's Cat Street View

Forget Google Street View, Here's Cat Street View

Japan city has launched an online street view map to introduce the view of the city by a cat's perspective.

Visual of New 3D Printer Can Save Hours of Time

New 3D Printer Can Save Hours of Time

A team of researchers recently developed a new method for 3D printing that can reduce the printing process down to minutes.

Visual of Next Nature at Futur en Seine Festival

Next Nature at Futur en Seine Festival

Next Nature at "Mindfulness and Digital Detox: How to Tune Out to Tune In" Conference in Paris.

Visual of Next Nature Book Second Edition

Next Nature Book Second Edition

After it sold out, the Next Nature book has been reprinted with a brand new cover.

Visual of Next Nature Talk at Nature 3.x Symposium

Next Nature Talk at Nature 3.x Symposium

Koert van Mensvoort will take part in the Nature 3.x: Where is Nature Now? symposium at the University of Minnesota.

Visual of Next Nature Talk at SXSW

Next Nature Talk at SXSW

Going to the lustrous SXSW festival in Texas this year? Don't miss out on the Next Nature presentation!

Visual of Listening to 3D Printed Records

Listening to 3D Printed Records

Let's enjoy some 3D-printed records!

Visual of Art Installation Submerges Amsterdam

Art Installation Submerges Amsterdam

Waterlicht shows how the Netherlands would look without waterworks — a virtual flood.

Visual of Robot Swans Monitor Water Quality

Robot Swans Monitor Water Quality

The National University of Singapore released a group of robot swans in the Pandan Reservoir to swim around and keep an eye on water quality.

Visual of Space Archeologist Unlocks Secrets of Ancient Civilizations

Space Archeologist Unlocks Secrets of Ancient Civilizations

Sarah Parcak is a pioneering "satellite archaeologist" from University of Alabama, a sort of Indiana Jones with 21st century tech. She has been awarded the 2016 TED Prize for her …

Visual of Seaweed That Tastes Like Bacon

Seaweed That Tastes Like Bacon

A new seaweed that tastes like bacon and is better for you than kale.

Visual of Seconds for Sale: Domestication of Time

Seconds for Sale: Domestication of Time

Time Ingot is a solid piece of lead alloy, its mass can slow down time in the immediate vicinity.

Visual of Seeing the Sun Through Data

Seeing the Sun Through Data

The Smithsonian’s National Air and Space museum has taken the sun observation to the next level with a giant public display of images and data that show the sun in hyper-real detail.

Visual of Self-Healing Concrete

Self-Healing Concrete

A microbiologist has developed a way to make the cracks in concrete structures heal themselves.

Visual of Solar Tree That Provides Electricity

Solar Tree That Provides Electricity

A tree, made with 3D printed leaves that contain solar cells.

Visual of St. Pauli's Walls Pee Back On You

St. Pauli's Walls Pee Back On You

Tired of drunk people peeing everywhere on the street, people of St. Pauli, Hamburg decided to take a smart step to prevent it.

Visual of Teppanyaki from the In Vitro Aquarium

Teppanyaki from the In Vitro Aquarium

These synthetic organisms from our In Vitro Aquarium are a hybrid between plants and animals. Would you eat them?

Visual of The art of growing grasshoppers

The art of growing grasshoppers

Grasshoppers are a sustainable and cost-effective alternative to meat protein. Could the ability to grow them in your kitchen make them more appealing? Watch the video below and …

Visual of The Face of Litter

The Face of Litter

Hong Kong is using DNA analysis to publicly shame litterbugs

Visual of The Phone That's Just a Phone

The Phone That's Just a Phone

Meet the anti-smartphone. It literally does nothing but make and answer calls.

Visual of The Sound System that Knows your Mood

The Sound System that Knows your Mood

BeoSound Moment is an intelligence sound system that predicts the music the user is in the mood for.

Visual of The World's First Virtual Reality Park

The World's First Virtual Reality Park

A virtual reality theme park where visitors can explore the virtual world in a physical environment.

Visual of The World’s Largest Indoor Farm

The World’s Largest Indoor Farm

The world’s largest indoor farm in Japan is 100 times more productive than traditional agriculture.

Visual of Talkable Vegetables

Talkable Vegetables

Breaking the silence, vegetables in a Japanese supermarket start to talk to the customers.

Visual of Virtual Reality Dining Experience

Virtual Reality Dining Experience

Using immersive virtual reality and aromatics to make the brain believe we are enjoying a delicious dish.

Visual of When Was the Last Time you Were Bored?

When Was the Last Time you Were Bored?

The Bored and Brilliant project asks people to measure their smartphone use take some conscious steps to limit the digital interactions.

Visual of Adblock Plus Now Sells Acceptable Ads

Adblock Plus Now Sells Acceptable Ads

Adblock Plus, world’s most popular ad-blocking tool, just announced they are launching an advertising service for “acceptable” ads.

Visual of Agriculture Isn’t as Green as You Think

Agriculture Isn’t as Green as You Think

Agriculture today isn’t where it needs to be. Here’s how farmers are taking the next step for better agriculture tomorrow

Visual of Architecture on Mars

Architecture on Mars

The future anticipates 3D printed homes on Mars.

Visual of Bringing Augmented Reality to Fitness

Bringing Augmented Reality to Fitness

Fitbit just released a new motivational feature that aims to trigger their users to go out and exercise more.

Visual of Australia Moves Too Fast for GPS

Australia Moves Too Fast for GPS

The entire continent of Australia has shifted and that's a problem for GPS, meteorologists, automated cars and even drones.

Visual of The Biggest Impact on the Planet Comes from Household Consumption

The Biggest Impact on the Planet Comes from Household Consumption

New study suggests that the real environmental problem is embodied in the things we buy.

Visual of Bringing the Camera Back to Our Eyes

Bringing the Camera Back to Our Eyes

The new Spectacles by Snap Inc. allow you to actually "make memories" (as their slogan claims) while capturing them.

Visual of Bringing In Vitro Meat to the Market

Bringing In Vitro Meat to the Market

Mark Post is planning to bring lab-grown meat on the market shelves within five years at a reasonable price.

Visual of Cockroach Milk: the Next Superfood?

Cockroach Milk: the Next Superfood?

A recent research reveals that the next extra nutritious ingredient may be the liquid produced by cockrach mothers to feed their offsprings. Are you willing to try it?

Visual of The Death of the Traffic Light

The Death of the Traffic Light

MIT researchers have developed a system of traffic control that will make traffic lights obsolete.

Visual of Dessert Goals: Bistro In Vitro Ice Cream

Dessert Goals: Bistro In Vitro Ice Cream

In the upcoming episode of Dutch youth education series Denktank (translated think tank) philosopher Stine Jensen and eight teenagers will explore the future of food and try our Bistro In Vitro ice cream.

Visual of Disney Lights Up the Sky with 300 Drones

Disney Lights Up the Sky with 300 Drones

Disney’s latest attraction? 300 drones flying in formation.

Visual of Edible Crops Grown in Martian Soil

Edible Crops Grown in Martian Soil

Scientists at Wageningen University, The Netherlands, grew edible crops in Martian soil.

Visual of Empowered by Robots Event Report

Empowered by Robots Event Report

A report on the Empowered by Robots conference during DDW16, demonstrating fruitful collaboration between humans and robots.

Visual of Father Hires Gamers to Virtually Kill His Son

Father Hires Gamers to Virtually Kill His Son

This father in China hired some professional gamers to find his son on online games and kill his avatar.

Visual of When FB Told Everyone They Were Dead

When FB Told Everyone They Were Dead

Due to an algorithmic error, Facebook mistakenly "memorialized" vital user accounts with a banner announcing the user’s passing – turning their friend walls into memorial walls.

Visual of The First Artificial Intelligent Lawyer

The First Artificial Intelligent Lawyer

There is an artificial intelligent robot called ROSS that is taking over the work of thousands of lawyers. Working non-stop, reading faster then any human attorney can do.

Visual of The First Fully Autonomous Soft Robot

The First Fully Autonomous Soft Robot

The Octobot is the first of its kind made fully of soft materials and is aimed to pave the way towards a more safely interaction with humans.

Visual of The First Drone Superhighway

The First Drone Superhighway

Urban planners proposed a utopian superhighway for the up-and-coming organic smart city Bao’an.

Visual of Fitness Trackers Help Improve Cycle Paths

Fitness Trackers Help Improve Cycle Paths

Tracking your workout can help improve the safety and optimize routes for cyclists and pedestrians in your town.

Visual of Lost in the Forest? The Drones Will Find You

Lost in the Forest? The Drones Will Find You

Researchers are teaching drones to recognize and follow forest trails.

Visual of Future of Food: Eating From the Ditch

Future of Food: Eating From the Ditch

For years scientist and farmers are researching the possibilities of eating duckweed, shoveling it out of the ditches onto our plates. This proteinrich plants can be used in animal fodders or be eaten by humans.

Visual of Genetic Scissors Instead of Chef's Knife

Genetic Scissors Instead of Chef's Knife

CRISPRy cabbage has been served for the first time in the world.

Visual of Google Sheep View

Google Sheep View

The Faroe Islands invented Google Sheep View 360.

Visual of Growing Potatoes at JFK Airport

Growing Potatoes at JFK Airport

The 5th largest airline in the United States, JetBlue, is growing potatoes at John F. Kennedy Airport in New York.

Visual of In Defense of the Eggplant

In Defense of the Eggplant

The eggplant emoji became a political weapon and gain cult status being the forbidden fruit of the web.

Visual of Robot Babies to Prevent Pregnancy

Robot Babies to Prevent Pregnancy

An Australian study has shown the use of lifelike robot babies increased teen pregnancy, rather than discouraging it.

Visual of Designer Dave Hakkens is putting plastic waste to better use

Designer Dave Hakkens is putting plastic waste to better use

We recently handed this year’s ECO Coin Award to Dutch designer Dave Hakkens, founder of the Precious Plastic movement. With his open sourced recycling machines, he provides people around the world the knowledge to start recycling plastic locally.

Visual of King Bee Inspecting His Drones?

King Bee Inspecting His Drones?

Facebook boss Mark Zuckerberg at the Mobile World Congress, in Barcelona.

Visual of The Largest Solar Power Plant in the World

The Largest Solar Power Plant in the World

A floating photovoltaic system will lie on the waters of a Japanese dam, representing the largest solar establishment in the world.

Visual of Look for The Bistro In Vitro Ice Cream Cart

Look for The Bistro In Vitro Ice Cream Cart

Our Bistro in Vitro Ice Cream Cart took off for the Spring/Summer season in Vondelpark, Amsterdam.

Visual of Lunar Insurrection Vol.2: Harvest Moon

Lunar Insurrection Vol.2: Harvest Moon

Lunar Insurrection  is a group of architects that explores the creative possibilities of the moon as a potential territory for human activity and inhabitation. In  Vol.2 , their …

Visual of A Map of Mars for Regular Humans

A Map of Mars for Regular Humans

If we'll ever get to go to Mars as tourists , we wouldn't get lost. Ordnance Survey , the official British mapping agency, recently released a new detailed map of the Red Planet. …

Visual of Explore Mars with NASA's VR Experience

Explore Mars with NASA's VR Experience

Exploring the surface of Mars at least 15 years before a human being in flesh and blood will be able to, this is the new ambitious idea of the people at NASA.

Visual of Meat Lovers Megasteak Delight

Meat Lovers Megasteak Delight

Grown in a laboratory in Wageningen and it is vegetarian too.

Visual of Meet Biomimic Alyssa Stark

Meet Biomimic Alyssa Stark

Using biology as a model for innovation and progress, Alyssa Stark embodies the essence of Biomimicry.

Visual of Meet the Firefighter Drone

Meet the Firefighter Drone

Meet the firefighter drone, she is the best at extinguishing fires and keep every species safe!

Visual of More Babies for Italy

More Babies for Italy

The Italian government just launched a campaign to raise awareness for falling birthrates and encourage family planning.

Visual of Moscow Spent $1.3M for a Day of Sunshine

Moscow Spent $1.3M for a Day of Sunshine

$1.3 million will be spent on dispersing clouds over Moscow for the May 1 holiday.

Visual of Nature-Inspired Nano-Robots

Nature-Inspired Nano-Robots

Researchers developed tiny, autonomous robots able to repair circuits.

Visual of NANO Supermarket in Brussels

NANO Supermarket in Brussels

Come and check out the NANO Supermarket at SAS Software's Forum BeLux 2016 on October 13 in The Egg Brussels!

Visual of The New Cinema Is Smartphone-Friendly

The New Cinema Is Smartphone-Friendly

Cinemas for Millennials will include special sections where texting is allowed.

Visual of Next Nature Gift Guide 2016

Next Nature Gift Guide 2016

Here is a the Next Nature gift Guide 2016.

Visual of VR Days Europe: Next Nature Habitat

VR Days Europe: Next Nature Habitat

Next Nature Habitat premiered at VR Days Europe in Amsterdam last weekend.

Visual of What Is Next Nature? #2

What Is Next Nature? #2

Fruit flavored candy

Visual of What Is Next Nature? #14

What Is Next Nature? #14

Not knowing what hanging up the phone means.

Visual of Smart Spoon with Spilling Prevention

Smart Spoon with Spilling Prevention

People with parkinson or other diseases that cause tremors or uncontrable muscular movements, eating is a major challenge. Liftware launches two smart spoons which corrects the unexpected movements of its eaters.

Visual of Who Owns the Map?

Who Owns the Map?

In their pursuit of mapping the physical world online, mapping services simultaneously shape our understanding of it too.

Visual of Cutlery Set to Eat Bugs

Cutlery Set to Eat Bugs

Designer Wataru Kobayashi created a picnic cutlery set to promote eating insects.

Visual of Preventing Data Leaks with Smell

Preventing Data Leaks with Smell

The Smell of Data alerts Internet users in any case of data leakage and communicates digital hazards by means of smell.

Visual of New Diets for Cows Can Stop Gas Emissions

New Diets for Cows Can Stop Gas Emissions

Yearly 90 million metric tonnes of methane are burped and farted into the atmosphere by cattle with effects on climate change. Researchers are looking for ways to change the cow's diet, feeding it oregano, seaweed and super grass.

Visual of Rethinking 3D Printing for the Future

Rethinking 3D Printing for the Future

Additivism is a movement that calls for radical rethinking of new technologies, such as 3D printing, the plastification of the world and our human position within it.

Visual of This Robot Builds a House in Two Days

This Robot Builds a House in Two Days

A Bricklaying Robot builds low-cost houses in just two days.

Visual of This Robot will Grow Food in Your Backyard

This Robot will Grow Food in Your Backyard

FarmBot Genesis is humanity's first open-source CNC farming machine designed for at-home automated food production.

Visual of This Robotic Stingray is Alive

This Robotic Stingray is Alive

By way of reverse engineering and taking heart cells from a rat, researchers at Harvard University have designed a miniature robotic stingray that is alive.

Visual of Are Robots the Future of Tattoos?

Are Robots the Future of Tattoos?

An industrial robot just tattooed the first person ever in San Francisco.

Visual of Save The Humans @ The Hoxton Hotel

Save The Humans @ The Hoxton Hotel

Next Thursday, February 11, the Hoxton Hotel in Amsterdam dedicates an evening to our newest publication: 'Save the Humans!'

Visual of Shapeshifting Robotic Furniture

Shapeshifting Robotic Furniture

Robotic furniture for the young professional.

Visual of The Movie Written by Artificial Intelligence

The Movie Written by Artificial Intelligence

Sunspring is a Sci-Fi short movie entrirely written by an artificial intelligence.

Visual of Solar Energy Day and Night

Solar Energy Day and Night

Special balloons able to catch the rays of the sun from above the clouds, producing clean energy day and night thanks to the help of a fuel cell.

Visual of Solving Crimes Thanks to Amazon Echo

Solving Crimes Thanks to Amazon Echo

Amazon's Echo smart speaker may have witnessed a murder. But will it talk?

Visual of A Taste of RoboBee Honey

A Taste of RoboBee Honey

Where most researchers are focusing on keeping bees alive, researchers of Harvard are developing a bee replacement; the Robobee. The Robobee is only the size of half a paperclip, with ultra thin wings flapping 120 times per second. The main goal is to build a mechanic pollinator.

Visual of Your Teaching Assistant Is a Robot

Your Teaching Assistant Is a Robot

Jill Watson has been performing as teaching assistant for 5 months, but she is not a real person, and students didn't notice.

Visual of Turn Your Cursor into a Songbird

Turn Your Cursor into a Songbird

The Bird Sounds experiment, powered by Google Creative lab, is a visualization of thousands of bird songs organized by their similarities.

Visual of Turning Coke into Water

Turning Coke into Water

This art installation turning coke into water raise questions on what, at the end of the day, should be considered 'the real thing'.

Visual of Turning Leaves into Batteries

Turning Leaves into Batteries

Other than decompose and give nutrition to the soil, leaves can be used to store energy, becoming the raw material of batteries.

Visual of A Robotic Suit to Update Your Granny

A Robotic Suit to Update Your Granny

The elderly may toss their walkers for this robotic suit.

Visual of Using Solar Powered Drones as Satellites

Using Solar Powered Drones as Satellites

The experimental solar powered airplane Solar Impulse 2 succeeded its record-breaking journey over the Pacific. The Swiss team is now developing the next step of the project: solar drones.

Visual of Bringing The Web into Real Life

Bringing The Web into Real Life

Web 0.0 is sa project by street-artist Biancoshock where web apps are contextualized in real life.

Visual of What Is the Selfie Elbow?

What Is the Selfie Elbow?

The advent of digital communications media is bringing along some health conditions.

Visual of Fake Grass Covered Roofs to Produce Energy

Fake Grass Covered Roofs to Produce Energy

The concept of using our rooftops to produce green, renewable energy for our houses is already very common if we look at solar panels. Now an international team of scientists is …

Visual of World's First 3D Printed Building

World's First 3D Printed Building

The world's first 3D printed office building opens its doors in Dubai, paving the way for the building of the future.

Visual of 1537 - Homunculus: the Semi-Human

1537 - Homunculus: the Semi-Human

In 16th and 17th centuries, some medical theory believed that a miniature human body can be produced in a flask by an alchemist.

Visual of 1916 - Artificial Womb Appeared in Cinema

1916 - Artificial Womb Appeared in Cinema

In 1916 the artificial womb made its first appearance on the big screen in the movie "Homunculus" by Otto Rippert.

Visual of 1923 - Term 'Ectogenesis' Coined

1923 - Term 'Ectogenesis' Coined

The term "ecotogenesis" was first coined in 1923 in "Daedalus".

Visual of 2014 - Womb Transplant Baby Born

2014 - Womb Transplant Baby Born

A Swedish woman who had her uterus removed due to cancer in her twenties gave birth to her own child as the world's first person to undergo a uterus transplant. And the donor? Her own mother.

Visual of 2015: Artificial Placenta Approaches

2015: Artificial Placenta Approaches

In 2015, a group of scientists from the University of Michigan claimed to have made the world's first artificial placenta.

Visual of 3D Print Your Pizza in Six Minutes

3D Print Your Pizza in Six Minutes

Meet the commercial 3D pizza printer that takes your order via a smartphone app.

Visual of Air Purifying Billboards

Air Purifying Billboards

These blue eco-boards are turning California a bit greener.

Visual of One Day of Air Traffic

One Day of Air Traffic

Mike Kelly shows the entire day of traffic, in just one image.

Visual of Animal Free Cow Milk

Animal Free Cow Milk

A San Francisco-based start up discovered a way to "brew" milk that has zero hormones, antibiotics, steroid or lactose inside, and a longer shelf-life.

Visual of Animal Guided Mediation

Animal Guided Mediation

Animal Meditation uses meditation guiding sounds to to enable user to feel as if he is an animal.

Visual of Obsolete Presence

Obsolete Presence

Our peculiar object in these summer weeks is a sculpture by Aram Bartholl, made for the Odyssey expo in Arnsberg.

Visual of 400 BCE - Myth of Princes Grown in Jars

400 BCE - Myth of Princes Grown in Jars

In year 400BCE in ancient Indian Sanskrit epics, 100 princes were created from a jar of ghee.

Visual of 1932 -

1932 - "Brave New World" Published

Aldous Huxley published Brave New World in 1932, bringing the idea of the artificial uterus to the big audience.

Visual of DNA Hacking: Catch a Computer Virus

DNA Hacking: Catch a Computer Virus

We know how it feels to catch a cold; how might it feel to catch malware?

Visual of Cognitive Cooking with Chef Watson

Cognitive Cooking with Chef Watson

The AI chef nows more than 10,000 recipes from all over the world and is capable of combining any ingredient while following your personal food preferences.

Visual of Dinner with Chef Watson

Dinner with Chef Watson

Chef Watson knows over 10.000 recipes. The highbrow robotic cook invited us over for dinner during the first Neo-Futurist Dinner at Mediamatic.

Visual of Digital Lemons to Make Virtual Lemonade

Digital Lemons to Make Virtual Lemonade

When life gives you digital lemons, make a virtual lemonade!

Visual of The Digital Mythology of... Super Mario

The Digital Mythology of... Super Mario

Mythology still surrounds us, we just relate to it differently. Games and movies have replaced pantheons and folk tales. Fairies and gnomes left the forests and the rivers and moved to virtual realities.

Visual of Drones and Robots Co-Work in Solar Farms

Drones and Robots Co-Work in Solar Farms

BladeRanger might have found the ultimate solution for solar panels cleaning putting drones and robots together at work.

Visual of ECO Coin Award 2017 Nominations Open

ECO Coin Award 2017 Nominations Open

The nominations for the ECO coin Award 2017 are now officially open. Let us know who you think deserves to earn the award.

Visual of ECO Coin at Welcome to the Village

ECO Coin at Welcome to the Village

On July 21, 22 and 23 you are invited to join us at Welcome to the Village festival in the Friesland province of The Netherlands for our next iteration of the ECO coin!

Visual of 1955 - Artificial Womb Drawing Patented

1955 - Artificial Womb Drawing Patented

In 1955 Emanuel M. Greenberg patented his Illustration of an artificial womb, his invention contains all the apparatus he thought would be required to grow a baby.

Visual of Energy Generated from Polluted Air

Energy Generated from Polluted Air

Scientists developed a device that converts polluted air into clean air while generating power.

Visual of A Fake City for Real Self-Driving Cars

A Fake City for Real Self-Driving Cars

Uber built a fake city called Almono to train self-driving cars. This town is full of fake houses, mannequins and chaotic intersections.

Visual of Farming in Silico

Farming in Silico

Farming is more than manual labor. The hard part is knowing how to get the best yield. Thankfully, there’s an app for that: growing crops in silico.

Visual of Sustainable Flying with Electric Planes

Sustainable Flying with Electric Planes

German company revealed fastest electric plane.

Visual of Floating Green Power

Floating Green Power

Offshore renewable energy resources, such as floating solar arrays, have begun to pop up around the world.

Visual of The Ephemeral Future of Internet Data

The Ephemeral Future of Internet Data

What the Internet would look like if all data were ephemeral?

Visual of Greenhouse for Space Colonies

Greenhouse for Space Colonies

Researchers from Arizona and NASA unveiled a plan to sustainably provide food in space, growing it in an inflatable greenhouse.

Visual of Growing Norwegian Nori in the Lab

Growing Norwegian Nori in the Lab

Norwegian researchers have succeeded to grow nori under laboratory conditions for the first time.

Visual of NNN Presents HUBOT - The Job Agency for People and Robots

NNN Presents HUBOT - The Job Agency for People and Robots

A horse can run faster than a human, yet nobody claims horses will make mankind dispensable. When a man rides a horse and the two work together, something new happens. Then, what …

Visual of Insect Ramen: the New Food Trend

Insect Ramen: the New Food Trend

Tokyo restaurant offers sustainable new dish - ramen noodles topped with crunchy insects and people love it

Visual of An afternoon with Josh Tetrick: The man who wants to bring in vitro meat to the market by 2018

An afternoon with Josh Tetrick: The man who wants to bring in vitro meat to the market by 2018

Meet Josh Tetrick, entrepreneur who wants to reinvent the food industry and plans to launch lab-grown meat on the market by the end of 2018.

Visual of Watch Koert's TED Talk on Meat the Future

Watch Koert's TED Talk on Meat the Future

We need to talk about the future of meat! Watch Next Nature Network director Koert van Mensvoort's TED talk on Meat the Future.

Visual of Making Tomatoes Tasty Again

Making Tomatoes Tasty Again

Scientists have found a way to bring back the lost flavor of tomatoes.

Visual of Meet the Emoji Snake

Meet the Emoji Snake

Python breeder designed emoji snake.

Visual of Nomophobia: the Fear of Phonelessness

Nomophobia: the Fear of Phonelessness

Nomophobia, no-mobile-phobia, is the fear of being separated from your smartphone.

Visual of One Minute on the Internet

One Minute on the Internet

With the rise of modernity, we have domesticated ourselves with new technology: discover how the world spends one minute on the Internet.

Visual of AI Foodcial Recognition 

AI Foodcial Recognition 

Pic2Recipe is an artificial intelligence system able to recognize ingredients, identify a dish and suggest recipes from a single image.

Visual of Plants + Science = Meat!

Plants + Science = Meat!

What if you could have the taste of a juicy, sizzling burger without the destructive impact of using animals for meat? That is what Impossible Foods wants to do with its new burger.

Visual of Smartflower Solar Device

Smartflower Solar Device

POP is an all-in-one solar energy system that hold visible benefits for humans.

Visual of Preventive Punishment for Robots

Preventive Punishment for Robots

The Punishment is an installation featuring a robotic arm that mimics a kid's handwriting perfectly, and repetitively writes "I must not hurt humans".

Visual of Print Your House in a Day!

Print Your House in a Day!

A Russian construction firm prints houses in 24 hours on site with their mobile 3D printer.

Visual of Robot Librarians Instruct Young Generations

Robot Librarians Instruct Young Generations

The Dutch province Gelderland-South uses two educational robots to increase kids' knowledge on such a technology.

Visual of Recharge! Sun for Your Brain Cells

Recharge! Sun for Your Brain Cells

A gadget called HumanCharger promises "the sun in your pocket" to give you energy, by beaming light through your ears.

Visual of Rent a Rain Room

Rent a Rain Room

Rent a rain room with simulated rain with a motion sensor to go through the rain without getting wet.

Visual of Dubai Employs First Robotic Police Officer

Dubai Employs First Robotic Police Officer

The first robotic officer will soon report for duty in Dubai.

Visual of Jobs for the Extraordinary-Robots at Work #5

Jobs for the Extraordinary-Robots at Work #5

This is post number five of our serie 'Robots at Work'. In this last episode we present you five jobs for the extraordinary, the ones who won't let themselves be categorized.

Visual of The Self-Flying Taxi Drone

The Self-Flying Taxi Drone

Passenger-carrying drones will hit the skies in Dubai this summer.

Visual of Skyscraper Hanging from the Sky

Skyscraper Hanging from the Sky

What if we rethink the system and instead of building from earth to sky, we do it the other way around?

Visual of Slaughterbots Video Depicts Killer Bots Nightmare

Slaughterbots Video Depicts Killer Bots Nightmare

This seven-minute video, titled 'Slaughterbots', shows a future in which palm-sized autonomous drones commit untraceable massacres.

Visual of Smog Free Bicycles

Smog Free Bicycles

Introducing bicycles to purify pollution as you pedal.

Visual of Solar Powered Electric Cars

Solar Powered Electric Cars

The sun sustains our planetary system. Its energy fuels life. And in the future, the sun will also fuel our cars. That’s the premise of Dutch startup Lightyear, a startup specialized in solar powered electric cars.

Visual of Speech Development Lost in Screens

Speech Development Lost in Screens

A study shows that screen time for kids between six months and two years triggers expressive speech delay.

Visual of Swap Your Smartphone for a Pineapple

Swap Your Smartphone for a Pineapple

Dutch commercial telecom provider Ben recently launched an advertising campaign to sell smartphone plans by promoting disconnection.

Visual of Tattooing Fruits and Veggies with Lasers

Tattooing Fruits and Veggies with Lasers

Eco-friendly lasers might soon replace stick-on labels on fruits and veggies.

Visual of The Economy of Ecology

The Economy of Ecology

What if we could redesign the system to work for humanity and the planet we call home? What would the economy of ecology look like?

Visual of The In Vitro Meat Cookbook Is Officially Art

The In Vitro Meat Cookbook Is Officially Art

The Stedelijk Museum has added The In Vitro Meat Cookbook to its public art collection, turning the book into a piece of art!

Visual of Tinder for Orangutans

Tinder for Orangutans

The Apenheul primate park in Apeldoorn, the Netherlands, has launched a four-year experiment to study how the primates make their mating choices.

Visual of Toilet Paper for Your Smartphone

Toilet Paper for Your Smartphone

Toilet paper for smartphones now on offer at Japanese airport.

Visual of Transformative Appetite: Shape-Shifting Pasta

Transformative Appetite: Shape-Shifting Pasta

MIT Media Lab developed pasta programmed on a computer.

Visual of A Truly Exotic Fruit: the Space Mango

A Truly Exotic Fruit: the Space Mango

Scientists sent mango embryos to space lab in order to let them develop new genetic traits.

Visual of Twittering Trees Talk Climate Change

Twittering Trees Talk Climate Change

How do trees feel? A team of scientists have developed a network of twittering trees to monitor their feelings and raise awareness over climate change.

Visual of Using Spinach to Detect Explosives

Using Spinach to Detect Explosives

Introducing nanobionic spinach plants that can detect explosives.

Visual of Virtual Baby Acts and Looks Impossibly Real

Virtual Baby Acts and Looks Impossibly Real

A rosy-cheeked kid learns her first words, cries when her babysitter leaves, smiles when she’s happy, but she’s not real. BabyX is an AI research-in-progress by a company named Soul Machines.

Visual of Visit the Garden of Eden

Visit the Garden of Eden

Discover the Next Nature Habitat VR and explore four future environments we might live in someday.

Visual of Meat the Future Exhibition: Appetizer

Meat the Future Exhibition: Appetizer

Have you already visited our Meat the Future exhibition? Consider this three course meal an introduction to what you may expect.

Visual of Protect Your Phone With a Watermelon

Protect Your Phone With a Watermelon

Watermelons are the new phone cases?

Visual of World’s First Lab-Grown Chicken Is Here

World’s First Lab-Grown Chicken Is Here

Memphis Meats reveals world’s first lab-grown chicken.

Visual of Envisioning the future of artificial biological reproduction in Mexico

Envisioning the future of artificial biological reproduction in Mexico

The debate on the future of artificial biological reproduction is moving to Mexico. C Minds, an impact innovation agency that believes in ‘a 4th Industrial Revolution that brings …

Visual of The Dictionary of Online Behavior adds a virtual layer to your vocabulary

The Dictionary of Online Behavior adds a virtual layer to your vocabulary

To some extent, it's a chicken-and-egg question: Are you unable to think about things you don't have words for, or do you lack words for them because you don't think about them? …

Visual of How self-driving cars will change our sex lives

How self-driving cars will change our sex lives

It’s clear that driverless cars will revolutionize the way we get from Point A to Point B. Perhaps less obvious is how it’ll change our sex lives. According to a new study by the …

Visual of Turning surplus bread into craft beer

Turning surplus bread into craft beer

Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …

Visual of The real-life gruesome experiments that inspired Frankenstein

The real-life gruesome experiments that inspired Frankenstein

On January 17 1803, a young man named George Forster was hanged for murder at Newgate prison in London. After his execution, as often happened, his body was carried ceremoniously …

Visual of #French [Green] DreamTowers

#French [Green] DreamTowers

FrenchDreamTowers is an eco-friendly high-rise complex imagined by Paris-based architect studio XTU , for the city of Hangzhou in Southern China. Currently under study, the …

Visual of Human Nature, designing the equilibrium with Koert van Mensvoort

Human Nature, designing the equilibrium with Koert van Mensvoort

Under the title Human Nature, designing the equilibrium, eleven designers will answer questions about a future in which Humankind and Nature enter into a new relationship. An …

Visual of How in vitro meat became a subject of debate in the Dutch parliament

How in vitro meat became a subject of debate in the Dutch parliament

To all in vitro meat optimists, hear hear! In May 2018 we launched the petition ' In vitro meat is here. Let us taste it. ' We proudly announce that this petition led to …

Visual of Why insects are not the new sushi

Why insects are not the new sushi

People across the world have been eating insects for thousands of years. We know that approximately 2,000 species are edible and that these insects are eaten in many different …

Visual of How the Dutch government is obstructing the advent of in vitro meat

How the Dutch government is obstructing the advent of in vitro meat

In 2017, two years after her father died , Ira van Eelen decided to call the Dutch Arable Farming Union. She couldn't help but wonder how come the Netherlands was still not …

Visual of On the origin of the word processor

On the origin of the word processor

Writing is recognised as one of mankind’s foremost inventions and the mechanization of writing is one of these developments that typify what is commonly regarded as the work of …

Visual of In vitro meat is here! But we are not allowed to taste it

In vitro meat is here! But we are not allowed to taste it

Previously we predicted that we would be eating in vitro meat by 2028. But as it turns out... In vitro meat is already here! And we are not allowed to eat it. The meat has been …

Visual of Proposing with a Phone Case

Proposing with a Phone Case

Not only does this phone case conceal your engagement ring in preparation for the big moment, but it’ll then take a video of your partner as you go down on one knee.

Visual of The return of Rayfish Footwear?

The return of Rayfish Footwear?

Rayfish Footwear was a fictional company that offered personalized sneakers crafted from genetically modified stingray leather. This online science fiction story allowed customers …

Visual of Sandra Rey wins ECO Coin Award

Sandra Rey wins ECO Coin Award

This year we are proud to announce that, with her ambitious work within the field of bioluminescence for Glowee, Sandra Rey is the ECO Coin Award 2017 winner.

Visual of Welcome spring with this selection of NANO Supermarket products

Welcome spring with this selection of NANO Supermarket products

Well, we finally made it. After a long, cold, dark winter, spring has officially started today. And guess what it's bringing with it? Nope, not spring flowers: Love flowers! …

Visual of Celebrate 10 years of Studio Drift at the Stedelijk Museum

Celebrate 10 years of Studio Drift at the Stedelijk Museum

Tonight, Studio Drift is launching their debut museum solo exhibition at the Stedelijk Museum in Amsterdam: Coded Nature . As  NNN Fellows , this Dutch duo is showcasing a …

Visual of The Ocean Cleanup heads for the Pacific

The Ocean Cleanup heads for the Pacific

The Ocean Cleanup claims its device could cut the size of the Great Pacific Garbage Patch in half in five years.

Visual of How animal filters unmask the estranged relation to our wild self

How animal filters unmask the estranged relation to our wild self

Would you like a dog snout, cat eyes or fluffy bunny ears? The choice is yours. Virtual selfie filters have become a widespread phenomenon on social media platforms such as …

Visual of How an app is helping restaurants cut food waste

How an app is helping restaurants cut food waste

Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …

Visual of Games become jobs: Looking through the eye of the submarine with an X-Box controller

Games become jobs: Looking through the eye of the submarine with an X-Box controller

Submarines feature a special device called a periscope that allows people inside the submarine to see what's going on above water. Controlling such an eye requires hours of …

Visual of AI creates images of food that doesn’t exist (yet)

AI creates images of food that doesn’t exist (yet)

A team of researchers from Tel-Aviv University developed a neural network capable of reading a recipe and generating an image of what the finished, cooked product would look like. …

Visual of Air pollution may be making us less intelligent

Air pollution may be making us less intelligent

Not only is air pollution bad for our lungs and heart , it turns out it could actually be making us less intelligent, too. A recent study found that in elderly people living in …

Visual of This artificial reef was just deployed in Sydney Harbor

This artificial reef was just deployed in Sydney Harbor

Earth’s oceans have seen better days. They’re inundated with plastic waste, both whole single-use plastics and tons of plastic microparticles that find their way back into our …

Visual of Why electric cars should be allowed to drive faster

Why electric cars should be allowed to drive faster

In response to the nitrogen crisis, the Dutch cabinet is planning to reduce the speed limit during the day to 100 kph. In itself a sensible decision. But it is strange that this …

Visual of 4 visions about the future of public transportation

4 visions about the future of public transportation

The way people get around is starting to change, and as a professor of transport strategy I do rather wonder if the modes of transport we use today will still be around by the …

Visual of Future Food: here's what we'll be eating in 2050

Future Food: here's what we'll be eating in 2050

What will you be having for breakfast, lunch or dinner in 2050? Where will this food be sourced? And how will it be prepared? Edible insects? A hamburger made from cultured meat? …

Visual of Genetically engineered plants do it better

Genetically engineered plants do it better

Welcome to the conversation! Every week, we’ll open up a new conversation among members of the network about next nature topics we've encountered around the globe. We hope …

Visual of The GOGBOT Conference 2019 is your guide to biotech futures

The GOGBOT Conference 2019 is your guide to biotech futures

Look around you and try to find the most natural thing in the room you are in now. It is you. But for how long? Welcome to the wonderful world of bio design ; a world full of …

Visual of Why not all buildings have sustainable green roofs

Why not all buildings have sustainable green roofs

Rooftops covered with grass, vegetable gardens and lush foliage are now a common sight in many cities around the world. More and more private companies and city authorities are …

Visual of Microbiocene: the microbiological archeology of the future

Microbiocene: the microbiological archeology of the future

In configuring our next nature, artists and scientists explore new languages that move beyond the Anthropocene - the era of human beings. These semantics would bridge the gap …

Visual of This exhibition looks at how robots are changing the world we live in

This exhibition looks at how robots are changing the world we live in

Delve into the science and fiction of robots at V&A Dundee’s latest exhibition: Hello, Robot . Contemplate the existence of robots and how they have both shaped, and been …

Visual of Next Generation: Unleashing nature’s untapped potential with Amelie Unger

Next Generation: Unleashing nature’s untapped potential with Amelie Unger

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of Next Generation: Thinking about the future of food with Annie Larkins

Next Generation: Thinking about the future of food with Annie Larkins

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of 10 Next Nature dinner table conversation starters

10 Next Nature dinner table conversation starters

Summer is here and the sun is out, and yes, this is awesome. After a long day in the sizzling summer sun, you get a group of people together to share some delicious food, …

Visual of Why some plastic packaging is necessary to prevent food waste

Why some plastic packaging is necessary to prevent food waste

There has been a surge in awareness of the damage that plastic pollution does to our planet in recent years. It has spurred a number of campaigns to remove single-use plastics …

Visual of Not a babysitter, but a social media sitter

Not a babysitter, but a social media sitter

Ibis, A popular European hotel chain, just introduced the world to the “social media sitter.” It’s the answer to a problem few knew existed, and even fewer though we needed …

Visual of The Next Nature guide to Transmediale 2019

The Next Nature guide to Transmediale 2019

Berlin is kicking off its cultural season with the not-to-miss 23th installment of Transmediale . This year the digital art/culture festival focuses on how feelings are made into …

Visual of Open call: speculative product advertisements

Open call: speculative product advertisements

In anticipation of the forthcoming Next Nature Magazine, we call upon you, dearest creatives, to submit a fictitious editorial advertisement: The Infotizement. The infotizement is …

Visual of Next Generation: listening to ultrasound waves with Sheng-Wen Lo

Next Generation: listening to ultrasound waves with Sheng-Wen Lo

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here?  Get in touch …

Visual of Is in vitro meat good news for animals?

Is in vitro meat good news for animals?

The Singapore Food Agency has approved “chicken bites” containing meat made from real chicken cells that were grown outside of a chicken’s body. Alongside similar news from Israel …

Visual of Living robots made from frog stem cells may revolutionize medicine

Living robots made from frog stem cells may revolutionize medicine

At just a millimeter wide, Xenobots are “neither a traditional robot nor a known species of animal", they are "a new class of artifact: a living, programmable organism”, says …

Visual of Mediamatic offers a quarantine-approved dinner date

Mediamatic offers a quarantine-approved dinner date

Dinner for two, please! Well we didn't expect to say that in a while. Luckily our friends at Mediamatic are working on an innovative solution. Their 'Serres Séparées' dinner dates …

Visual of Next Generation: Hearing the first breath of Earth with Dora Lionstone

Next Generation: Hearing the first breath of Earth with Dora Lionstone

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Next Generation: illustrating the remains of the anthropocene with Louise Silfversparre

Next Generation: illustrating the remains of the anthropocene with Louise Silfversparre

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Next Generation: Exploring the vegetal cyborg with Marie Declerfayt

Next Generation: Exploring the vegetal cyborg with Marie Declerfayt

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here?  Get in touch  and …

Visual of 7 ways to connect with your loved ones

7 ways to connect with your loved ones

During these challenging times, we have tried to find happy moments together where we could find them. From weekly Zoom lunches to having online wine tastings, still, it doesn't …

Visual of 6 gadgets to make your long distance relationship last

6 gadgets to make your long distance relationship last

"Absence makes the heart grow fonder" is a common phrase people associate with romance that has been forced apart by distance. But for long-distance couples (as many of us can …

Visual of Synthetic skin is bringing the sense of touch to VR

Synthetic skin is bringing the sense of touch to VR

Current social distancing measures are all about keeping a physical distance from each other in order to flatten the curve. But this does not mean we have to keep a distance from …

Visual of The technosphere is outweighing the biosphere

The technosphere is outweighing the biosphere

Our deficiencies have always driven us, even among our distant ancestors, back in the last Ice Age. Having neither the speed and strength to hunt large prey, nor sharp teeth and …

Visual of How a giant robot learns its true nature

How a giant robot learns its true nature

At first glance, the premise of the film 'The Iron Giant' (1999) seems to be a total failure. An animation film set in the United States in 1957; while the Russian satellite …

Visual of Next Generation: Moving towards the plastic human with Max Ahluwalia

Next Generation: Moving towards the plastic human with Max Ahluwalia

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Towards a global society as a superorganism

Towards a global society as a superorganism

Today we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …

Visual of What will COVID-19 teach us about life?

What will COVID-19 teach us about life?

We live in turbulent times. Thanks to science and technology, we are able to perceive our environment down to the atomic level. We can read DNA, manipulate cells, cut and paste …

Visual of Why screen games are still real play

Why screen games are still real play

Play is a core part of a healthy childhood , through which children develop social, communication, cognitive and physical skills. Children’s play adapts to its circumstances. …

Visual of Exploring the society of trees

Exploring the society of trees

In conversation with Canadian researcher Suzanne Simard, inventor of the Wood Wide Web.

Visual of A message from volcanic rocks

A message from volcanic rocks

Although it’s seductive to think of human beings as the dominant species on earth, many others play important roles too. Bacteria, insects, algae colonies, rocks and the …

Visual of Next Generation: Building aquatecture with Shaakira Jassat

Next Generation: Building aquatecture with Shaakira Jassat

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of How can Big History help us think about the future?

How can Big History help us think about the future?

'Big History' is a multidisciplinary study that seeks to put the human story into the context of a 13.8 billion-year story from the Big Bang to now.

Visual of To decarbonize flying, we need biofuels

To decarbonize flying, we need biofuels

While aviation accounts for 2.4% of all emissions from fossil fuel use globally, two-thirds of the sector’s warming effect depends on something other than its CO₂ emissions. And …

Visual of Blocking the sun with dust

Blocking the sun with dust

In the past few years, scientists have hatched some pretty crazy-sounding schemes in the name of protecting Earth and its inhabitants. From building an underwater wall 120 …

Visual of CO2 injected volcanic rock could save the atmosphere

CO2 injected volcanic rock could save the atmosphere

The rapid technological advancement of the human race has led to many consequences, especially regarding the integrity of the atmosphere that protects all life on Earth. Although …

Visual of How cyborg soil reveals the secret microbial metropolis beneath our feet

How cyborg soil reveals the secret microbial metropolis beneath our feet

Dig a teaspoon into your nearest clump of soil, and what you’ll emerge with will contain more microorganisms than there are people on Earth. We know this from lab studies that …

Visual of A digital twin of the Earth could make the planet climate-neutral

A digital twin of the Earth could make the planet climate-neutral

While Elon Musk may be trying to initiate efforts to colonize Mars, scientists on Earth are attempting to build an accurate digital twin of the planet to simulate in the future. …

Visual of Beijing's dust storm: part human, part nature

Beijing's dust storm: part human, part nature

The skies in Beijing turned orange recently, thanks to what was widely reported as a massive sandstorm . The problem, at least in terms of public health, is that it was not …

Visual of How telecommunication cables could help detect earthquakes

How telecommunication cables could help detect earthquakes

At the bottom of the Earth’s oceans lies an intricate network of over a million kilometres of fibre optic cables. These cables were laid on the seabed by telecommunication …

Visual of Elephants are geodesigners

Elephants are geodesigners

Imagine you’re in a hot air balloon flying over an African savanna in the late growing season. Below, herds of elephants, zebras, wildebeests and rhinos roam a mosaic landscape …

Visual of Fish-inspired soft robot takes a deep dive

Fish-inspired soft robot takes a deep dive

The deepest regions of the oceans still remain one of the least explored areas on Earth, despite their considerable scientific interest and the richness of lifeforms inhabiting …

Visual of Explore the future of nature at IDFA Festival

Explore the future of nature at IDFA Festival

Humans often claim to be at the top of the food chain, but is that really the case? We are experiencing – now more than ever – our own fragility: an increase in natural disasters, …

Visual of Gear up for our VR timemachine!

Gear up for our VR timemachine!

Travel to big future in our VR timemachine at the Evoluon in Eindhoven

Visual of Printing houses with cow poop

Printing houses with cow poop

Now here's a perspective: a pooping cow is like a living 3D printer

Visual of Dune explores the geopolitics behind resource extraction

Dune explores the geopolitics behind resource extraction

Dune offers a useful allegorical narrative of the “scramble for Africa”, which saw European empires carve up the continent into colonized powers.

Visual of Humans could recolonize Earth after mass extinctions with ectogenesis

Humans could recolonize Earth after mass extinctions with ectogenesis

Lately it seems that every movie, book and video game we see is about future apocalypses. Science articles are also painting a grim future for Earth and its inhabitants. If it’s …

Visual of La Belle Verte imagines a world of harmonious existence

La Belle Verte imagines a world of harmonious existence

Utopianism and dystopianism are themes often found in today’s movies, especially considering the increased awareness of the damage done to the Earth by human activities. Often …

Visual of How a mantis shrimp can one day help build self-growing roads

How a mantis shrimp can one day help build self-growing roads

Don’t get fooled by the colourful, unsuspecting demeanour and size of the mantis shrimp. Known as “death incarnate” to its prey on the seafloor, the crustacean hides two …

Visual of Meet Kaia the CO2 filtering lamp

Meet Kaia the CO2 filtering lamp

Did you know that we owe every second breath we take to the algae in the sea? And that minerals have been absorbing CO2 for billions of years while converting it into important …

Visual of The Next Nature gift guide 2021

The Next Nature gift guide 2021

As winter arrives, so does the season of giving. Good gift giving is an art and can be quite the endeavor at times. But don’t worry, Next Nature is here to help! We present to you …

Visual of Notes on the plastisphere

Notes on the plastisphere

Every piece of plastic that’s ever made, still exists. It results in a floating garbage dump in the ocean, full of life. While this (geo)design was never intentional, humans …

Visual of Plant virtual flowers with Pikmin Bloom

Plant virtual flowers with Pikmin Bloom

Soon it will be possible to grow flowers with your phone. Niantic and Nintendo joined forces to create a new mobile game connected to the Pikmin franchise. In this augmented …

Visual of How plastic waste is hurting women in developing countries

How plastic waste is hurting women in developing countries

If we are to build a greener, fairer and more equal society in the wake of COVID-19, it’s time for rich countries to end their practice of dumping plastic waste in developing …

Visual of Science Friction explores living among companion species

Science Friction explores living among companion species

Is it possible to imagine other earthly stories? Can we conceive of other ways of living among different species? This exhibition explores these issues with the help of a …

Visual of Animals are shapeshifting to cope with climate change

Animals are shapeshifting to cope with climate change

Global warming is a big challenge for warm-blooded animals, which must maintain a constant internal body temperature. As anyone who’s experienced heatstroke can tell you, our …

Visual of Social media likes change the way we feel about our memories

Social media likes change the way we feel about our memories

Memories are often considered very personal and private. Yet, in the past few years, people have got used to notifications from social media or phone galleries telling them they …

Visual of This documentary tells the story of Biosphere 2

This documentary tells the story of Biosphere 2

Can we create a new biosphere on another planet? Documentary "Spaceship Earth" shows how - in the Arizona desert.

Visual of Donna Haraway rejects the doomsday rhetoric of the Anthropocene

Donna Haraway rejects the doomsday rhetoric of the Anthropocene

For multispecies feminist theorist Donna J. Haraway, “it matters what stories make worlds, what worlds make stories.” She studies the current age as the Chthulucene (chthon, …

Visual of Join the Next Nature Talkshow on biodesign!

Join the Next Nature Talkshow on biodesign!

A living lamp that you need to feed, a tapestry made of animal waste streams and tableware made from algae. Welcome to the wonderful world of biodesign.

Visual of The Internet of Mycelium

The Internet of Mycelium

A lot of the ground we live on is polluted. More than a third of our soils are moderately or heavily degraded; heavy metals such as lead are increasingly found in urban soils, …

Visual of How memes are evolving beyond the image

How memes are evolving beyond the image

The times where memes were geeky and funny, somewhat disturbing images have been over for years. Even a simple frog such as Pepe is not innocent anymore. Memes were hijacked by …

Visual of This machine makes human clouds

This machine makes human clouds

Humans have been changing the composition of the atmosphere for years, resulting in concerns such as air pollution and extreme climate events. According to Filips Stanislavskis , …

Visual of Tiny houses: why more people are living in miniature

Tiny houses: why more people are living in miniature

Tiny houses have been heralded as a radical and creative way to address a lack of affordable housing, as well as reducing living costs and shrinking our carbon footprint. My PhD …

Visual of Meet the lungs of the sea: phytoplankton

Meet the lungs of the sea: phytoplankton

Phytoplankton are microscopic algae living throughout the ocean’s surface waters. They can’t swim and are at the mercy of the currents and tides. Despite their small size, …

Visual of Turn your garden into living artworks for bees

Turn your garden into living artworks for bees

Art not for people, but for insects. That is the goal of the Pollinator Pathway project by Alexandra Daisy Ginsberg. With her concept she wants to change the way we perceive our …

Visual of Working with microbes to clean up electronic waste

Working with microbes to clean up electronic waste

If you were to stack up all the electronic waste produced annually around the world it would weigh as much as all the commercial aircrafts ever produced, or 5,000 Eiffel towers. …

Visual of We sequenced DNA from a million-year old mammoths

We sequenced DNA from a million-year old mammoths

Most people think of mammoths as the iconic woolly species from the last Ice Age, which ended around 12,000 years ago. But mammoths originated in Africa around 5 million years …

Visual of What Rachel Armstrong is reading this summer

What Rachel Armstrong is reading this summer

Architect Rachel Armstrong establishes an alternative approach to sustainability. Through a close reading of computational properties of the natural world, Armstrong develops a …

Visual of Why urban gardens are crucial for conserving bees and butterflies

Why urban gardens are crucial for conserving bees and butterflies

As humans have industrialised farming to feed a growing global population, pollinators – animals vital for plant reproduction – have seen their food supply decline. In the UK, …

Visual of Next Generation: Exploring blood, salt and iron as biomaterials with Hedwich Rooks

Next Generation: Exploring blood, salt and iron as biomaterials with Hedwich Rooks

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch: magazine@nextnature.net. …

Visual of Discovering AI generated species

Discovering AI generated species

Sofia Crespo and Feileacan McCormick have made an AI-generated endangered species installation on Times Square.

Visual of Exploring public spaces, landmarks and landscapes in Beneath the Surface expo

Exploring public spaces, landmarks and landscapes in Beneath the Surface expo

The ‘Beneath the Surface’ exhibition organized by Taiwan Designers’ Web at the Chiayi Art Museum teaches us about unconventional connections, past and future.

Visual of Beware of the Smombies: how smartphones affect our infrastructure

Beware of the Smombies: how smartphones affect our infrastructure

Next time you are taking a walk to work, have a look around you. You will probably notice that most of your fellow pedestrians are glued to their phones, rather than enjoying the …

Visual of Bio, Art & Design (BAD) Award Winners

Bio, Art & Design (BAD) Award Winners

The three winners of the Bio, Art & Design (BAD) awards have been announced.

Visual of Next Generation: Adorning bio embellishments with Aradhita Parasrampuria

Next Generation: Adorning bio embellishments with Aradhita Parasrampuria

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Building with biocement

Building with biocement

Using the waste streams from the chemical industry and urine to make biocement.

Visual of Understanding the ocean's metabolism

Understanding the ocean's metabolism

Scientists have discovered the effect of sunscreen on corals. We need to understand our impact on the world to understand its problems.

Visual of Next Generation: Producing glass from ashes with Benedikt Peirotén

Next Generation: Producing glass from ashes with Benedikt Peirotén

Benedikt Peirotén has started a project called ‘From the Ashes’ proposing using waste streams to replace the energy-intensive ingredients in glass.

Visual of The GeneSprout Initiative: cultivating new plant breeding techniques

The GeneSprout Initiative: cultivating new plant breeding techniques

Some 10,000 years ago humans began to domesticate plants and animals. The birth of agriculture, one of the earliest technologies available.

Visual of Time gets bendy in Disney Pixar's new film

Time gets bendy in Disney Pixar's new film

Spoiler alert: this article explains a key plot point, but we don’t give away anything you won’t see in trailers. At the beginning of the new Disney Pixar film, Lightyear, Buzz …

Visual of Next Generation: Tasting Landless Food with Malu Luecking

Next Generation: Tasting Landless Food with Malu Luecking

Regeneration of extinct flavor families via microalgae 

Visual of Driving solar with Lightyear: the world's first solar car

Driving solar with Lightyear: the world's first solar car

Imagine driving along in your car, powered by the same solar energy that nourishes the landscapes around it. Lightyear 0 is the world's first solar powered car, charging itself …

Visual of Mapping the world's DNA

Mapping the world's DNA

The Earth BioGenome Project is aiming to create a database of genomes of all organic life on earth within 10 years.

Visual of Using tattoos in medicine

Using tattoos in medicine

What if we can use tattoos to measure the concentration of certain components in your blood? Scientists developed a film that can detect the amount of oxygen.

Visual of Next Generation: Emptying Out with Natasja Bökkerink

Next Generation: Emptying Out with Natasja Bökkerink

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Next Generation: Wandering through the post wilderness with Melissa Schwarz

Next Generation: Wandering through the post wilderness with Melissa Schwarz

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Next Nature Gift Guide 2022

Next Nature Gift Guide 2022

The most wonderful time of the year can turn stressful quite easily when you run out of exciting gift-ideas. Don't worry, we got you covered.

Visual of Submit your project to the Bio Art & Design Awards 2022

Submit your project to the Bio Art & Design Awards 2022

Hello upcoming bio artists and designers! We invite designers and artists interested in bio art & design to propose projects for collaborative work across disciplines. The Bio …

Visual of Our VR timemachine comes to Amsterdam

Our VR timemachine comes to Amsterdam

So you missed your flight to the Big Future? Or do you have withdrawal symptoms from your previous trip? Not to worry, we have news for you. Schedule a new flight from 12 March—1 …

Visual of Why Borghildur Indriðadóttir wishes to perform on the Moon

Why Borghildur Indriðadóttir wishes to perform on the Moon

What is the meaning of art on the moon? Artist on the Moon is the latest project from Icelandic visual artist Borghildur Indriðadóttir , who aims to perform for the stars and …

Visual of The carbon footprint of space tourism

The carbon footprint of space tourism

The commercial race to get tourists to space is heating up between Virgin Group founder Sir Richard Branson and former Amazon CEO Jeff Bezos. On Sunday 11 July, Branson ascended …

Visual of From Megabytes to CO2

From Megabytes to CO2

Thijs Biersteker has designed an art installation that shows the carbon dioxide emission of the internet.

Visual of The No(nhuman) Consent Form

The No(nhuman) Consent Form

There seems to be a green shift happening in Dutch Design, where the traditional vision is slowly sprouting into a newer, more refreshing one. The biodesigners are emerging from …

Visual of Next Generation: Designing a living menstrual cup with Lucrezia Alessandroni

Next Generation: Designing a living menstrual cup with Lucrezia Alessandroni

What if living objects could re-connect humans with their menstrual cycle and change the way we perceive it?

Visual of Next Generation: Unlearning botanical narratives with Nina Škerjanc

Next Generation: Unlearning botanical narratives with Nina Škerjanc

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Using the intelligence of plants to battle climate change

Using the intelligence of plants to battle climate change

Living Carbon enhances natural traits in plants as a solution for stabilizing the climate by increasing the efficiency of the photosynthesis process. 

Visual of We’re all radioactive – life isn't possible without it

We’re all radioactive – life isn't possible without it

Most radiation is natural and life on Earth wouldn’t be possible without it.

Visual of Organs from genetically engineered pigs may help shorten the transplant wait list

Organs from genetically engineered pigs may help shorten the transplant wait list

Demand for life-saving organ transplantation is at an all-time high. In 2021, a record 41,000-plus organ transplants were performed in the U.S., with top numbers for kidney, liver …

Visual of AI meal planner suggests humans to cook with human flesh and bleach

AI meal planner suggests humans to cook with human flesh and bleach

AI sure knows how to throw a banger of a dinner party. One that guests will never forget - or outlive. When New Zealand grocery store chain PAK’nSAVE introduced their new …

Visual of Bacteria might have eaten the Titanic's wreckage by 2030

Bacteria might have eaten the Titanic's wreckage by 2030

In 1912, the RMS Titanic met a fateful demise as it crashed into the depths of the North Atlantic Ocean, leaving a mark on the world's collective memory, and igniting a lasting …

Visual of Bluehouses are the new greenhouses

Bluehouses are the new greenhouses

Fishfarming , or aquaculture has been the fastest growing food-sector for decades. This is nothing to be surprised about: fishing as a practice has been in existence since the …

Visual of ChatGPT is getting stupider and we don't know why - so I asked ChatGPT

ChatGPT is getting stupider and we don't know why - so I asked ChatGPT

AI language model ChatGPT has hit the mainstream last year when it became widely accessible to everyone. Next to doing our (home)work, it became also a D&D Dungeon Master , …

Visual of People are now having sex in self-driving taxis

People are now having sex in self-driving taxis

In the evolving scenery of self-driving taxis in San Francisco, passengers are getting frisky in the backseat of driverless taxis.

Visual of Dubai will soon house the world's largest artificial coral reef

Dubai will soon house the world's largest artificial coral reef

A floating sustainable city where humans can live, work and study while supporting aquatic ecosystems. Soon this will become a reality in Dubai, as sustainable real estate company …

Visual of A Dutch startup is saving the banana from extinction

A Dutch startup is saving the banana from extinction

There is a banana crisis happening right now. Our beloved yellow fruits are being threatened with extinction due to a fungal infection called Panama disease, which can wipe out …

Visual of Fashion brand Ganni grew leather with bacteria

Fashion brand Ganni grew leather with bacteria

Danish fashion brand Ganni proposed a post-leather future: they grew imitation leather with bacteria.

Visual of NASA's 'Human Computers' helped land the first human on the moon

NASA's 'Human Computers' helped land the first human on the moon

Nowadays mechanical intelligence is often chosen over that of our own human capabilities. But there was a time where our computers were still not always a match against our own …

Visual of Next Generation: Designing chairs with mealworms and Will Eliot

Next Generation: Designing chairs with mealworms and Will Eliot

William Eliot designs chairs while collaborating with mealworms.

Visual of Whoops! Our sustainability efforts are warming the oceans

Whoops! Our sustainability efforts are warming the oceans

Cleaning up ships' pollution is making the ocean warmer than expected. Less pollution means less cooling clouds, heating up the Atlantic.

Visual of Paco Rabanne's AI-designed perfume can connect with your phone while making you smell sexier

Paco Rabanne's AI-designed perfume can connect with your phone while making you smell sexier

Paco Rabanne already positioned himself as a cutting-edge designer by establishing his reputation as one of the trailblazers during the space age movement of the 1960s. With his …

Visual of How to plant seeds with your shoes

How to plant seeds with your shoes

Imagine helping nature restore itself simply by going for a run. In a fusion of fashion and conservation, London-based designer Kiki Grammatopoulos has introduced her concept …

Visual of Saving the oceans by sinking a 1980's superyacht

Saving the oceans by sinking a 1980's superyacht

Sunshine, cocktails, and the lap of luxury; a yacht usually doesn’t seem to symbolize sustainability or charity. But this one might save the ocean.

Visual of Tesla enhanced Lotus, now Lotus returns the favor

Tesla enhanced Lotus, now Lotus returns the favor

Lo and behold the new Lotus Eletre Hyper SUV car. It shouldn't be allowed to exist, yet you may meet it in traffic soon.

Visual of All aboard the world's first hydrogen passenger train!

All aboard the world's first hydrogen passenger train!

As the world is trying to keep carbon emissions under control, humans are also looking for viable carbon-neutral transportation options. The people from French rolling stock …

Visual of Making prosthetic nipples out of human hair

Making prosthetic nipples out of human hair

Designer Arianna Pezzano creates prosthetic nipples using keratine coming from the hair that cancer patients lose during chemotherapy.

Visual of This vending machine gives out health advice in exchange for your personal data

This vending machine gives out health advice in exchange for your personal data

Your biggest wealth is health, but what it the costs you your anonymity? This vending machine gives you nutritional advice based on the information you give it.

Visual of Like fish that don't know they are wet, we are dwelling in a waterworks of money

Like fish that don't know they are wet, we are dwelling in a waterworks of money

The ancient Egyptians and Greeks saw water as the source of life, the "origin of everything". Today that role is reserved for money.

Visual of We can now grow insulin from lettuce

We can now grow insulin from lettuce

In a ground-breaking discovery, researchers at the University of Pennsylvania have achieved to produce insulin out of lettuce. There's no need for needles and injections anymore, …

Visual of Why we need space janitors

Why we need space janitors

Reduce, reuse, recycle. We know the drill. But how do we cope with a junkyard in space?

Visual of Why NASA sends giant disco balls into space

Why NASA sends giant disco balls into space

In the 1970s, NASA and the ASI launched a giant disco ball into space. Its purpose? Teaching the humans of today and the civilizations of tomorrow about Earth.

Visual of Will 3D-printed mussel reefs be the next nature?

Will 3D-printed mussel reefs be the next nature?

Researchers hope that 3D-printed, biodegradable mussel reefs help the growth of mussel banks.

Visual of Yes, we can fry potatoes in space!

Yes, we can fry potatoes in space!

Thanks to the European Space Agency (ESA) and a team of enthusiastic researchers from the University of Thessaloniki we now know for certain: we can fry potatoes in space.  …

Visual of Soon you can have dinner in space in a low-carbon balloon (if you're rich)

Soon you can have dinner in space in a low-carbon balloon (if you're rich)

Get ready to take your dining experience to literal new heights, soon we are able to enjoy high cuisine at the edge of space. French company Zephalto is introducing extravagant …

Visual of Cleaning water with magnets

Cleaning water with magnets

What if we could clean our water with magnets? Wageningen University & Research, introduces the Magnetic Adsorption-Desorption (MAD) project.

Visual of Food after flood: what's on the menu when sea levels rise?

Food after flood: what's on the menu when sea levels rise?

As sea levels climb, coastal communities brace for floods and erosion. Artist Allie Wist asked herself: what will we eat in a flood-filled future?

Visual of Merging AI with human brain cells

Merging AI with human brain cells

A team of researchers are currently investigating the fusion of human brain cells with artificial intelligence. Creepy or innovative?

Visual of Obese mice are losing weight without breaking a sweat

Obese mice are losing weight without breaking a sweat

Bye-bye gym membership, hello losing pounds. Scientists have found a new drug that helped obese mice lose weight.

Visual of MyPowerbank hacks bicycles so the homeless can juice up their phones

MyPowerbank hacks bicycles so the homeless can juice up their phones

Luke Talbot has developed a solution to assist people experiencing homelessness in charging their phones for free by hacking rental bicycles.

Visual of Next Gen: Watching our collective heartbeats with Nino Basilashvili

Next Gen: Watching our collective heartbeats with Nino Basilashvili

Heartsync is an interactive art installation crafted by artist Nino Basilashvili that syncs up your heartbeat with others. 

Visual of Why looking at beaver dams might save the world

Why looking at beaver dams might save the world

Eddie Corwin studies beaver dams and ponds from satellite images in order to restore watercourses and wetlands, and establish nature reserves.

Visual of Enter the symbiocene

Enter the symbiocene

What if we would use the idea of symbiosis as the basis for the next period of Earth’s history?

Visual of Future Festive Feast

Future Festive Feast

As the year is coming to a close, many of us are preparing our homes and dinner tables for a festive meal.

Visual of Meet the BAD Awards winners of 2023

Meet the BAD Awards winners of 2023

The annual Bio Art & Design (BAD) Award encourages new artists and designers to explore the world of bio art and design. Let's have a look at the three winning projects of this year.

Visual of Building the farm of tomorrow

Building the farm of tomorrow

Seven examples of how design will help us built the farm of tomorrow.

Visual of How to teleport sushi

How to teleport sushi

Sushi designed in Japan, printed in Texas. This might sound like a wild dream, but actually became a reality during interactive media festival South by Southwest (SXSW) that took …

Visual of Sonograms of planet earth

Sonograms of planet earth

Technology can help us to connect with our surroundings. Think about the microscope: it revealed ecosystems beyond our visual reach allowing us to look at the smallest inhabitants …

Visual of Enter Spa Sybarite: the luxury wellness center of our dreams and nightmares

Enter Spa Sybarite: the luxury wellness center of our dreams and nightmares

In conversation with film director Joshua Ashish Dawson about the future of wellness, climate anxiety and healthy cynicism India-born, Los Angeles-based film director Joshua …