Search results for Human Planet

Visual of Video Game-Playing Robot Acts More

Video Game-Playing Robot Acts More "Human" than Humans

Computer-controlled players in video games can usually be spotted for their repetitive, illogical or unemotional behavior. Unlike humans, non-player characters (NPCs) don't get …

Visual of 'Team Human' is a manifesto for humankind

'Team Human' is a manifesto for humankind

' Team Human ' is a manifesto—a fiery distillation of media theorist Douglas Rushkoff’s most urgent thoughts on civilization and human nature. In one hundred lean and incisive …

Visual of Humane Technology #4: Resonate with human senses

Humane Technology #4: Resonate with human senses

Principle number four: Humane technology should resonate with the human senses, rather than numbing them. If you're an office worker or a video game fanatic , you may spend most …

Visual of Humans Caused Mass Extinctions Before There Were Even Humans

Humans Caused Mass Extinctions Before There Were Even Humans

Humans and other hominids have a reputation for bringing about mass extinctions. Homo erectus  has been blamed for the disappearance of many African carnivores, our ancestors …

Visual of To Be Human Is To Be Transhuman

To Be Human Is To Be Transhuman

Buckle up for a new video from our favorite performance philosopher Jason Silva: To Be Human Is To Be Transhuman.

Visual of Talking Nonhuman Nonsense

Talking Nonhuman Nonsense

Nonhuman Nonsense is a research-driven design and art studio existing somewhere between utopia and dystopia. They wonder upon our relationship with the non-human, embracing …

Visual of Earth is so strongly impacted by its human inhabitants that it's now a “hybrid planet”

Earth is so strongly impacted by its human inhabitants that it's now a “hybrid planet”

Humanity has for a long time considered itself the most important species on the planet. We are quite happy to share the world with other species, but we think we know who's in …

Visual of Letter to Humanity

Letter to Humanity

NNN director Koert van Mensvoort writes a letter to humanity.

Visual of Humane Technology #6: Improve the Human Condition

Humane Technology #6: Improve the Human Condition

And now for the sixth and final principle: Humane technology improves the human condition and helps people realize the dreams they have of themselves. No matter what your …

Visual of Humane Technology #2: Revive Human Intuitions

Humane Technology #2: Revive Human Intuitions

Our second principle: Humane technology revives human intuitions, in particular those we might have forgotten about. 'Conventional' technology aims to overcome our hominid …

Visual of Humane Technology #3: Take Human Values as a Cornerstone

Humane Technology #3: Take Human Values as a Cornerstone

The third principle of humane technology: It should take human values as a cornerstone of its development. Technology doesn't have to be expensive or electronic to be humane. …

Visual of Why superhuman technologies will affect us all

Why superhuman technologies will affect us all

When you look through a super-telescope, you can still see the planet Earth. Once called the blue planet, she now looks red and parched. We had no choice but to abandon her… On a …

Visual of Why human enhancement requires technological citizenship

Why human enhancement requires technological citizenship

New technologies – from artificial intelligence to synthetic biology – are set to alter the world, the human condition, and our very being in ways that are hard to imagine. The …

Visual of Can technology be humane?

Can technology be humane?

We must be mindful about how we engage with technology: what we use it for, why, and whether it helps us or hinders us. Sometimes our tech seems to be flowing in inhumane …

Visual of Human-animal hybrids are coming and could be used to grow organs for transplant

Human-animal hybrids are coming and could be used to grow organs for transplant

Around the world thousands of people are on organ donor waiting lists. While some of those people will receive the organ transplants they need in time, the sad reality is that …

Visual of On inhumane technology

On inhumane technology

Stick-on shoes, wakeup lights, bionic limbs: these are examples of humane technology. But what exactly does this mean? It can best be explained in contrast with its opposite. …

Visual of Six principles of humane technology

Six principles of humane technology

We must be mindful about how we engage with technology: what we use it for, why, and whether it helps or hinders us. Sometimes our tech seems to be flowing in inhumane directions, …

Visual of Next Generation: Towards the Plastic Human with Max Ahluwalia

Next Generation: Towards the Plastic Human with Max Ahluwalia

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of A path to humane technology

A path to humane technology

In 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …

Visual of Discussing non-human centered design with Kelvin Godee and Simon Wijrdeman

Discussing non-human centered design with Kelvin Godee and Simon Wijrdeman

What if design began to put everything but the human first? The needs of the human not paramount to the design process, but instead the other entities that we cohabit planet earth …

Visual of The Ecological Human

The Ecological Human

The nature of humanity in the twenty-first century is, according to sociologist Steve Fuller, a ‘bipolar disorder’ beset with dualisms of identification such as divine/animal, …

Visual of Meet Humanity beyond Race, it's Beautiful

Meet Humanity beyond Race, it's Beautiful

Meet Humanity beyond Race, it's Beautiful

Visual of Fly like a Bird? Get Human Birdwings

Fly like a Bird? Get Human Birdwings

Dutch mechanical-engineer Jarnos Smeets dreams of flying like bird. Nothing new really, many people have had this dream for ages. Yet being an engineer and all, Jarnos is seriously propelling his dream towards a reality.

Visual of This exhibition investigates how humanity will live tomorrow

This exhibition investigates how humanity will live tomorrow

Occupying the 52nd floor of Tokyo’s Mori Tower, Mori Art Museum is internationally renowned for its visionary approach and highly original curation of contemporary art. The …

Visual of Ectogenesis, Artificial Womb, Human Egg?

Ectogenesis, Artificial Womb, Human Egg?

The artificial womb is on the verge of becoming a reality, but how it will affect our culture is for us to decide.

Visual of Three exhibitions that explore the relationship between humans and the environment

Three exhibitions that explore the relationship between humans and the environment

As we go about our daily activities, we may lose sight of our connections with nonhuman life. Here are three exhibitions to encourage you to step outside of your everyday and …

Visual of Humans Are the Sex Organs of Technology

Humans Are the Sex Organs of Technology

Written by Kevin Kelly , published in The Technium .  I claim that technology has its own agenda. What is the evidence that technology as a whole, or the technium as I call it, is …

Visual of Did Monogamy Make Us Human?

Did Monogamy Make Us Human?

Pair-bonding sets humans apart from our relatives. But where did it come from?

Visual of OUT NOW: Save the Humans! Book

OUT NOW: Save the Humans! Book

The SAVE THE HUMANS! book is now available on our web shop.

Visual of Glowing Planet T-Shirt

Glowing Planet T-Shirt

Featuring different cities at night, the Next Nature Glowing Planet T-shirt highlights the enchanting beauty of our glimmering world.

Visual of Longest Lived Human Embryo in a Lab

Longest Lived Human Embryo in a Lab

Scientists keeping a human embryo alive in lab for 13 days for the first time.

Visual of The Anthropocene Debate: Marking Humanity’s Impact

The Anthropocene Debate: Marking Humanity’s Impact

  Is human activity altering the planet on a scale comparable to major geological events of the past? Scientists are now considering whether to officially designate a new …

Visual of Neither Warfare nor Dumplings Are Innate to Human Nature

Neither Warfare nor Dumplings Are Innate to Human Nature

In Ngogo, Gombe and elsewhere in Africa, bands of male chimpanzees regularly make organized raids on neighboring troops and batter their enemies to death. These grim, warring …

Visual of The Non-Human Noosphere

The Non-Human Noosphere

The definition of the noosphere as "the sphere of human thought on earth" is woefully anthropocentric. It ignores that fact that our fellow sentient organisms have noospheres of …

Visual of The Posthuman Farm

The Posthuman Farm

Wu Tzu-ning presents a posthuman reality from genetic engineering to digital afterlife.

Visual of We Feel Empathy for Robots (Even if They Don't Look Human)

We Feel Empathy for Robots (Even if They Don't Look Human)

Human test subjects felt empathy for dinosaur robots being cuddled or abused.

Visual of 2016 - Human Embryo Lives 13 Days in Lab

2016 - Human Embryo Lives 13 Days in Lab

In 2016 a team of biologists has successfully kept a human embryo alive in the lab for 13 days, breaking the previous record of nine days.

Visual of Human Nature Forecast

Human Nature Forecast

Interview witth TEDx on how people are technological by nature, yet how we also need humane technology to remain human, or become even more human than we are today.

Visual of Plastic Planet

Plastic Planet

We tend to think of plastic as a cheap, inferior and ugly material used to make children’s toys, garden furniture and throwaway bottles. But as an experiment, imagine for a moment …

Visual of Meat-Eating Made Us Humans

Meat-Eating Made Us Humans

Eating meat has made us who we are today: evolved, intelligent humans, able to use a verbal language.

Visual of Letter to Humanity in 25 Languages, Plus One!

Letter to Humanity in 25 Languages, Plus One!

Read the Letter to Humanity in Morse Code.

Visual of Van Mensvoort Writes a Letter to Humanity

Van Mensvoort Writes a Letter to Humanity

On the occasion of the Earth Day, 22 April 2017, philosopher Koert van Mensvoort wrote his Letter to Humanity.

Visual of Three ways farms of the future can feed the planet and heal it too

Three ways farms of the future can feed the planet and heal it too

Intensive agriculture may be nourishing most of the Earth’s inhabitants, but it’s doing the opposite to earth itself. Its dependence on singular crops, heavy ploughing machinery, …

Visual of Humans to Blame for Global Warming

Humans to Blame for Global Warming

Global warming is "very likely" a human-caused problem that will last for centuries and require concerted international action to reduce its potentially devastating impacts, a …

Visual of Save The Humans – Submit your Quote

Save The Humans – Submit your Quote

We call upon you, dear readers, to participate in a new publication from the Next Nature Network: SAVE THE HUMANS!.

Visual of Study finds humans still evolving and quickly

Study finds humans still evolving and quickly

By Karen Kaplan, Los Angeles Times , December 11, 2007 The pace of human evolution has been increasing at a stunning rate since our ancestors began spreading through Europe, Asia …

Visual of Animals Give Leadership Lesson to Humans

Animals Give Leadership Lesson to Humans

What are the characteristics of the perfect leader? The answer could be found looking at nature.

Visual of Save The Humans @ The Hoxton Hotel

Save The Humans @ The Hoxton Hotel

Next Thursday, February 11, the Hoxton Hotel in Amsterdam dedicates an evening to our newest publication: 'Save the Humans!'

Visual of Scientists want to create human-cow hybrid

Scientists want to create human-cow hybrid

Scientists in the UK applied for permission to create part-cow, part-human embryos for research aimed at treating diseases such as Parkinson's and Alzheimer's. The embryos created …

Visual of Apes Like Cooked Food, and What that Means for Human Evolution

Apes Like Cooked Food, and What that Means for Human Evolution

Humans are the only species on earth that cooks its food. Not only do we cook our food, but we usually find the flavor of cooked foods preferable to the raw version. Compare the …

Visual of Humane Technology #1: Feels Natural

Humane Technology #1: Feels Natural

All too often, technology frustrates us. It forces our behavior into constrained pathways. Even more insidious, technology can knock us out of alignment with our values, goals or …

Visual of Humane Technology #5: Empower People

Humane Technology #5: Empower People

Principle number five: Humane technology doesn't outsource people, but instead empowers them. How healthy or humane is it to have an escalator to the gym? Humane technology should …

Visual of Humanthesizer


The human body as an instrument is a cool example of how culture and nature are merging. Calvin Harris used a giant human synthesizer to perform his single. The material used is …

Visual of Is the Human Body Redundant?

Is the Human Body Redundant?

The increasing ‘liveliness’ of machines and accessibility to the virtual world has raised questions about whether it is possible to uncouple the mind from the body in through a …

Visual of The Soft Touch of a Human Hand

The Soft Touch of a Human Hand

Nissan’s Engineers Are Creepily Trying To Replicate Human Skin

Visual of Save the Humans - Call for Quotes

Save the Humans - Call for Quotes

For our new book "Save the Human" we invite you to submit quotes that question the autonomy of mankind in the digital computer era and study the future of the independent creative spirit.

Visual of Living on Water for a Sustainable Planet

Living on Water for a Sustainable Planet

Company Blue Frontiers wants to build 7.500 square meters of floating city made up of linked platforms, starting 2018. They hope to complete it by 2020.

Visual of Robotization Makes Work More Human

Robotization Makes Work More Human

Imagine being 16 and studying for a job that soon won't exist. What kind of future is that? New occupations will come thanks to robotization.

Visual of Q: How will a technology enter the human habitat?

Q: How will a technology enter the human habitat?

This question is an excerpt from the Pyramid of Technology toolkit In the late nineties, the Tamagotchi egg was released. A small egg-shaped device that contained a digital …

Visual of Fight climate change: Hack the Planet

Fight climate change: Hack the Planet

Lots of clouds this week. The peculiar picture above shows the eruption of mount Pinatubo in 1991, which apparently resulted in a certain amount of global cooling (next to some …

Visual of Incredibly Shrinking Humanity

Incredibly Shrinking Humanity

Arne Hendricks thinks we can solve the ecological crisis by shrinking every human on earth to 50cm tall: #powershow

Visual of Transgenic Jell-O, more human than ever!

Transgenic Jell-O, more human than ever!

The American Chemical Society has announced a new method of producing gelatin that sounds like good news for cannibals and the canni-curious. Researchers are able to create …

Visual of Internet Traffic is now 51% Non-Human

Internet Traffic is now 51% Non-Human

So you thought the Internet was made by and for people? Think again. A study by Incapsula , a provider of cloud-based security for web sites (mind you where this data comes from), …

Visual of Watch Out Whales, Humans Want Your Krill

Watch Out Whales, Humans Want Your Krill

Krill, those tiny members of the ocean's planktonic community, have an importance disproportionate to their size. They are a vital food for whales, penguins and increasingly, …

Visual of A Brief History of Humankind

A Brief History of Humankind

Historian Yuval Noah Harari takes us on a journey through the whole human history.

Visual of GM Pigs for Animal-to-Human Organ Transplant

GM Pigs for Animal-to-Human Organ Transplant

Scientists have been trying to develop GM pigs that could be used to solve the shortage of organs for transplant patients.

Visual of What if Humans Disappeared?

What if Humans Disappeared?

What could happen if humans would just disappear?

Visual of A Map of Mars for Regular Humans

A Map of Mars for Regular Humans

If we'll ever get to go to Mars as tourists , we wouldn't get lost. Ordnance Survey , the official British mapping agency, recently released a new detailed map of the Red Planet. …

Visual of 1537 - Homunculus: the Semi-Human

1537 - Homunculus: the Semi-Human

In 16th and 17th centuries, some medical theory believed that a miniature human body can be produced in a flask by an alchemist.

Visual of Hybrid Carp with human face

Hybrid Carp with human face

I never expected anthropomorphobia to be evoked by a fish! This hybrid species fish was born between a carp and a leather carp in the pond of a personal house in Chongju. Each of …

Visual of Pimp My Planet

Pimp My Planet

"We live in a time where everything or everyone can be upgraded or ‘pimped'. After the worldwide acceptance of plastic surgery, it was time to subject our worldly possessions …

Visual of The Human LED screen

The Human LED screen

All living creates produce light by default, so do humans . Now researchers from US, China, Korea and Singapore collaborated have collaborated in order to create ultra-thin …

Visual of Chrysler Looks to Human Lungs for a Better Gas Tank

Chrysler Looks to Human Lungs for a Better Gas Tank

Alveoli in human lungs serve as the inspiration for designing better, stronger ways of storing compressed natural gas.

Visual of Did Forks Really Give Modern Humans an Overbite?

Did Forks Really Give Modern Humans an Overbite?

The food writer Bee Wilson, author of Consider the Fork , has put forth a surprising theory about forks and teeth that has received widespread online coverage. According to …

Visual of All Humans Piled Together Are So Tiny

All Humans Piled Together Are So Tiny

All humans on Earth put together are not enough to fill the Grand Canyon. We are so small yet so present.

Visual of Human Workers Get Increasingly Obsolete

Human Workers Get Increasingly Obsolete

Robots are coming to replace humans at work, are they a real threat to the world’s unemployed?

Visual of A Modest Future for Humanity

A Modest Future for Humanity

Three minutes in the mind of Juan Enriquez, director of Synthetic Genomics.

Visual of Jazz-Playing Robot Challenges Human-Computer Interactions

Jazz-Playing Robot Challenges Human-Computer Interactions

A musical robot able to improvise a jazz solo in response to an actual person performing jazz.

Visual of Human Cloning Now Possible in China

Human Cloning Now Possible in China

Is human cloning here? Chinese scientist is ready to clone people at his ‘replication factory’.

Visual of AI Defeats Human at Go

AI Defeats Human at Go

Go world champion Ke Jie has lost two games of 'Go' against Google's DeepMind AI system AlphaGo.

Visual of Biopresence - Human DNA Trees

Biopresence - Human DNA Trees

Imagine a graveyard without tombstones, instead there are growing trees that contain genetic material of the deceased people burried there. Biopresence creates Human DNA trees by …

Visual of Radio controlled human

Radio controlled human

Think of this sonic vibe-technology inside any MP3 player ;)

Visual of Next humans

Next humans

What will the human race look like in 1, 2, 3, 4 million years? Will it be one human race? Will there be a human race? Impressions of future scenario's must come from scientists, …

Visual of Pencils made from cremated humans

Pencils made from cremated humans

Artist Nadine Jarvis fabricates pencils from carbon left over of cremated humans -- it's part of a larger "research project into post mortem." She notes that "240 pencils can be …

Visual of Human genome sequencing soon child play?

Human genome sequencing soon child play?

Starting next spring, a complete human-genome sequence can be ordered the Californian startup Complete Genomics for just $5,000, Techreview reports. Currently sequencing still …

Visual of Human Nature as Pathology

Human Nature as Pathology

Modern society seems to have transformed human nature into a pathology. Our emotions are controlled by drugs. We are forced to operate within a narrow bandwith of what are …

Visual of Human garbage can

Human garbage can

Anthropomorphobic object of the week. Created by Sarah Hatch .

Visual of The Human Printer

The Human Printer

For a while now printer ink is probably the most expensive liquid per litre on earth. Still we need our images so badly that we accept this fact. The Human Printer manages to make …

Visual of Web Access Is A Basic Human Right

Web Access Is A Basic Human Right

"It's time to recognize the Internet as a basic human right" its inventor Sir Tim Berners-Lee has said.

Visual of 20k human chip

20k human chip

AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …

Visual of Fractalary: Fractals from Planet to Atoms

Fractalary: Fractals from Planet to Atoms

I think all Nature has a fractal structure, from Planet to Atoms. Website: Fractalary: Fractals from Planet to Atoms

Visual of Human animal hybrid

Human animal hybrid

This peculiar, half-human creature could be your cousin. No really; it is a sculpture by Patricia Piccinini entitled The Young Family , which, in turn, is part of a larger …

Visual of Mapping the human desire to be touched

Mapping the human desire to be touched

Fleshmap touch investigates the collective perception of erogenous zones. Hundreds of people ranked how good it would feel to touch or be touched by a lover in different points of …

Visual of Human Augmentation™

Human Augmentation™

As a gamer, I come across many visions of possible futures. But this trailer from the upcoming video game Deus Ex: Human Revolution , the third part in the Deus Ex series shocked …

Visual of Trading Humans for Trading Algorithms

Trading Humans for Trading Algorithms

The economic system and profit motive has been a driving force that steers and even dictates social change. Investors and stockbrokers have been a major influence to these social …

Visual of Who Needs Real Humans? Not H&M

Who Needs Real Humans? Not H&M

Clothing giant H&M no longer uses real humans in its online catalog. The company has admitted that it pastes real models' heads on computer-generated bodies. At least there's …

Visual of #10: Enhance Human Experience, Don’t Replace it

#10: Enhance Human Experience, Don’t Replace it

Part 10 in the 11 part series Anthropomorphism and Design . The hidden danger with interactive products is that they will become so good at fulfilling our needs that they start to …

Visual of Beluga Whale makes Human-like Sounds

Beluga Whale makes Human-like Sounds

Researchers in the US have been shocked to discover a beluga whale whose vocalisations were remarkably close to human speech.

Visual of Human Barbie

Human Barbie

Just when you thought the  Second Life  hype was long gone, meet Ukrainian body artist Valerie Lukyanova who aims to turn Second Life into First Life. They call her the Human …

Visual of Lego Minifigs Will Take Over The Planet By 2019

Lego Minifigs Will Take Over The Planet By 2019

Imagine the devastation when there are more Lego minifigs on Earth than humans...

Visual of The Human Hamster Wheel Desk

The Human Hamster Wheel Desk

The Human Hamster Wheel Desk is the latest result of workspace evolution. Office work has domesticated us!

Visual of Hacking Human Cells to Use Solar Power

Hacking Human Cells to Use Solar Power

A new biotech startup seeks to hack our cells to use solar energy instead of carbon and oxygen.

Visual of Human-Like Robot Makes Freaky Joke About the Future of Mankind

Human-Like Robot Makes Freaky Joke About the Future of Mankind

To thread the uncanny valley is a conscious choice for many artists and enthusiasts, as a means to evoke, through their work, powerful emotions, thoughts and everything in between.

Visual of Musical Journey Through the Human Body

Musical Journey Through the Human Body

De Motu is an interactive music app that let you experience your body through music and influence the sound with your own body.

Visual of The Complex Networks of Our Planet

The Complex Networks of Our Planet

This video by Nature explains the complexity of networks on our planet.

Visual of The Human Smart Home Assistant

The Human Smart Home Assistant

Artist Lauren McCarthy launched a project called LAUREN in which she embodies a eponymous human smart home assistant.

Visual of Human Nature, designing the equilibrium with Koert van Mensvoort

Human Nature, designing the equilibrium with Koert van Mensvoort

Under the title Human Nature, designing the equilibrium, eleven designers will answer questions about a future in which Humankind and Nature enter into a new relationship. An …

Visual of First human CRISPR trial in the US aims to cure inherited blindness

First human CRISPR trial in the US aims to cure inherited blindness

Gene editing is advancing at a faster pace than most of us can keep up with. One significant recent announcement was gene editing tool CRISPR’s application to non-genetic diseases …

Visual of Five ways AI could make your car as smart as a human passenger

Five ways AI could make your car as smart as a human passenger

Driving long distances without a passenger can be lonely. If you’ve ever done it, you might have wished for a companion to talk to – someone emotionally intelligent who can …

Visual of NOT (Natural) AND NOT (mechanical) = human

NOT (Natural) AND NOT (mechanical) = human

Eric Hoffer (1902-1983) You dehumanize a man as much by returning him to nature - by making him one with rocks, vegetation, and animals - as by turning him into a machine. Both …

Visual of Human Tetris

Human Tetris

A tribute to the virtual world boomeranging back to the physical world by Mega64 . Or do you rather prefer the corny japanese gameshow version? Via Engadget ,

Visual of Human body farm

Human body farm

Why not use the human body to grow products for the medical industry? The designer Michael Burton envisions Future Farm where the body is used as a farm to cultivate clinical and …

Visual of Human Landscape

Human Landscape

Our peculiar image of the week was created by artist Levi van Veluw , who reinvents the classical fine art of landscape painting, by moving from the traditional 'oil on canvas' to …

Visual of Mirror Neurons – Simulation at the basis of Human Civilization

Mirror Neurons – Simulation at the basis of Human Civilization

Within our society, imitation and simulation are typically seen as inferior symbols of a distorted mediated culture – think of fake Rolexes, plastic Christmas trees, silicone …

Visual of The Human Construction of Gay Animal Culture

The Human Construction of Gay Animal Culture

Much attention has recently been devoted to 'gay' animals. It's not the fact that many species have enthusiastic homosexual lives that should be surprising – there are convincing …

Visual of Hi, a Real Human Interface

Hi, a Real Human Interface

By Multitouch Barcelona , via Trendbeheer .

Visual of Rule #8: Use Human Ethics

Rule #8: Use Human Ethics

Part 8 of the 11 part series Anthropomorphism and Design .  Anthropomorphic products blur the boundaries between products and people. Ethical norms for people don’t usually apply …

Visual of Book as Human-Computer Interface

Book as Human-Computer Interface

In combining the classic feeling of handling a book with the interactivity of the computer, Waldek W?grzyn of the Academy of Fine Arts in Katowice, Poland, has created a new human-computer interface.

Visual of Computer Algorithms Are Already Replacing Human Journalists

Computer Algorithms Are Already Replacing Human Journalists

Will writing software eventually replace journalists?

Visual of Maya YogHurt: Fermented Drink Made with Human Lactic Acid

Maya YogHurt: Fermented Drink Made with Human Lactic Acid

Artist Maja Smrekar modified yeast with her own DNA to produce human lactic acid.

Visual of World's Worst Job? Being a Human Robot at Amazon's Fulfillment Center

World's Worst Job? Being a Human Robot at Amazon's Fulfillment Center

Workers are completely controlled by algorithms in Amazon's fulfillment center

Visual of Humans Need Not Apply

Humans Need Not Apply

Warning, this video on the impact of automation on human labor might cause you to re-plot you professional career.

Visual of Human LCD

Human LCD

New media technology from South Korea: a gigantic human display compiled from supporters cheering their soccer teams . One pixel per supporter. See also: Skyscreen , A4 e-paper .

Visual of 1 Whole human

1 Whole human

Peculiar product of the week. Found at.

Visual of Planet Earth - Inversed

Planet Earth - Inversed

Peculiar image of the week. By Vladstudio

Visual of One Generation in, Dolphins Still Transmit Human Tricks

One Generation in, Dolphins Still Transmit Human Tricks

Dolphins in Port Adelaide, Australia, have been observed performing a remarkable trick : tail-walking, a trait so rare it has only been seen in the wild one other time. More …

Visual of Cake Made from Human Skin

Cake Made from Human Skin

Cake or death? Cake! The Slice cake is a (vegetarian) vision of the forms lab-grown meat may take in the future.

Visual of If Barbie Had Human Proportions

If Barbie Had Human Proportions

What does Barbie look like when she has the proportions of a normal 19-year-old?

Visual of Technology Made us Human

Technology Made us Human

Buckle up for a cinematic espresso shot from performance philosopher and NNN ambassador Jason Silva.

Visual of Human Artist Hatches Ten Chicken Eggs

Human Artist Hatches Ten Chicken Eggs

French performance artist hatches 10 hen's eggs in Palais de Tokyo.

Visual of New AI Model Can Mimic Any Human Voice

New AI Model Can Mimic Any Human Voice

Lyrebird is an AI model capable of synthesizing anyone’s voice from just a one-minute audio sample.

Visual of Human Furniture

Human Furniture

This unpractical yet not less pretty anthropomorphic furniture piece was created by photographer David Blazques . We are clueless on whether it is in permanent use, yet it serves …

Visual of Human-Shaped Power Lines

Human-Shaped Power Lines

Just a project for now, but a far more creative way to deal with unsightly public works than tree-shaped antennas.

Visual of Lucas Foglia's photography explores the uneasy relationship between humans and nature

Lucas Foglia's photography explores the uneasy relationship between humans and nature

There’s no place on earth untouched by human activity: This was clear as Lucas Foglia whizzed across the vast, white expanse of Alaska's Juneau Ice Field last summer. He was …

Visual of Explore your relationship with AI in this exhibition

Explore your relationship with AI in this exhibition

What makes us human? And why do we sometimes fear artificial intelligence? And what about technological singularity - the moment in time when artificial intelligence outperforms …

Visual of Interview Mark Wigley:

Interview Mark Wigley: "We are living in an ecology of antenna"

With the invention of the radio antenna in the late 19th century, we became a different species: Introducing the human insect. A species, able to communicate across oceans using …

Visual of Colonizing Mars: Not with humans, but plants

Colonizing Mars: Not with humans, but plants

The idea of colonizing Mars has become the big speculative future of humanity on Earth. But, artist Alexandra Daisy Ginsberg has radically different ideas to contribute to the …

Visual of Anthropomorphobia


Are you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …

Visual of Curator Gène Bertrand on design for human needs

Curator Gène Bertrand on design for human needs

Nature has always been a source of inspiration for many artists and designers, yet the urgency to connect to nature is more pressing than ever. Environmental issues such as …

Visual of I Want Wings!!!!!!!!!!!!!!

I Want Wings!!!!!!!!!!!!!!

Read Nicholas Carr's essay on the transhumanist dream of having wings.

Visual of Interview: Bruce Sterling on the Convergence of Humans and Machines

Interview: Bruce Sterling on the Convergence of Humans and Machines

We had the honor of hosting Bruce Sterling in our Next Nature Network headquarters to talk to him about the concept of the convergence of humans and machines.

Visual of Interview: Agi Haines, Speculative Artist Who Wants to Redesign the Human Body

Interview: Agi Haines, Speculative Artist Who Wants to Redesign the Human Body

Speculative designer Agi Haines' work focuses on (re)designing the human body, and speculates upon future scenarios.

Visual of Next Generation: AI meets human creativity in Sofia Crespo's Neural Zoo

Next Generation: AI meets human creativity in Sofia Crespo's Neural Zoo

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here?  Get in touch …

Visual of Interview: Floris Kaayk, the Visionary Creative Mind Behind Human Birdwings

Interview: Floris Kaayk, the Visionary Creative Mind Behind Human Birdwings

Floris Kayak discusses online hoaxes and the future of technology.

Visual of Bio-Printer Creates Living Body Parts

Bio-Printer Creates Living Body Parts

Bioprinter creates bespoke lab-grown body parts for transplant.

Visual of Did Booze Make Us Modern?

Did Booze Make Us Modern?

A psychiatrist argues that beer gave us civilization - but do intoxicants play a deeper evolutionary role than that?

Visual of Next Generation: VR creator Bas Jansen asks, is there a place for humans?

Next Generation: VR creator Bas Jansen asks, is there a place for humans?

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here?  Get in touch  and …

Visual of Cyborgnest: redefining human senses

Cyborgnest: redefining human senses

Nature provided humans with an extensive set of sensory modalities, allowing our brain to constantly gather sundry inputs from the outer world. These sensory inputs help us …

Visual of The future infrastructure of the blockchain might be green and humane

The future infrastructure of the blockchain might be green and humane

The connection we share through the Internet has laid the foundation for a whole new digital infrastructure, in which blockchain technology is heralded by many believers for being …

Visual of This expo confronts a planet in a state of emergency

This expo confronts a planet in a state of emergency

Meet the 'Eco-Visionaries' , these are the architects, artists and designers who respond to some of the most urgent ecological issues of our times. This exhibition reveals how …

Visual of Space Television Network

Space Television Network

Sen is a space television network that provides visuals from other planets in order to prepare us for our multi-planetary life.

Visual of The Biggest Impact on the Planet Comes from Household Consumption

The Biggest Impact on the Planet Comes from Household Consumption

New study suggests that the real environmental problem is embodied in the things we buy.

Visual of Technology: Intrusive or Supportive?

Technology: Intrusive or Supportive?

Is the use of personal devices becoming a replacement for the spectrum of emotions that make us all humans?

Visual of A digital twin of the Earth could make the planet climate-neutral

A digital twin of the Earth could make the planet climate-neutral

While Elon Musk may be trying to initiate efforts to colonize Mars, scientists on Earth are attempting to build an accurate digital twin of the planet to simulate in the future. …

Visual of We Are more Bacteria than Human

We Are more Bacteria than Human

Our bodies are microbiomes, suffering from our habit of cleanliness.

Visual of Beijing's dust storm: part humans, part nature

Beijing's dust storm: part humans, part nature

The skies in Beijing turned orange recently, thanks to what was widely reported as a massive sandstorm . The problem, at least in terms of public health, is that it was not …

Visual of An Edible Drone for Humanitarian Aid

An Edible Drone for Humanitarian Aid

Nigel Gifford is developing a drone that will be relatively inexpensive, disposable and edible.

Visual of Ouroboros Steak: Producing meat using human cells

Ouroboros Steak: Producing meat using human cells

You are what you eat; a quite common message in the midst of our self-growth society. We have to eat well to become the best version of ourselves - more productive, healthier …

Visual of Controlling Human Odour

Controlling Human Odour

The ultimate personal hygiene product, feces odor tablets, is another Japanese innovation sold by the Takano Yori Beauty Clinic . These pills promise to make your excrement …

Visual of More People Are Too Fat Than Too Thin

More People Are Too Fat Than Too Thin

For the first time in history the world population counts more people who are too fat than too thin.

Visual of Watch: BBC reports on world's first artificial womb for humans

Watch: BBC reports on world's first artificial womb for humans

Now that the team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …

Visual of Human Swarms

Human Swarms

A video showing a small intersection in India. It's hypnotic .

Visual of The World Without Technology

The World Without Technology

I remember the smoke the most. That pungent smell permeating the camps of tribal people. Everything they touch is infused with the lingering perfume of smoke – their food, …

Visual of Should we clone Neanderthals?

Should we clone Neanderthals?

If Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …

Visual of Time Between Emergence and Design

Time Between Emergence and Design

Previously, experiences of time emerged from nature as given – offering seasons, the rhythm of humans, plants and animals. Nowadays, people integrate nature-time, body-time, inner-time, clock-time, and global 24/7 systems-time. Human beings, in past, current and next natures, have to deal with emergence and design of time in order to survive.

Visual of An Ecstatic Dialogue with Richard Doyle

An Ecstatic Dialogue with Richard Doyle

When techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …

Visual of A Stroll Through the Bubbles of Chemicals and Men

A Stroll Through the Bubbles of Chemicals and Men

A stunning pre-history of the anthropocene

Visual of Next Generation: Exploring the vegetal cyborg with Marie Declerfayt

Next Generation: Exploring the vegetal cyborg with Marie Declerfayt

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here?  Get in touch  and …

Visual of Hello, superorganism

Hello, superorganism

When I was a kid, my parents took me to the beach every summer. We’d swim in the ocean and play on our inflatable raft in the surf. When the tide was low, I’d build a sand castle …

Visual of From Eco-Apartheid to Earth Democracy

From Eco-Apartheid to Earth Democracy

Do humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.

Visual of Ecology – A New Opium for the Masses

Ecology – A New Opium for the Masses

Marxist philosopher Slavoj Žižek discusses the 'naturalization' of capitalism and how ecology became a new field of capitalist investment. He also argues that the ultimate …

Visual of Towards a global society as a superorganism

Towards a global society as a superorganism

Today we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …

Visual of Intimate Technology: the Battle for Our Body and Behaviour

Intimate Technology: the Battle for Our Body and Behaviour

Technology is nestling itself within us and between us, has knowledge about us and can act just like us.

Visual of Next Nature Interview

Next Nature Interview

For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …

Visual of Pyramid of Technology: How technology becomes nature in seven steps

Pyramid of Technology: How technology becomes nature in seven steps

How technology becomes nature in seven steps

Visual of The Anthropocene Explosion

The Anthropocene Explosion

We have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.

Visual of Next Nature Introduction

Next Nature Introduction

This project - the Next Nature Network - is about Nature's brand image. One might surmise that "Nature," being 100 percent all-natural, can't have any brand image.  The facts …

Visual of It could be time to start thinking about a cybernetic Bill of Rights

It could be time to start thinking about a cybernetic Bill of Rights

Like it or loathe it, the robot revolution is now well underway and the futures described by writers such as Isaac Asimov , Frederik Pohl and Philip K. Dick are fast turning from …

Visual of Yes, Naturally

Yes, Naturally

The introductory essay from the Yes, Naturally book - available in our store!

Visual of Interview: Curator Ilari Laamanen on Momentum9, the Nordic Biennial

Interview: Curator Ilari Laamanen on Momentum9, the Nordic Biennial

We recently spoke to Ilari Laamanen, to peel the outcrops of Momemtum9, and unveil the overlapping themes to the next nature philosophy.

Visual of Technosphere outweighs the biosphere

Technosphere outweighs the biosphere

Our deficiencies have always driven us, even among our distant ancestors, back in the last Ice Age. Having neither the speed and strength to hunt large prey, nor sharp teeth and …

Visual of The Coronation

The Coronation

For years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …

Visual of The Uncanny Valley of the Pussycat Dolls

The Uncanny Valley of the Pussycat Dolls

Make no mistake, you're not looking at the latest Barbie line: These are the The Pussycat Dolls. Formerly an LA stripper show burlesque show, now upgraded to be pop music …

Visual of Microbiocene: A microbiological archeology of the future

Microbiocene: A microbiological archeology of the future

In configuring our next nature, artists and scientists explore new languages that move beyond the Anthropocene - the era of human beings. These semantics would bridge the gap …

Visual of In conversation with cyborg musician Kai Landre

In conversation with cyborg musician Kai Landre

What does the merge of bodies and technology mean for the human? For cyborg Kai Landre, cybernetic extensions become body parts and not technology. Kai began his transition to a …

Visual of Nurturing Architecture

Nurturing Architecture

The way we currently build is not sustainable. We will have to develop a sustainable living environment that matches our human needs, intuitions and potential.

Visual of ‘Optimism is our duty’: A conversation with Koert van Mensvoort

‘Optimism is our duty’: A conversation with Koert van Mensvoort

We live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …

Visual of In conversation with cyborg choreographer Moon Ribas

In conversation with cyborg choreographer Moon Ribas

If we could extend our senses in order to perceive the planet in a deeper way, would our understanding and our behavior towards it be different? We caught up with cyborg …

Visual of The Playboy Interview

The Playboy Interview

In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …

Visual of Love your monsters

Love your monsters

Why we must care for our technologies as we do our children.

Visual of Could Biomimicry Help us Solve the Refugee Crisis?

Could Biomimicry Help us Solve the Refugee Crisis?

From nutrients within an organism, to organisms within collectives, to populations within a territory and so on - nature offers models on how to deal with highly complex systems.

Visual of Can microbes communicate with alien species?

Can microbes communicate with alien species?

Are we alone in the universe? The famous Seti (Search for Extraterrestrial Intelligence) programme has been trying to answer this question since 1959. American astronomer Carl …

Visual of Ancient Man Impacted Environment Already

Ancient Man Impacted Environment Already

The human environmental impact on our planet is hardly underestimated nowadays. Scientist agree humans are to blame for Global Warming – some are already dreaming up scenario’s of …

Visual of Totem Animals for the Anthropocene

Totem Animals for the Anthropocene

Invasive species become the animal symbols for a man-made world.

Visual of Next Generation: Get to know Valerie Daude

Next Generation: Get to know Valerie Daude

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of Moral Shortcomings in the Technology Debate

Moral Shortcomings in the Technology Debate

Digital and genetic techniques increasingly influence life. Our belief in progress through technology stands in the way of a moral debate on this development. By Rinie van Est We …

Visual of The Biosphere Code Manifesto

The Biosphere Code Manifesto

During the event The Biosphere Code, Stockholm University researcher Victor Galaz and colleagues outlined a manifesto for algorithms in the environment.

Visual of To decarbonize flying, we need biofuels

To decarbonize flying, we need biofuels

While aviation accounts for 2.4% of all emissions from fossil fuel use globally, two-thirds of the sector’s warming effect depends on something other than its CO₂ emissions. And …

Visual of Meet the lungs of the sea: phytoplankton

Meet the lungs of the sea: phytoplankton

Phytoplankton are microscopic algae living throughout the ocean’s surface waters. They can’t swim and are at the mercy of the currents and tides. Despite their small size, …

Visual of Seeking Symbiosis

Seeking Symbiosis

Visual artist Heleen Blanken explores the complex relationship between people, nature and technology.

Visual of Can This Virtual World Save the Real One?

Can This Virtual World Save the Real One?

A Dutch artist designs a Utopian eco-socialist online society.

Visual of Next Nature and the Curse of Oil

Next Nature and the Curse of Oil

The next step is to embrace and celebrate how cultural artifacts are escaping control, becoming autonomous, and forming the “next nature”.

Visual of Interview: Liam Young on Speculative Architecture and Engineering the Future

Interview: Liam Young on Speculative Architecture and Engineering the Future

Interview with Liam Young on his work in speculative architecture, the future, and our role in nature as humans.

Visual of Getting rid of that bit of unspoiled green

Getting rid of that bit of unspoiled green

There it is. A hefty hen, with its head up high and its beak out. And a gigantic VR headset over its beady little eyes. What does this battery hen see? ‘An experience of a free …

Visual of An introduction to Biomimicry

An introduction to Biomimicry

The first time I explained biomimicry to a stranger was not in a talk or a workshop but in a big-box bookstore just after Biomimicry: Innovation Inspired by Nature had come out. I …

Visual of Next Generation: Hearing the first breath of Earth with Dora Lionstone

Next Generation: Hearing the first breath of Earth with Dora Lionstone

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of On the prehistoric origins of modern sexuality

On the prehistoric origins of modern sexuality

Let’s talk about the most controversial of "m words"—monogamy. And let’s have this conversation with in mind its prehistoric origins. Our modern picture of prehistoric societies …

Visual of Real Nature is not Green

Real Nature is not Green

At the edge of the woods along the motorway near the Dutch town of Bloemendaal, there stands a mobile telephone mast disguised as a pine tree. This mast is not nature: at best, it …

Visual of The 21th Century Paradigm

The 21th Century Paradigm

The history of art through the ages reveals a constancy that, by conscious or unconscious applications, provides us with an omnipresent correlation dealing with the …

Visual of Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture

Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture

Rachel Armstrong discusses living buildings, Venice's foundations, millennial nature and how to improve our future.

Visual of How climate fiction novels allow us to imagine possible futures

How climate fiction novels allow us to imagine possible futures

Every day brings fresh and ever more alarming news about the state of the global environment. To speak of mere “climate change” is inadequate now, for we are in a “ climate …

Visual of Why I'm turning my son into a cyborg

Why I'm turning my son into a cyborg

Imagine if everyone spoke a language that you don’t understand. It’s not a foreign language–it’s been spoken around you since the day you were born–but where as everyone else …

Visual of Next Generation: Exploring cybernetic ecologies with Marie Walker-Smith

Next Generation: Exploring cybernetic ecologies with Marie Walker-Smith

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of You Can Never Go Back To Nature

You Can Never Go Back To Nature

One of the arguments that environmentalists use against factory farming and burning fossil fuels is that these activities are "unnatural" or that they "go against nature." But …

Visual of Happy Earth Day!

Happy Earth Day!

Today we celebrate Earth day, here is why.

Visual of Counteracting Climate Change with Geoengineering

Counteracting Climate Change with Geoengineering

A respected astrobiologist argues that a radical new process called geoengineering might be the only way to save us from climate change.

Visual of How a museum encourages its visitors to examine their relationship with their environment

How a museum encourages its visitors to examine their relationship with their environment

Last month I had the opportunity to immerse myself in Tokyo’s newly opened digital art landscape, the Mori Digital Art Museum. The museum stands out for it enables virtual …

Visual of Next Generation: Pei-Ying Lin is cooking with viruses

Next Generation: Pei-Ying Lin is cooking with viruses

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here?  Get in touch  and plot your …

Visual of We Domesticated Ourselves

We Domesticated Ourselves

Our bodies are maps of our ancestor's social lives.  We evolved, physically and behaviorally, in incredibly complex social groups.  Such intense sociability may have favored the …

Visual of The Enlightenment Is Dead, Long Live the Entanglement

The Enlightenment Is Dead, Long Live the Entanglement

We humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.

Visual of How AI is reshaping electronic music

How AI is reshaping electronic music

The idea that AI can compose electronic music may sound a little off to people. It raises essential questions about creativity as a product exclusive to humans: can an AI be …

Visual of In conversation with Jalila Essaïdi

In conversation with Jalila Essaïdi

What do in-vitro human skin, spider silk and cow manure have in common? They are all unlikely materials that can cloth, protect and inspire humans, as realized by award-winning …

Visual of The AI Revolution Is On

The AI Revolution Is On

Steven Levy writes in Wired on the unexpected turn of the Artificial Intelligence revolution: rather than whole artificial minds, it consists of a rich bestiary of digital fauna, …

Visual of A.I. Can Guess Exact Locations of Images

A.I. Can Guess Exact Locations of Images

Google's PlaNet will be soon able to tell you where a photograph was taken by simply looking at its contents.

Visual of Conversation with Dutch Philosopher Bas Haring: Robot, Colleague or Foe?

Conversation with Dutch Philosopher Bas Haring: Robot, Colleague or Foe?

We talked with Bas Haring to discuss the conception, image and will of the robot. Read our conversation with him and update your ideas about robots.

Visual of Five must-see exhibitions before 2020

Five must-see exhibitions before 2020

A large-scale asian food market serving in vitro meat, a transatlantic expo on the future of nature and a travelling exhibition that explores our relationship with AI. These five …

Visual of What we can learn from 'The Social Dilemma'

What we can learn from 'The Social Dilemma'

Is social media ruining the world? Dramatic political polarization. Rising anxiety and depression. An uptick in teen suicide rates. Misinformation that spreads like wildfire. The …

Visual of Bacteria

Bacteria "R" Us

There is a domain of creatures that diffusively encircles an entire planet. There are so many of them that they occupy every conceivable ecological niche. Yet, despite their …

Visual of Further Incredibly Shrinking Man

Further Incredibly Shrinking Man

Artist Arne Hendriks gave a lustrous talk on the possibilities of downsizing humanity to better fit the earth.

Visual of Next What?

Next What?

In this essay, anti-civilization, anarchist philosopher John Zerzan critiques the concept of 'next nature.' He argues that rather than freeing us, our self-domestication through …

Visual of The Carnery - A Cultured Future with In Vitro Meat

The Carnery - A Cultured Future with In Vitro Meat

In vitro meat has the capacity to transform meat production as we know it, introducing an entirely new way of thinking about and interacting with food.

Visual of How AI and genomics will impact the future of making babies

How AI and genomics will impact the future of making babies

As if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …

Visual of When will the first baby be born in space?

When will the first baby be born in space?

When the first baby is born off-Earth, it will be a milestone as momentous as humanity’s first steps out of Africa . Such a birth would mark the beginning of a multi–planet …

Visual of Next Senses

Next Senses

Next Senses explores the unchartered territory of how we could experience the world with technology

Visual of Entryparadise


Written by Werner Lippert & Peter Wippermann, Curators of the Entryparadise exhibition (26/8 until 3/12, 2006, at Kohlenwäsche, Zollverein) Design is about to undergo a …

Visual of The NBIC Convergence: When Machines and Matter ‘Have Sex’

The NBIC Convergence: When Machines and Matter ‘Have Sex’

The Singularity , as popularized by Ray Kurtzweil, refers to a near term, theoretical time when machine intelligence greatly surpasses our own. At this point we will experience a …

Visual of Anthropo-scene #9: Sense, Sensors, Sensitivity

Anthropo-scene #9: Sense, Sensors, Sensitivity

Technology helps us understand the unfolding of the Anthropocene.

Visual of Artificial Light Threatens Pollination

Artificial Light Threatens Pollination

A recent study demonstrated how artificial light is a serious threat to plant pollination. It puts plant reproduction in danger, as well as the whole ecosystem.

Visual of Heart Repair with Spinach Leaves

Heart Repair with Spinach Leaves

Scientists developed a procedure to repair your heart with a spinach leaf.

Visual of Recharge! Sun for Your Brain Cells

Recharge! Sun for Your Brain Cells

A gadget called HumanCharger promises "the sun in your pocket" to give you energy, by beaming light through your ears.

Visual of People are less likely to turn a robot off if it asks them not to

People are less likely to turn a robot off if it asks them not to

A team of German researchers published  a study  earlier this week indicating people can be duped into leaving a robot turned on just because it “asks” them to. The …

Visual of Suzanne Lee wants to live in a sustainable material world. Built with biology, not oil

Suzanne Lee wants to live in a sustainable material world. Built with biology, not oil

Biotechnology is nearly as old as humanity itself. The food you eat and the pets you love? You can thank our ancestors for kickstarting the agricultural revolution, using …

Visual of What will the virus teach us about life?

What will the virus teach us about life?

We live in turbulent times. Thanks to science and technology, we are able to perceive our environment down to the atomic level. We can read DNA, manipulate cells, cut and paste …

Visual of Breaking Point?

Breaking Point?

John Zerzan, published in Green Anarchy issue #24 - Spring/Summer 2007 The rapidly mounting toll of modern life is worse than we could have imagined. A metamorphosis rushes …

Visual of Out of Control

Out of Control

The Made and the Born: Neo-Biological civillization, written by Kevin Kelly, excerpt from Out of Control : The New Biology of Machines, Social Systems and the Economic World, …

Visual of Robot’s Best Friend

Robot’s Best Friend

From chef, to nurse, and also lover. Get ready, a new generation of robots is going to invade our lives!

Visual of Designed to Survive Our Roads

Designed to Survive Our Roads

A road safety campaign in the Australian state of Victoria exposed an educational, yet confronting picture to raise awareness to the vulnerable human body on the road.

Visual of Interview: Mike Thompson and Susana Cámara Leret, Designers Exploring Alternative Ways of Thinking & Doing

Interview: Mike Thompson and Susana Cámara Leret, Designers Exploring Alternative Ways of Thinking & Doing

Interview with Mike Thompson and Susana Cámara Leret.

Visual of The Robots Are Coming!

The Robots Are Coming!

Robots are getting stronger and smarter every day. They are taking over our whole lives. How long will I have my job before a robot steals it?

Visual of Virtual Baby Acts and Looks Impossibly Real

Virtual Baby Acts and Looks Impossibly Real

A rosy-cheeked kid learns her first words, cries when her babysitter leaves, smiles when she’s happy, but she’s not real. BabyX is an AI research-in-progress by a company named Soul Machines.

Visual of Your Next Nature guide to Dutch Design Week 2018

Your Next Nature guide to Dutch Design Week 2018

Over time, our bodies, our food and our environment have become more and more subject to design. As designers, we hold the responsibility and have the unique chance to envision …

Visual of How animal filters unmask the estranged relation to our wild self

How animal filters unmask the estranged relation to our wild self

Would you like a dog snout, cat eyes or fluffy bunny ears? The choice is yours. Virtual selfie filters have become a widespread phenomenon on social media platforms such as …

Visual of Next Generation: Biophilic design with Daniel Elkayam

Next Generation: Biophilic design with Daniel Elkayam

This story is part of Next Generation, a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of The Coming World: Ecology as the new politics

The Coming World: Ecology as the new politics

In science fiction and popular science, 2030 is often suggested as the year in which our planet will run out of oil. Similarly, 2100 will be the year that, according to …

Visual of There's a new urgency for speculative design. Here's why

There's a new urgency for speculative design. Here's why

Pink chickens, synthesized tiger penises and salads grown from bodily fluids - how could they shape our future? In a Next Nature collaboration with the Gogbot Festival, the …

Visual of Next Generation: Louise Silfversparre illustrates the remains of the Anthropocene

Next Generation: Louise Silfversparre illustrates the remains of the Anthropocene

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Geodesign


We have identified eight key defining moments that tell the story of geodesign, from ancient insight to artificial intelligence.

Visual of Interview with a cyborg

Interview with a cyborg

Erich Berger has a 96 year old grandmother who is a cyborg. She features dentures, hearing aids, glasses, pace maker, a metal implant on the pinkie toe, and more. Quotes from the …

Visual of Innovative Nostalgia

Innovative Nostalgia

We humans simply feel more comfortable with technological change when it comes in a familiar form that refers to an existing and accepted object, habit, value, tradition or intuition.

Visual of Robots Taking Government Jobs

Robots Taking Government Jobs

Meet Amelia, the first robot to work along with human coworkers in a council job.

Visual of Untouched Nature Is Entirely Gone

Untouched Nature Is Entirely Gone

Researchers prove that pristine landscapes haven’t existed for thousands of years, therefore we should change or mindset before trying to save the planet.

Visual of Ecosexuality: Make the Biosphere Your Lover

Ecosexuality: Make the Biosphere Your Lover

Ecosexuality reconceptualizes our perspective on the biosphere by having consensual experiences with it.

Visual of The future of the ECO Coin

The future of the ECO Coin

How can we design a cryptocurrency for the better of humanity and ecology? In this last chapter of the crypto deep dive series , we will dissect two kinds of blockchain …

Visual of Welcome to the CRISPR baby world—here’s what you should know

Welcome to the CRISPR baby world—here’s what you should know

Last week, the gene editing world was hit by news the equivalent of a nuclear bomb. In a video on YouTube , Dr. Jiankui He at Southern University of Science and Technology in …

Visual of Maurizio Montalti talks nature’s cycle of life

Maurizio Montalti talks nature’s cycle of life

As modern humans, we are out of balance with our natural environment. With use of technology, we try to prolong our human lifespan and create materials that live longer than we …

Visual of How biotechnology could shape the future of product design

How biotechnology could shape the future of product design

Humans have been manipulating living things for thousands of years. Examples of early biotechnologies include domesticating plants and animals and then selectively breeding them …

Visual of How China is enjoying blue skies — thanks to the coronavirus

How China is enjoying blue skies — thanks to the coronavirus

Surrounded by greyness and with the air around you having a dusty, burnt taste; for a long time this is what it has been like to live in many of the world’s highly polluted …

Visual of NNN announces 2021-2024 plans: 'Hello, Superorganism'

NNN announces 2021-2024 plans: 'Hello, Superorganism'

With great pleasure we announce our plans for 2021-2024: ‘Hello, Superorganism’ . Our human presence has a huge impact on the planet; plastic in the oceans, climate change, mass …

Visual of Why physical distancing feels so unnatural to us

Why physical distancing feels so unnatural to us

For many people, the most distressing part of the coronavirus pandemic is the idea of social isolation. If we get ill, we quarantine ourselves for the protection of others. But …

Visual of A message from volcanic rocks

A message from volcanic rocks

Although it’s seductive to think of human beings as the dominant species on earth, many others play important roles too. Bacteria, insects, algae colonies, rocks and the …

Visual of What our Next Nature fellows are reading this summer

What our Next Nature fellows are reading this summer

We asked our fellows , those who dedicate their hearts and minds to explore the next nature and bring our goals and projects in the attention of a wider audience. From artists, to …

Visual of What our team is reading this summer

What our team is reading this summer

The Next Nature team explores how our technological environment becomes so omnipresent, complex, intimate and autonomous that it becomes a nature of its own. From life on mars, to …

Visual of Exploring Next Nature (2004)

Exploring Next Nature (2004)

The first essay ever written on Next Nature, published in Next Nature Pocket and in Entry Paradise, New Design Worlds . ( download pdf ) (German version: Erkundungen im Nächste …

Visual of A Society of Simulations

A Society of Simulations

An interviewer once asked Pablo Picasso why he paints such strange pictures instead of painting things the way they are. Picasso asks the man what he means. The man then takes out …

Visual of Ars Electronica Festival goes Next Nature

Ars Electronica Festival goes Next Nature

This years edition of the Ars Electronica festival , which has been hangout for international experts from the arts and sciences for almost three decades, focuses on the nature …

Visual of The Monsters We Deserve

The Monsters We Deserve

Recently, a video clip has been circulating the web that  purportedly shows a rabbit born earless due to the radiation at Fukushima. BoingBoing has a convincing take-down of the …

Visual of Interview: Arne Hendriks, Researcher and

Interview: Arne Hendriks, Researcher and "Father" of The Incredible Shrinking Man

Hendriks’s activity explores the positive transformative power of creative impulses and the importance of fundamental free scientific research.

Visual of The

The "Actroid" Lives in the Uncanny Valley

The Actroid robot holds clues for climbing out of the uncanny valley.

Visual of Personhood Status for Robots

Personhood Status for Robots

An "electronic personhood" for robots has been discussed in the European Parliament recently, raising big questions about equality, citizenship, legal and ironically, human rights for artificial intelligent machines.

Visual of Solar Powered Electric Cars

Solar Powered Electric Cars

The sun sustains our planetary system. Its energy fuels life. And in the future, the sun will also fuel our cars. That’s the premise of Dutch startup Lightyear, a startup specialized in solar powered electric cars.

Visual of Sophia: World's First Robot with a Citizenship

Sophia: World's First Robot with a Citizenship

Sophia the Humanoid, a human-like robot in appearance and mannerisms, was granted citizenship by Saudi Arabia and became the first robot with citizenship.

Visual of ReTuna: the Shopping Mall Selling Nothing but Recycled Products

ReTuna: the Shopping Mall Selling Nothing but Recycled Products

A Swedish shopping center is bucking the trend of mindless consumption. At the ReTuna Återbruksgalleria every product is made of recycled materials.

Visual of Next Nature book launch: here's what you missed

Next Nature book launch: here's what you missed

The new Next Nature book is here ! Next Nature fellows, ambassadors, members and newly interested people came together on the 4th of June to celebrate the book launch with a …

Visual of How a 6.000-year-old fruit fly gave us cheese

How a 6.000-year-old fruit fly gave us cheese

Historians often trace the dawn of human civilisation back 10,000 years, when Neolithic tribes first settled and began farming in the Fertile Crescent, which stretches through …

Visual of How future fashion could help us cope with isolation

How future fashion could help us cope with isolation

Today we cannot meet, touch or hug our loved ones. And while we all like the feeling of the touch of another human being, physical contact does not just feel nice, it is crucial …

Visual of Interview: Patricia Piccinini discusses her latest solo exhibition 'Embracing the Future'

Interview: Patricia Piccinini discusses her latest solo exhibition 'Embracing the Future'

Patricia Piccinini is an artist interested in the relationship between humans and non-humans, the natural and the artificial, science and storytelling. Working with silicone, …

Visual of Next Generation: Sheng-Wen Lo hears ultrasound waves like pets do

Next Generation: Sheng-Wen Lo hears ultrasound waves like pets do

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here?  Get in touch …

Visual of Why your pets can't spread the coronavirus

Why your pets can't spread the coronavirus

A Pomeranian dog in Hong Kong grabbed the international media’s attention this week after scientists found traces of coronavirus in the canine. Following confirmation that the …

Visual of How to design your future family

How to design your future family

Imagine a place called Reprodutopia. How would such a place look like?

Visual of Information Decoration: Our Environment as an Information Carrier

Information Decoration: Our Environment as an Information Carrier

Picture this: it's 40,000 years ago, and you are an early Homo sapiens. You are standing on the savanna. Look around you. What do you see? No billboards, no traffic signs, no …

Visual of Next Nature Movie #4: Blade Runner

Next Nature Movie #4: Blade Runner

Look around you and try to find the most natural thing in the room you are in now. It is you. Now, you wouldn’t be so sure in the apocalyptic Los Angeles of 2019 depicted in Blade …

Visual of Bulletproof Skin

Bulletproof Skin

Recent work of artist Jalila Essaïdi exemplifies of how science and art can meet and create meaningful inventions for society. Jalila Essaïdi used the spider silk produced by …

Visual of Can Life Be a Technology?

Can Life Be a Technology?

In 2009 the Initiative for Science, Society and Policy coined the phrase ‘living technology’ [1] to draw attention to a group of emerging technologies that are useful because they …

Visual of Man Flies Like a Bird

Man Flies Like a Bird

Some months ago we wrote about the dream of mechanical-engineer Jarno Smeets to fly like bird . Over the last few months Jarno worked steadily to materialize his dream. Today …

Visual of Post Natural Organisms of the EU

Post Natural Organisms of the EU

If you happen to be in the neighborhood you might want to drop by at the exhibition Post Natural Organisms of the European Union in Amsterdam. The small but delicate expo, curated …

Visual of Walter Benjamin on Film and the Senses

Walter Benjamin on Film and the Senses

During the late 1930’s the philosopher Walter Benjamin wrote its widely influential essay ‘The work of Art in the Age of Its Technical Reproducibility’. While describing a general …

Visual of Will Eugenics Become an Acceptable Strategy to Avoid Climate Change?

Will Eugenics Become an Acceptable Strategy to Avoid Climate Change?

Climate change is one of the biggest challenges of today and various scenarios, ranging from artificial trees , pollution trading , co2 capturing to geo-engineering, have been …

Visual of A Plan to Eliminate Predators

A Plan to Eliminate Predators

British philosopher David Pearce believes we should to stop animals from hunting and killing other animals.

Visual of Get Infrared Sight with a Vitamine Diet

Get Infrared Sight with a Vitamine Diet

Bio-hackers developed a protocol to augment human sight to see into the near infrared range.

Visual of Anthropo-scene #7: Anthropocene Bird

Anthropo-scene #7: Anthropocene Bird

Due to human action, 1300 bird species are seriously in decline. Other birds have learned to live with humans and profit from their presence.

Visual of Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society

Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society

We recently talk to Nadine Bongaerts about the role and impact of synthetic biology, the gap between bio­sciences and society and the importance of communication to overcome the fear of new technologies.

Visual of Watch out for Bullied Robots

Watch out for Bullied Robots

Dystopian future scenarios filled with evil robots are everywhere. We are afraid of robots treating us badly, but what will happen if it'll be the other way around? According to …

Visual of Interview: Leanne Wijnsma, Designer for the Instinct Who Uses Smell as Medium

Interview: Leanne Wijnsma, Designer for the Instinct Who Uses Smell as Medium

Dutch experience designer Leanne Wijnsma designs for the human instinct and puts the sense of smell back to where it belongs, as modern hazards have shifted to the digital realm.

Visual of ECO Coin Award Interviews: Shubhendu Sharma

ECO Coin Award Interviews: Shubhendu Sharma

We asked Shubhendu Sharm, our first ECO coin award nominee about his method, business and hopes for the future.

Visual of If you could have another sense, which sense would you choose?

If you could have another sense, which sense would you choose?

Color-blind artist Neil Harbisson designed a brain-implanted antenna that converts colors into sound. This enables him to hear colors he cannot see, and extends his vision to …

Visual of The world’s plastic problem is bigger than the ocean

The world’s plastic problem is bigger than the ocean

As you read this, a strange object that looks like a 2,000-foot floating pool noodle is drifting slowly through the central north Pacific Ocean. This object is designed to solve …

Visual of Exploring body architecture with Lucy McRae

Exploring body architecture with Lucy McRae

As evolution goes on, the human body is evolving too. What does it mean to be human in times of advanced biotechnology and genetic engineering? Are our bodies ready for our …

Visual of Next Generation: Why Annie Larkins' egg project is essential for future food thinking

Next Generation: Why Annie Larkins' egg project is essential for future food thinking

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of Living robots made from frog stem cells may revolutionize medicine

Living robots made from frog stem cells may revolutionize medicine

At just a millimeter wide, Xenobots are “neither a traditional robot nor a known species of animal", they are "a new class of artifact: a living, programmable organism”, says …

Visual of Next Generation: The speculative futures of Deborah Rhyner

Next Generation: The speculative futures of Deborah Rhyner

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of The new Next Nature book is here!

The new Next Nature book is here!

We live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …

Visual of Notes on the plastisphere

Notes on the plastisphere

Every piece of plastic that’s ever made, still exists. It results in a floating garbage dump in the ocean, full of life. While this (geo)design was never intentional, humans …

Visual of Deadline to save the World: 30th August

Deadline to save the World: 30th August

Picnic Green Challenge calls upon people like you to invent a product or service that can help to save the world. Restore the planet's harmony and lets you win 500.000 Euro on the …

Visual of Gel Remote

Gel Remote

Human-product relationships increasingly play out in a realm which was previously considered exclusive for human-human and human-animal relationships. Panasonic now redesigned one …

Visual of The Evolution of the Richer

The Evolution of the Richer

Are we on the verge of a future human evolution, one that isn’t, at least in it’s very core, “the survival of the fittest”, but rather “the evolution of the richer”? Think about …

Visual of How biotech will drive our evolution

How biotech will drive our evolution

Are you ready for some techno-optimism? Buckle up and enjoy the ride with bio-tech evangelist Gregory Stock . Some quotes from his prophetic TED talk : "We are seizing control of …

Visual of Suffering from Anthropomorphobia?

Suffering from Anthropomorphobia?

Anthropomorphobia is the fear of acknowledging qualities we wish to consider only human in non-human things. Sufferers from the condition used to have trouble mostly at fairs or …

Visual of Having Invented the Gods, Perhaps we can Turn into Them

Having Invented the Gods, Perhaps we can Turn into Them

My name is Jason Silva. I've spent the last 5 years hosting and producing a tv show on Al Gore's Emmy-winning Current TV network and I'm a fellow at the Hybrid Realities …

Visual of Disaster Edens: The Anti-Tourist Attraction

Disaster Edens: The Anti-Tourist Attraction

Imagine your cruise to the Galapagos came with a ghoulish warning: "Your hair will fall out, your skin will blister, you'll probably get cancer and your children's children might …

Visual of The Earth on Loan

The Earth on Loan

Christian Schwägerl is a correspondent for Der Spiegel and the author of Menschenzeit (The Age of Man). He will be presenting his views on the Anthropocene at the  Next Nature …

Visual of Lions Relocate to the Suburbs

Lions Relocate to the Suburbs

As cities push to the edges of the wilderness, wild animals are increasingly com

Visual of End of Life Care Machine

End of Life Care Machine

Designer, artist and engineer  Dan Chen has developed the ' End of Life Care Machine ', a machine designed to guide and comfort dying patients with a carefully scripted message. …

Visual of Nature is Dead, Long live Nature

Nature is Dead, Long live Nature

Like we did to old nature before, we must now cultivate our technological environment.

Visual of Anthropo-scene #1: From Rocks to Thoughts

Anthropo-scene #1: From Rocks to Thoughts

How geology and humanity turn ancient algae into high-tech gadgets.

Visual of Anthropo-scene #3: Morphing Earth, Piece by Piece

Anthropo-scene #3: Morphing Earth, Piece by Piece

Humans act as bio-excavators that literally move mountains.

Visual of GM Mosquitoes: No Olfaction, No Sting

GM Mosquitoes: No Olfaction, No Sting

Engineering mosquitoes to ignore the scent of human flesh.

Visual of Moments in Meat History Part I - Origins of Meat-eating and Hunting

Moments in Meat History Part I - Origins of Meat-eating and Hunting

About 4 or 5 million years ago, major changes in the Earth's climate brought about grassland regions where giant mammals could graze.

Visual of Diseases Of The Future

Diseases Of The Future

Nowadays humans suffer from diseases that didn't exist in the past, a trend that will probably continue into the future. A wide range of new disorders, especially related to the …

Visual of Electronic Skin can Detect Magnetic Fields

Electronic Skin can Detect Magnetic Fields

There is a new artificial skin technology that could give humans magnetoception in the future.

Visual of The Golden Quarter

The Golden Quarter

Some of our greatest cultural and technological achievements took place between 1945 and 1971. Why has progress stalled?

Visual of But will lab-grown meat be kosher?

But will lab-grown meat be kosher?

Read Benjamin Aldes Wurgaft's essay on judaism in relation to the production of laboratory-grown meat.

Visual of “Everything Is Already Invented”

“Everything Is Already Invented”

Robert Gordon says all the major inventions have been made, but that's only true for our limited knowledge of future possibilities.

Visual of From Homo Sapiens to Homo Optimus

From Homo Sapiens to Homo Optimus

We are entering an age of technological singularity, in which artificial intelligence and biological enhancement are combined in order to construct the next stages of human evolution.

Visual of Interview: Pauline Van Dongen, Designer Merging Fashion and Technology

Interview: Pauline Van Dongen, Designer Merging Fashion and Technology

Dutch fashion designer specialized in wearable technology, Pauline van Dongen researches the human body in relation to its surroundings.

Visual of Lunar Insurrection Vol.2: Harvest Moon

Lunar Insurrection Vol.2: Harvest Moon

Lunar Insurrection  is a group of architects that explores the creative possibilities of the moon as a potential territory for human activity and inhabitation. In  Vol.2 , their …

Visual of Fellow Day: Next Senses

Fellow Day: Next Senses

On June 17th a NNN Fellow Day was organized to explore the future project: Next Senses.

Visual of Racist Robots and Bloodthirsty Crowds

Racist Robots and Bloodthirsty Crowds

It took less than 24 hours for Twitter to corrupt an innocent AI bot and teach it morally repugnant things.

Visual of The Digital Mythology of... Super Mario

The Digital Mythology of... Super Mario

Mythology still surrounds us, we just relate to it differently. Games and movies have replaced pantheons and folk tales. Fairies and gnomes left the forests and the rivers and moved to virtual realities.

Visual of A Robot Will Spark the Next Avant-Garde

A Robot Will Spark the Next Avant-Garde

­­ “An illegal theme park exposing the ideology of the aesthetics of hacking”. “A hybrid drone targeting technological domination”. “A psychedelic fridge to raise doubt about fake …

Visual of Jobs for Creators - Robots at Work #2

Jobs for Creators - Robots at Work #2

Have a look at our series Robots at Work! In this episode we present you five jobs for creators, the ones that build with their hands.

Visual of Technosphere Weighs 30 Trillion Tons

Technosphere Weighs 30 Trillion Tons

If humans would disappear from the face of the Earth today, we would still leave 30 trillion tons of mass in the geological record. Certainly, "we were here" is written all over.

Visual of The Economy of Ecology

The Economy of Ecology

What if we could redesign the system to work for humanity and the planet we call home? What would the economy of ecology look like?

Visual of A happy birth day to Louise Brown

A happy birth day to Louise Brown

Dear Louise Brown, On behalf of the future I would like to congratulate you on your birthday. It has been 40 years that you where born into this world on July 25th 1978, …

Visual of I like my steak lab-grown, not-grass fed

I like my steak lab-grown, not-grass fed

Right now, somewhere in a laboratory in California, the Netherlands or Japan, a technician is taking a few thousand skeletal muscle cells from a living animal, and placing them in …

Visual of Interview: Designer Shahar Livne is geomimicing the future of plastics

Interview: Designer Shahar Livne is geomimicing the future of plastics

We sat down with Shahar Livne, an Israeli-born designer who graduated from the Design Academy in Eindhoven to talk about her vision on the future of plastics.

Visual of Your next doctor might just be a robot

Your next doctor might just be a robot

Conventional wisdom says that you can’t replace the human touch in terms of medical care, but in our rapidly changing technological environment, it appears that this perception …

Visual of Q: How will we co-evolve with technology?

Q: How will we co-evolve with technology?

This question is an excerpt from the Pyramid of Technology toolkit Cooking is a process through which humans outsource part of their bodily functions to technology (think …

Visual of The social animals that are inspiring new behaviors for robot swarms

The social animals that are inspiring new behaviors for robot swarms

From flocks of birds to fish schools in the sea, or towering termite mounds , many social groups in nature exist together to survive and thrive. This cooperative behaviour can be …

Visual of The religion named Artificial Intelligence

The religion named Artificial Intelligence

Would you pray to a Robot deity? A group of Japanese buddhists is already doing so. Meet Mindar , the robot divinity shaped after the buddhist Goddess of Mercy, also known as …

Visual of What is a species?

What is a species?

A koala bear isn’t actually a bear, it’s a marsupial. Whales aren’t fish, they’re mammals . Tomatoes aren’t vegetables, they’re fruit . Almost nothing is actually a nut . Peanuts, …

Visual of Interview Matilde Boelhouwer: Making urban environments flower again

Interview Matilde Boelhouwer: Making urban environments flower again

Matilde Boelhouwer is a designer whose work speculates between art, design, science, biology and food. Matilde shapes this obligation into a studio which mainly focuses on the …

Visual of Is in vitro meat good news for animals?

Is in vitro meat good news for animals?

The Singapore Food Agency has approved “chicken bites” containing meat made from real chicken cells that were grown outside of a chicken’s body. Alongside similar news from Israel …

Visual of Swiping is the new touching

Swiping is the new touching

From all the memes that have reached me through my screen since the outbreak of the corona pandemic, there is one that perfectly reflects my thoughts in the beginning of March …

Visual of Homo Desktopus

Homo Desktopus

A future physical anthropologist who knows nothing about the human race and would dig up a contemporary desktop computer, might conclude homo desktopus must have been the user of …

Visual of Deliver us from Skeuomorph Prosthetics

Deliver us from Skeuomorph Prosthetics

No, this is not another example in our fake for real series , comparing an artificial with a human hand. Rather, you are looking at twice the same hand: with and without its …

Visual of Hyperfins


The next step in biomimetic body extentions for propelling yourself through water. Man moves on from copying ducks to become a dolphin-like cyborg. With these fins you can be …

Visual of Wrapping Greenland

Wrapping Greenland

The Discovery series 'Ways to save the planet' the episode 'Wrapping Greenland ' shows how Dr. Jason Box uses reflective blankets to cover glaciers in Greenland. Due to global …

Visual of Ars Electronica 2010: Artists Adressing NextNature

Ars Electronica 2010: Artists Adressing NextNature

Sind wir noch zu retten? That was the slogan of this year’s Ars Electronica festival in Linz (Austria). Titled ‘REPAIR’, the media art festival urged to leave our scepticism and …

Visual of Razorius Gilletus – On the Origin of a Next Species

Razorius Gilletus – On the Origin of a Next Species

Is the evolution of the single bladed razor into an exorbitant five–bladed vibrating gizmo the outcome of human needs, or is there another force in play? Say hello to Razorius …

Visual of 11 Golden Rules of Anthropomorphism and Design: Introduction

11 Golden Rules of Anthropomorphism and Design: Introduction

Welcome to the 11 part series The Golden Rules of Anthropomorphism and Product Design. In this series, we will be examining how designers can better integrate human-like forms or …

Visual of Back to the Tribe

Back to the Tribe

Traditionally, technology is seen as a force that diminishes our instincts and puts us at a distance of nature. Increasingly however, we realize technology can also energize and …

Visual of Nintendo Portables Are Breeding Grounds For Sexy Fun

Nintendo Portables Are Breeding Grounds For Sexy Fun

Sexuality and sensuality are phenomena which have been a nature for us as long as we humans exist. Not only humans experience these phenomena; also animals experience sexuality …

Visual of System Animals

System Animals

What animal is so naive to come into this world as a naked and crying infant, completely vulnerable, helpless, and an easy prey for any predator? Newborn lamb or giraffe’s babies …

Visual of The Sound of the Blue Canary

The Sound of the Blue Canary

Blue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …

Visual of The Technological Sublime

The Technological Sublime

The sublime is an aesthetic concept of 'the exalted,' of beauty that is grand and dangerous. Through 17th and 18th century European intellectual tradition, the sublime became …

Visual of A More Interesting, More Depressing Theory of Easter Island's Downfall

A More Interesting, More Depressing Theory of Easter Island's Downfall

A new theory claims it wasn't human deforestation that caused the ecological collapse of Easter Island, but something smaller and squeakier.

Visual of Interview: Jason Silva, Media Artist and Curator of Awe-Inspiring Ideas

Interview: Jason Silva, Media Artist and Curator of Awe-Inspiring Ideas

Media artist, filmmaker and wonderjunkie Jason Silva talks about technological evolution and why humans are gods with anuses.

Visual of What Ant Colony Networks Can Tell Us About What’s Next for Digital Networks

What Ant Colony Networks Can Tell Us About What’s Next for Digital Networks

Ever notice how ant colonies so successfully explore and exploit resources in the world … to find food at 4th of July picnics, for example? You may find it annoying. But as an …

Visual of Gene-Edited Micropigs Will Be Soon Sold As Pets

Gene-Edited Micropigs Will Be Soon Sold As Pets

Earlier this year, a group of Chinese scientists published a paper about the modification of the genome of human embryos with the cutting-edge powerful technique called CRISPRs. …

Visual of Should Intelligent Sex Robots be Banned?

Should Intelligent Sex Robots be Banned?

The Campaign Against Sex Robots, recently launched, is pushing towards banning the continuation of sex robots development.

Visual of Meet Yangyang, Actroid From China

Meet Yangyang, Actroid From China

The humanoid robot Yangyang can function autonomously, talking and gesturing while interacting with people.

Visual of Plastivore – A Bird that Feeds on Plastic

Plastivore – A Bird that Feeds on Plastic

The speculative 'Plastivore' bird thrives on a diet of fungi and plastics.

Visual of Poem Passes the Turing Test

Poem Passes the Turing Test

Zackary Scholl developed a program to produce a poem that passed the Turing Test.

Visual of Should We Fear Thinking Machines?

Should We Fear Thinking Machines?

It seems thinking machines could put the human race in danger. How realistic these fears are?

Visual of Artificial Senses for Navigation

Artificial Senses for Navigation

A team of cyborgs and digital enthusiasts developed a wearable technology for the body that perceives a human sixth sense.

Visual of Empowered by Robots Event Report

Empowered by Robots Event Report

A report on the Empowered by Robots conference during DDW16, demonstrating fruitful collaboration between humans and robots.

Visual of The First Artificial Intelligent Lawyer

The First Artificial Intelligent Lawyer

There is an artificial intelligent robot called ROSS that is taking over the work of thousands of lawyers. Working non-stop, reading faster then any human attorney can do.

Visual of Augmented Biology: Growing Ears on Apples

Augmented Biology: Growing Ears on Apples

A promising way to grow body parts: using an apple.

Visual of Solar Energy: the Hottest New Currency

Solar Energy: the Hottest New Currency

Energy-backed money could help transition humanity to a more sustainable world, both environmentally and economically.

Visual of The Modular Body

The Modular Body

The Modular Body is an online science fiction story by Floris Kaayk about the creation of OSCAR, a living organism built from human cells.

Visual of 1932 -

1932 - "Brave New World" Published

Aldous Huxley published Brave New World in 1932, bringing the idea of the artificial uterus to the big audience.

Visual of Hire a Smart Robot

Hire a Smart Robot

What if your co-worker was a robot? Dutch startup Smart Robotics is a job agency for robots that allows you to hire a smart-robot.

Visual of A Truly Exotic Fruit: the Space Mango

A Truly Exotic Fruit: the Space Mango

Scientists sent mango embryos to space lab in order to let them develop new genetic traits.

Visual of How AI could revolutionize the teaching profession

How AI could revolutionize the teaching profession

In various parts of the world, access to education is, or risks becoming, a huge crisis. UNESCO estimates that around 20 million new teachers are needed worldwide - and that's not …

Visual of Call for projects: bring your groundbreaking creativity to tackle pressing energy issues

Call for projects: bring your groundbreaking creativity to tackle pressing energy issues

We need to change the way we power our daily lives. Burning fossil fuels is the primary cause of climate change, yet this is still our main source of energy. Much of this energy …

Visual of Custom-grown bones, and other wild advances in regenerative medicine

Custom-grown bones, and other wild advances in regenerative medicine

The human body has always been an incredible machine, from the grand feats of strength and athleticism it can accomplish down to the fine details of each vein, nerve, and cell. …

Visual of In Conversation with Marleen Hartjes: Introducing a digital door to the museum

In Conversation with Marleen Hartjes: Introducing a digital door to the museum

Don’t be surprised when you catch a human face on a screen strolling through the Van Abbe museum for contemporary art in Eindhoven, as these are Europe’s very first robotic …

Visual of This startup uses body heat to mine crypto

This startup uses body heat to mine crypto

While many love to speculate about the sheer number of jobs that robots and artificial intelligence are going to replace in the near future, no one seems to be coming up with any …

Visual of Air pollution may be making us less intelligent

Air pollution may be making us less intelligent

Not only is air pollution bad for our lungs and heart , it turns out it could actually be making us less intelligent, too. A recent study found that in elderly people living in …

Visual of This cool artificial reef was just deployed in Sydney Harbor

This cool artificial reef was just deployed in Sydney Harbor

Earth’s oceans have seen better days. They’re inundated with plastic waste, both whole single-use plastics and tons of plastic microparticles that find their way back into our …

Visual of How Pokemon are affected by climate change

How Pokemon are affected by climate change

You know climate change is real when dead coral Pokemon start to wash up on (virtual) beaches. Behold, Cursola, world’s first dead coral Pokemon. On the origins of Cursola While …

Visual of Why electric cars should be allowed to drive faster

Why electric cars should be allowed to drive faster

In response to the nitrogen crisis, the Dutch cabinet is planning to reduce the speed limit during the day to 100 kph. In itself a sensible decision. But it is strange that this …

Visual of 299 trees grow in a football stadium

299 trees grow in a football stadium

Some centuries ago landscape painters taught us to appreciate the quality of an untouched landscape. Ever since we have been doing everything to recreate it. We camouflage cell …

Visual of Discussing bio-based material experiences with Elvin Karana

Discussing bio-based material experiences with Elvin Karana

The world of design is in need of new materials that align with the urgency for sustainability. Issues such as climate change, plastic waste and harmful materials require us to …

Visual of In conversation with Studio Drift

In conversation with Studio Drift

A flock of drones that fly like birds, drifting blocks of concrete, a choreography of opening and closing flowers. The work of Studio Drift is challenging the distinction between …

Visual of The beginner's guide to biohacking

The beginner's guide to biohacking

What is the first thing that comes to mind when you hear the term 'biohacking'? Perhaps you are now thinking of a bunch of kids sitting in their kitchen with a DNA kit, (wannabe) …

Visual of How Amazon trees write their own autobiographies

How Amazon trees write their own autobiographies

Tropical forests are one of the world’s largest carbon stores and they help regulate the global climate. But they’re being erased at a terrifying rate. Deforestation claimed an …

Visual of (IM)POSSIBLE BODIES: Responsiblity and care in our cyborg future

(IM)POSSIBLE BODIES: Responsiblity and care in our cyborg future

What does it mean to become a cyborg? Better yet, aren't we cyborgs already? What then, does it mean to have a body? Is a 'standard' desirable, what does that even mean, and what …

Visual of POND: A symphony of lights and water

POND: A symphony of lights and water

Have you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …

Visual of ‘We All Parent Earth’

‘We All Parent Earth’

Last week I was strolling through the aisles of the supermarket when I heard a buzzing sound coming from my pocket. I looked up from my cart and saw it was a message from  …

Visual of Next Generation: Building Aquatecture with Shaakira Jassat

Next Generation: Building Aquatecture with Shaakira Jassat

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Cyborg mythologies #3: in god we trust, all others bring data

Cyborg mythologies #3: in god we trust, all others bring data

This is #3 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …

Visual of Welcome to New Evoluon

Welcome to New Evoluon

Today our human impact on Earth is humongous. Climate change, plastic oceans, mass urbanization and deforestation. Scientist recently calculated the technosphere now outweighs the …

Visual of The World is not a Desktop

The World is not a Desktop

Mark Weiser (originally written for ACM Interactions ). What is the metaphor for the computer of the future? The intelligent agent? The television (multimedia)? The 3-D graphics …

Visual of Faustian Bargains and Pineapple Shampoo

Faustian Bargains and Pineapple Shampoo

Since the early days of the net, the electronic pastoral has lent itself to all sorts of dubious agendas pushed by science, the military and even libertarian tendencies. In the …

Visual of Doggerland – Mapping a Lost World

Doggerland – Mapping a Lost World

So you think climate change is new? So you think the flooding of landmass by the oceans is a new? So you must have not heard of the times when people walked from London to …

Visual of Synthetic biology demystified

Synthetic biology demystified

:// The expanding research culture of synthetic biology demystified in this TV item on the International Genetically Engineered Machine competition . Via Posthuman …

Visual of ECO Currency – A Proposal to Balance Economical and Environmental Value

ECO Currency – A Proposal to Balance Economical and Environmental Value

Imagine we would have an alternative monetary currency for environmental value. Would the rain forest still be destroyed if there existed an ECO–currency to express its value and …

Visual of Self–Repairing Architecture

Self–Repairing Architecture

All buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …

Visual of Take your transgenic kids to the CPNH

Take your transgenic kids to the CPNH

The Center for PostNatural History doesn't house the dinosaurs or dioramas of your run-of-the-mill natural history museum. Instead, it's the first museum dedicated exclusively to …

Visual of Voodoo Phone

Voodoo Phone

Japanese professor Hiroshi Ishiguro from Osaka University has quite a track record of threading the uncanny valley. Remember his Doppelgänger Robot and Geminoid Female ? His …

Visual of Arne Hendriks – Incredible Shrinking Man

Arne Hendriks – Incredible Shrinking Man

Artist Arne Hendriks explores the possibilities and implications of downsizing the human species to better fit the earth.

Visual of Better Than Nature?

Better Than Nature?

At the turn of the millennium, miniaturized canines acquired the cherished status of living, designer handbag ornaments.  These teeny tiny photogenic doggies, which had been …

Visual of Better Walking with Robotic Legs

Better Walking with Robotic Legs

The Berkeley Robotics & Human Engineering Laboratory is researching a way to improve the performance of human bodies. They are doing innovative research in the field of …

Visual of Christian Schwägerl - Riding the Anthropocene

Christian Schwägerl - Riding the Anthropocene

Christian Schwägerl , freelance journalist and biologist, author of the book The Anthropocene: The Human Era and How It Shapes Our Planet , introduces us into the Anthropocene , a …

Visual of Monkeys Fall into the 'Uncanny Valley' Too

Monkeys Fall into the 'Uncanny Valley' Too

The uncanny valley, a phrase coined by Japanese robotic researcher Masahiro Mori nearly three decades ago, describes the uncanny feeling that occurs when people look at …

Visual of Artifice Earth: Adam Rutherford on the Promises of Synthetic Biology

Artifice Earth: Adam Rutherford on the Promises of Synthetic Biology

An interview about the history and promises of synthetic biology, and the problem with the word "nature".

Visual of Engineering Beneficial Parasites

Engineering Beneficial Parasites

Breeding parasites to improve immune function, skin tone and even resistance to poison.

Visual of Interview: Alexandra Daisy Ginsberg, Designer and Synthetic Biology Expert

Interview: Alexandra Daisy Ginsberg, Designer and Synthetic Biology Expert

An interview with Daisy Ginsberg, artist and synthetic biologist.

Visual of The Fence

The Fence

A satirical yet bona fide view on our changing relation with nature.

Visual of Beyond the Possible with Floris Kaayk

Beyond the Possible with Floris Kaayk

Floris Kaayk, artist and fictive documentaries maker, confronts us with the impossible.

Visual of Reducing Plastic Bags by 80%

Reducing Plastic Bags by 80%

The EU Commission will hopefully reduce the consumption of disposable plastic bags within 5 years by 80%.

Visual of The Power Amplification Robot

The Power Amplification Robot

Power Loader: the power amplification exoskeleton robot.

Visual of What’s the Point If We Can’t Have Fun?

What’s the Point If We Can’t Have Fun?

Since Darwin we tend to look at the biological world exclusively in economical terms. The idea that monkey's, frogs, or even ants do more than simply propagate, doesn't find much acceptance among scientists. And yet, even crayfishes at times seem to displace objects just for fun.

Visual of Anthropo-scene #10: From Thoughts to Geology

Anthropo-scene #10: From Thoughts to Geology

It's more than two years since I have started this exploration of the Anthropocene for Next Nature for you. We have visited many places together, places I have traveled to as a …

Visual of Drugs Testing with Artificial Organs

Drugs Testing with Artificial Organs

Researchers are working on artificial organs-on-chips will be used for drug development.

Visual of

"The End": a Virtual Opera Singer, Millions of Fans and the Meaning of Death

Sixteen-year-old Japanese singer Hatsune Miku grew in short time to a worldwide popstar. With her colourful appearance she counts millions of followers on social media, she …

Visual of Genome Editing - Bringing the Übermensch to a Shelf Near You

Genome Editing - Bringing the Übermensch to a Shelf Near You

Last April, a Chinese group of researchers published a paper that set the scientific world ablaze in a fierce debate. The paper was about their attempts to edit the DNA of a human …

Visual of Abandoning Modern Life to Live as a Goat

Abandoning Modern Life to Live as a Goat

Conceptual designer Thomas Thwaites is currently investigating and experiencing to live life as a goat.

Visual of Organs Could Self-Heal with Nanoneedles

Organs Could Self-Heal with Nanoneedles

An international team of scientists used nano-sized needles in order to promote production of new blood cells.

Visual of Which Technologies will 2016 Bring?

Which Technologies will 2016 Bring?

The new year is right around the corner, let’s forget about long-term future for a while to check out what new tech trends will hit it big in 2016. At the end of every year, …

Visual of The Risk of Technological Unemployment

The Risk of Technological Unemployment

Stephen Hawking gives his opinion on what technological unemployment, aka machines taking over our jobs, can represent for future human societies.

Visual of The Hotel Run by Robots

The Hotel Run by Robots

A futuristic Japanese hotel will be run by robots, designed to be extremely human-like.

Visual of Explore Mars with NASA's VR Experience

Explore Mars with NASA's VR Experience

Exploring the surface of Mars at least 15 years before a human being in flesh and blood will be able to, this is the new ambitious idea of the people at NASA.

Visual of What if Mosquitoes Were Only a Zoo Species?

What if Mosquitoes Were Only a Zoo Species?

Genetic engineers are developing techniques to kill several types of mosquitoes.

Visual of Pigs Have a Heart for Us

Pigs Have a Heart for Us

Replacing your old heart with a new heart from an animal may seem extreme? Well, this future may arrive sooner than we think.

Visual of Robots Are Making Pizza Now

Robots Are Making Pizza Now

A new wave of automation lies in pizza. Not only will robots deliver your pizzas in the future, they will even make them.

Visual of Setting Aside Half the Earth for Nature

Setting Aside Half the Earth for Nature

E.O. Wilson, a respected biologist, has proposed a radical idea: set aside half of the planet as nature preserves.

Visual of This Indestructible Micro-Animal Will Help Us

This Indestructible Micro-Animal Will Help Us

Will a small step for Ramazzottius Varieornatus be a giant leap for mankind?

Visual of Welcome to the Age of Plastic

Welcome to the Age of Plastic

According to a new study, humankind is now entering the "Age of Plastic". The research investigates the evidence that we are living in the Anthropocene, a time in which humanity is the main geological force.

Visual of 1916 - Artificial Womb Appeared in Cinema

1916 - Artificial Womb Appeared in Cinema

In 1916 the artificial womb made its first appearance on the big screen in the movie "Homunculus" by Otto Rippert.

Visual of 1999 - Ectogenesis Enters The Matrix

1999 - Ectogenesis Enters The Matrix

The movie The Matrix brought ectogenesis to the public eye.

Visual of Artificial Womb: the Timeline

Artificial Womb: the Timeline

NNN is currently doing a preliminary research into the idea of the artificial womb. This timeline will help you navigate through the investigation.

Visual of Artificial Womb Workshop at BioClub Tokyo

Artificial Womb Workshop at BioClub Tokyo

On August 8, NNN gave a workshop at BioClub Tokyo to share some insights on the future of technologies concerning human reproduction, sexuality and relationships.

Visual of Dinner with Chef Watson

Dinner with Chef Watson

Chef Watson knows over 10.000 recipes. The highbrow robotic cook invited us over for dinner during the first Neo-Futurist Dinner at Mediamatic.

Visual of Interview: Lining Yao, Interaction Designer and Maker of Novel Materials

Interview: Lining Yao, Interaction Designer and Maker of Novel Materials

We recently interviewed Lining Yao, Chinese interaction designer who uses organic materials as a technology that brings us back to nature.

Visual of Next Nature Gift Guide 2017

Next Nature Gift Guide 2017

The gift giving season is once again upon us and to help out those who are struggling to find that perfect gift for that special someone we have brought together a collection of Next Nature inspired gifts.

Visual of Jobs for Caretakers - Robots at Work #1

Jobs for Caretakers - Robots at Work #1

This is post number one of our serie 'Robots at Work'. In this episode we present you five jobs for caretakers, the ones that work with their hearts.

Visual of Jobs for the Extraordinary-Robots at Work #5

Jobs for the Extraordinary-Robots at Work #5

This is post number five of our serie 'Robots at Work'. In this last episode we present you five jobs for the extraordinary, the ones who won't let themselves be categorized.

Visual of Scientists Create Ghost Heart

Scientists Create Ghost Heart

The Texas Heart Institute researches in the field of organ transplantation. With the “ghost heart” — an heart organ scrubbed clean of all its former cells, the researches are on the verge of creating a sustainable and effective way of transplanting organs.

Visual of How to Train Your Robot

How to Train Your Robot

Humans and robots can work together to maximize the potential of both and boost productivity to new levels.

Visual of This artwork lets trees tell the story of climate change

This artwork lets trees tell the story of climate change

In our ongoing battle against climate change, it's hard to transcend from our human position and ‘think’ like nature. Given, nature doesn't think the way humans do, but it does …

Visual of Future AI may hallucinate and get depressed — just like the rest of us

Future AI may hallucinate and get depressed — just like the rest of us

Scientists believe the introduction of a hormone-like system, such as the one found in the human brain, could give AI the ability to reason and make decisions like people do. …

Visual of Scientists accidentally create mutant enzyme that eats plastic bottles

Scientists accidentally create mutant enzyme that eats plastic bottles

Scientists have created a mutant enzyme that breaks down plastic drinks bottles – by accident. The breakthrough could help solve the global plastic pollution crisis by enabling …

Visual of Open Call for ECO Coin Award 2018 Submissions

Open Call for ECO Coin Award 2018 Submissions

Nominate an inspiring project, platform, person or community who is tackling food waste for the ECO Coin Award 2018

Visual of Face the future of intimacy with Kiiroo

Face the future of intimacy with Kiiroo

Meet the teledildonics, an ingenious species of bi-directionally controlled sextoys from the future, available today. These touch emulating vibrators find each other on social sex …

Visual of Why you should attend ADE Green

Why you should attend ADE Green

ADE Green returns for the seventh consecutive year to the DeLaMar Theater in Amsterdam. Once more, Amsterdam Dance Event organizes this leading event to ignite sustainable action, …

Visual of AI creates images of delicious food that doesn’t exist

AI creates images of delicious food that doesn’t exist

A team of researchers from Tel-Aviv University developed a neural network capable of reading a recipe and generating an image of what the finished, cooked product would look like. …

Visual of These speculative 'Next Senses' allow you to augment your senses with technology

These speculative 'Next Senses' allow you to augment your senses with technology

Imagine you could communicate telepathically with a whale, listen to the WiFi networks in your environment, or experience smells through seeing color. Developments in technology …

Visual of Iceland is mourning a dead glacier

Iceland is mourning a dead glacier

Death certificates and commemorative plaques aren’t something you’d normally associate with a glacier. But that is exactly how Iceland recently mourned the loss of 700-year-old …

Visual of Truly smart homes could help dementia patients live independently

Truly smart homes could help dementia patients live independently

You might already have what’s often called a “smart home”, with your lights or music connected to voice-controlled technology such as Alexa or Siri. But when researchers talk …

Visual of A guide to parenting with AI Barbie

A guide to parenting with AI Barbie

The rise of artificial intelligence has brought us more advanced toys. If AI Barbie and her talking robotic friends are going to raise our kids, what would their parenting style …

Visual of Why half of the world's beaches could disappear by 2100

Why half of the world's beaches could disappear by 2100

Up to half of the world’s sandy beaches are at risk of disappearing by the end of this century if no action is taken to limit greenhouse gas emissions. That’s according to a new …

Visual of Next Generation: Elissa Brunato's bio iridescent sequin shimmers with nature

Next Generation: Elissa Brunato's bio iridescent sequin shimmers with nature

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here?  Get in touch …

Visual of Cyborg artist Moon Ribas feels earthquakes

Cyborg artist Moon Ribas feels earthquakes

Imagine waking in the night, and feeling the vibrations of an earthquake on the other side of the world pulsing through your body. This is a reality for Catalan-born artist Moon …

Visual of Virtual makeup: maybe they're born with it, maybe it’s XR

Virtual makeup: maybe they're born with it, maybe it’s XR

As our reality exists increasingly within digital realms, our virtual world demands a virtual identity. Our work is hybrid, our social identity is online and our connection is …

Visual of Cooling buildings with ultra-white paint

Cooling buildings with ultra-white paint

From icy tundras to billowing clouds, the colour white crops up repeatedly in our planet’s palette. This colour provides a natural way for light from the sun to reflect back from …

Visual of Enter the memesphere

Enter the memesphere

Why memes might be the next tool to make sense of on our increasingly hybrid virtual and physical environment.

Visual of A Model's Body

A Model's Body

Dutch photographer Koen Hauser blends parts of the human body with parts from anatomical models. You know, the ones you had in biology class and gave you this fine colorful …

Visual of Friending, Ancient or Otherwise

Friending, Ancient or Otherwise

By ALEX WRIGHT, Published in NY Times December 2, 2007 The growing popularity of social networking sites like Facebook , MySpace and Second Life has thrust many of us into a new …

Visual of Rhythm robot Keepon

Rhythm robot Keepon

The goals of "understanding humanity" and "humanizing robots" are tightly related to each other. Infanoid Project is trying to relate robotics to human sciences in order to …

Visual of Remote pets

Remote pets

Humans have domesticated animals for thousands of years. The earliest known evidence of a domesticated dog is a jawbone found in a cave in Iraq and dated to about 12,000 years ago …

Visual of Tail communicator

Tail communicator

'The LED Dog Tail Communicator' is an initiative of James Auger and Jimmy Loizeau, and it is part of the larger 'Augmented Animals' project. Its focus points to technological …

Visual of Artificial 'Trees' to Stop Climate Change

Artificial 'Trees' to Stop Climate Change

The fabrication of forests with artificial trees is one of the best strategies to stop climate change, according to scientists of the Institution of Mechanical Engineers . The …

Visual of Bacteria that Turn CO2 into Energy

Bacteria that Turn CO2 into Energy

We’ve written earlier about man–made bacteria that eat waste & shit petrol . How about a genetically modified bacteria that can eat CO2 and excrete methane that could power …

Visual of DrinkPeeDrinkPeeDrinkPee


Drinkpeedrinkpeedrinkpee is a project by Britta Riley and Rebecca Bray about the role our bodies play in larger ecosystems. It's an installation about the Urine to Fertilzer DIY …

Visual of Ear on your arm? Why not?!

Ear on your arm? Why not?!

For over 40 years Australian artist Stelios Arcadious Stelarc has made art with medical instruments, prosthetics, robots, virtual reality systems and biotechnology to investigate …

Visual of Liberate the Breast Cancer Genes

Liberate the Breast Cancer Genes

On May 12, 2009 the ACLU and the (not-for-profit) Public Patent Foundation, filed a lawsuit, charging that patents on two human genes associated with breast and ovarian cancer are …

Visual of Mapping the DNA World

Mapping the DNA World

DNA related tools, once expensive and restricted to research and crime labs, are rapidly becoming affordable. Like GPS – once a high-tech wonder now turned into a everyday gadget …

Visual of Objects of Desire

Objects of Desire

Created by  Alex Sandwell Kliszynsk . Via Posthuman blues .

Visual of Plastic Birds

Plastic Birds

Bird spotting is not a typical activity for us next nature explorers, yet occasionally we bump into some birds worth mentioning (remember the amazing copy-paste bird , rubber duck …

Visual of Supermarket – Our Next Savanna

Supermarket – Our Next Savanna

We are living in the future and we find it boring. The best place to gather evidence for this claim is the supermarket. To begin with, try and have a fresh look at the word:  …

Visual of Tattooed Goldfishes

Tattooed Goldfishes

If a tattooed pig is a bit too much for you, why not go for a tattooed goldfish? They bring you lost of luck and are available Chinese characters such as “Wealth, Dragon, …

Visual of Think Hello

Think Hello

Remember Asimo ? Honda has now developped a new Brain-Machine Interface technology that allows humans to control the humanoid robot simply by thinking certain thoughts. The BMI …

Visual of Cultivating the Money-verse

Cultivating the Money-verse

Alright, we were mistaken. Money isn't virtual after all.   A recent TV commercial of a Greek bank shed light on the issue. Your money lives, is anthropomorphic and inhabits an …

Visual of Geminoid Female

Geminoid Female

Professor Hiroshi Ishiguro ( Intelligent Robotics Laboratory at Osaska University) has done it again! This time in coöperation with robot-maker Kokoro Co. Ltd . Objective: to …

Visual of Next Nature Movie #1: Quest for Fire

Next Nature Movie #1: Quest for Fire

The Quest for Fire (1981) shows the Next Nature of 80.000 BC. Set in a world without highways, supermarkets, airports, Internet, television, farming, money or written language, …

Visual of Next Nature Movie #3: Koyaanisqatsi

Next Nature Movie #3: Koyaanisqatsi

Koyaanisqatsi (1982) is a film with no actors, no storyline, and no dialogue. The only things we see are landscapes, images of cities, and people going about their regular lives. …

Visual of US Judge Rules Gene Patents Invalid ?because they are Natural

US Judge Rules Gene Patents Invalid ?because they are Natural

Did you know that about 20 percent of your body isn't really yours? It has been patented by some corporation you probably never heard of. You can't patent gold, you can't patent …

Visual of American Hyperbodies

American Hyperbodies

Lady Gaga is famous for fashion that exaggerates or obscures her body, but a few months ago, she made a foray into 'actual' body-modification. Gaga appeared on Jay Leno's talk …

Visual of Birdfeeders spit Blackcaps in two species

Birdfeeders spit Blackcaps in two species

Until now, most people have likely regarded bird-feeders as merely a pleasant addition to their gardens. But scientists have now discovered that bird-feeders in the UK are …

Visual of City Rats Love Ethnic Food

City Rats Love Ethnic Food

City rats, it seems, prefer the same foods that humans do: Greasy, fatty, sweet, and salty. Although rats are usually seen as the billy goats of city life, ready to chow down on …

Visual of Evolutionary Janitors

Evolutionary Janitors

We normally think of polluted water as the source of disease, not the cure for it. The Gowanus Canal in Brooklyn, affectionately known as the Super Fun Superfund , is one of the …

Visual of Flap to Freedom

Flap to Freedom

It works like this. Position yourself with a friend in front of a battery hen and flap your arms as fast as you can when the music sets in. The harder you flap the faster your …

Visual of Manko & Life [#8]

Manko & Life [#8]

Manko sighed. Nada: 'Did you like it?' Manko: 'I have to admit that if this is the starter, I'm not sure I'll survive the main course.' Everyone at the table laughed. Manko: 'Let …

Visual of Mapping the Utilisphere

Mapping the Utilisphere

Earth has had a geosphere, atmosphere and biosphere for a few billion years. Only within the last several thousand years has earth gained a global noosphere, the intangible …

Visual of Next Nature Services

Next Nature Services

Intentionality separates culture from nature. A dog is intentional, a fox is not; a park is intentional, a forest is not. Since trash, ruined buildings, and automated computer …

Visual of Protei, the Sail Bot that Cleans Up Oil

Protei, the Sail Bot that Cleans Up Oil

Protei is a sailing robot that's designed to clean up oil spills without human assistance. After sailing upwind, the bot drifts downwind, zigg-zagging across the surface to absorb …

Visual of The Cat Parasite that Sells Motorcycles

The Cat Parasite that Sells Motorcycles

The protozoa Toxoplasma gondii makes an unobtrusive home in nearly every warm-blooded species, but it's prolific life is limited: Toxo can only reproduce in cat stomachs. The …

Visual of The Incredible Shrinking Man

The Incredible Shrinking Man

It has been a trend for people to grow taller and taller during the evolution. When people get taller, they will need more energy, food and space. Since the human population is …

Visual of The Soul is a Plastic Bag

The Soul is a Plastic Bag

In the film Plastic Bag , the title character spends a lifetime (or more) on a quest for a creator not even aware of his existence.  A stunning short by Ramin Bahrani, director of …

Visual of A Clockwork Forest

A Clockwork Forest

Has nature become a fairytale or do we want it to be one? In their installation The Clockwork Forest , artist collective Greyworld seems to opt for the latter. The work of art …

Visual of A Fake Sun for Your 25/7 Life

A Fake Sun for Your 25/7 Life

The earth operates on a 24 hour cycle, and so do humans. For most of history, we didn't have much choice in the matter. However, in the absence of visual cues light sunlight, some …

Visual of Bonobos (And Maybe Baboons) Domesticated Themselves

Bonobos (And Maybe Baboons) Domesticated Themselves

While evidence indicates that humans  domesticated themselves , we're not the only primates capable of self-domestication. Bonobos and baboons have shown they are just as capable …

Visual of Rule #7: Respect Social Standards

Rule #7: Respect Social Standards

Anthropomorphic products enter the human social space. Humans have the most complex social behavior of any organism on Earth. Anyone or anything trying to join in should be careful to do it right.

Visual of Is Life on Earth Suicidal?

Is Life on Earth Suicidal?

At Next Nature, we often argue that "our image of nature as static, balanced and harmonious  is naive and up for reconsideration ." Paleontologist Peter J. Ward happens to agree. …

Visual of Where Be Dragons? Try Your Instinctual Fear of Snakes

Where Be Dragons? Try Your Instinctual Fear of Snakes

This last Monday rang in the Chinese Year of the Dragon. Not restricted just to the benevolent, snake-like creature of Chinese mythology, or to the greedy, princess-stealing …

Visual of A Frankenstein-esque System

A Frankenstein-esque System

The boundary between humans and machines is slowly but steadily blurring. The Immortal is a machine which exists out of several life-support machines connected with wires and electric cords.

Visual of A Lifetime of Questions through Google

A Lifetime of Questions through Google

Google becomes the authority on existential questions about aging.

Visual of Brick Era

Brick Era

Mankind has expanded the variety of stones found on the planet.

Visual of Customizing the Brain with Psychoactives

Customizing the Brain with Psychoactives

It’s long been a desire of the human species to have complete control over our own thoughts. We’ve all had these moments where we curse our brain. Asking questions like: “Why …

Visual of EcoBot III: a Robot that Produces Energy Fueled by Organic Matter

EcoBot III: a Robot that Produces Energy Fueled by Organic Matter

There are robots that look like people, and then there are robots, like the Ecobot III, that look nothing like humans but have our same biological needs: they have to eat, digest …

Visual of Electric Skin Could Allow Robots to Feel

Electric Skin Could Allow Robots to Feel

A new kind of piezotronic transistor mesh could make for robotic skin that’s as sensitive as your own is, covered in thousands of tiny mechanical hairs.

Visual of Fuel Your Body With Algae Headgear

Fuel Your Body With Algae Headgear

Algae as the future alternative fuel for the human body.

Visual of Why Meat Grown in Labs is the Next Logical Step for Food Production

Why Meat Grown in Labs is the Next Logical Step for Food Production

Lab grown meat is part of the trajectory that agricultural technology is already following.

Visual of Project Genesis

Project Genesis

We serve our systems as much as they serve us.

Visual of What Will We Look Like in 100,000 Years?

What Will We Look Like in 100,000 Years?

In 100,000 years human beings might look like a manga character: big intense eyes, high forehead, large head, straight nose, more pigmented skin, and perfect symmetry. “There will …

Visual of Growing Crops with Video Projections

Growing Crops with Video Projections

Growing plants with projected YouTube videos.

Visual of How Technology becomes Nature

How Technology becomes Nature

In this talk at TEDxGhent, our own Dr. Van Mensvoort shows how technology becomes nature in seven steps and what engineers, inventors, designers and entrepreneurs can learn from that.

Visual of In Vitro Meat: Animal Liberation?

In Vitro Meat: Animal Liberation?

Many people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.

Visual of Painting the Anthropocene

Painting the Anthropocene

Govedare paints the human impact on natural environments, showing how nature has become a subset of culture.

Visual of The Earth As You've Never Seen It Before

The Earth As You've Never Seen It Before

Breathtaking satellite images that will change how you see the World.

Visual of Transportations Of The Future

Transportations Of The Future

A selection of nine enthralling and striking concepts of future way of transportation.

Visual of Cities Evolve in Similar Ways as Galaxies

Cities Evolve in Similar Ways as Galaxies

Scientists think the laws governing the structure of galaxies in outer space are the same laws underlying the growth of cities.

Visual of Did a Robot Grow your Vegetable?

Did a Robot Grow your Vegetable?

The world’s largest indoor farm  is not the only firm developing vertical agriculture. Japanese company  Spread plans to grow more than ten million heads of lettuce a year by …

Visual of Dynamic Exoskeleton Chair

Dynamic Exoskeleton Chair

An exoskeleton chair that allows the body to move freely.

Visual of IBM Predicts Artificial Intelligence Future

IBM Predicts Artificial Intelligence Future

While the Watson technology is exponentially increasing its processing power on an annual basis and steadily moving from answering trivia questions, to cooking advice, onto medical advice, it is about time we confront it with the million dollar question: "Watson, what do you want?".

Visual of Meet the Band Aid of the Future

Meet the Band Aid of the Future

This potentially revolutionary device includes LED lights and temperature sensors to provide medication directly to the wounded section of the skin.

Visual of Our Bodies, Our Fuel

Our Bodies, Our Fuel

This piece from Ars Technica details the breadth in the variety of energy sources emitting from our every day interactions.

Visual of Stewart Helps People to Trust Self-Driving Car

Stewart Helps People to Trust Self-Driving Car

Stewart is a tactile interface that mediates the communication between human and self-driving car.

Visual of Stratospheric Sky Garden with Proto Life

Stratospheric Sky Garden with Proto Life

A sky garden of cacti and artificial life forms floating a hundred thousand feet above the Earth's surface.

Visual of How Technology is Becoming More and More Sensitive

How Technology is Becoming More and More Sensitive

Over the past decade scientists have tried to get technology surfaces to be as sensitive as our skin, especially as our fingertips. Human tact is a very sophisticate interface …

Visual of Turning Poop Back Into Food

Turning Poop Back Into Food

Nasa funded a program to turn astronauts’ poop into food.

Visual of AI Teenage Girl Hit by Depression

AI Teenage Girl Hit by Depression

An AI was intended to improve human-like experiences in regards to the company’s customer service chatbots, but has fallen into a suicidal depression instead.

Visual of C-Sections Caused an Evolutionary Change

C-Sections Caused an Evolutionary Change

C-sections have an unexpected side effect on human evolution. Newborn heads are getting bigger, while the mothers birth cannals are becoming smaller.

Visual of Colorless coral: How climate change is affecting the great barrier reef

Colorless coral: How climate change is affecting the great barrier reef

Our peculiar image of the week comes from the Great Barrier Reef. You've probably seen images of this vibrant underwater attraction before. If you're lucky, maybe you've seen it …

Visual of When FB Replaced Editors with Algorithm

When FB Replaced Editors with Algorithm

Facebook had just fired their curatorial team for the ‘Trending’ news section over an algorithm, resulting in false stories attacking a news anchor, a writer, and Mac Donald’s.

Visual of Evolution Will Change the Way We Sleep

Evolution Will Change the Way We Sleep

A group of researchers is working to optimize the way we sleep, increasing our relaxation, and therefore reducing the time devoted to our naps.

Visual of Getting Wasted on Plastics

Getting Wasted on Plastics

A new community currency that rewards recyclers with local discounts and deals.

Visual of How We Domesticated Food

How We Domesticated Food

We tend to believe that the fruit and the vegetables we eat today are "natural" and the same as they always were. It turns out that in the past this familiar food didn't look like this at all.

Visual of Designer Dave Hakkens is putting plastic waste to better use

Designer Dave Hakkens is putting plastic waste to better use

We recently handed this year’s ECO Coin Award to Dutch designer Dave Hakkens, founder of the Precious Plastic movement. With his open sourced recycling machines, he provides people around the world the knowledge to start recycling plastic locally.

Visual of Landfills Cause Changes in Bird Migration

Landfills Cause Changes in Bird Migration

Garbage dumps may not be very attractive places for us but they sure are for animals. A study published in Science Advances shows how certain groups of storks modified (and …

Visual of Medical Practice Aided by Robots

Medical Practice Aided by Robots

Robots in health care could lead to a doctorless hospital.

Visual of The New Era of Tourism is Underwater

The New Era of Tourism is Underwater

Sleeping underwater has always been your dream? Thanks to an ambitious project it will be soon reality.

Visual of Are Robots the Future of Tattoos?

Are Robots the Future of Tattoos?

An industrial robot just tattooed the first person ever in San Francisco.

Visual of Storing Knowledge for Eternity

Storing Knowledge for Eternity

Researchers discovered a way to store data in five dimensions on a nano structured glass able to survive for billion of years.

Visual of The Supermarket with No Employees

The Supermarket with No Employees

This automated store in Sweden doesn’t have any human employees, only a smartphone app.

Visual of Vacation in the Era of Marine Pollution

Vacation in the Era of Marine Pollution

While we can’t just leave the coast permanently without upsetting the delicate balance of this new environment we created, we can take better care of it to ensure that it is around for years to come.

Visual of 2017 - Artificial Womb Incubates Fetal Lamb

2017 - Artificial Womb Incubates Fetal Lamb

A lamb born at the equivalent of 23 weeks in a human gestational period was kept alive in an artificial womb and developed just as if it was in a normal womb.

Visual of Artificial Intelligence Learns to Smell

Artificial Intelligence Learns to Smell

22 teams of computer scientists have unveiled a set of algorithms able to predict the odor of different molecules based on their chemical structure. Computers learn how humans smell

Visual of Digital Detox: Disconnect to Reconnect?

Digital Detox: Disconnect to Reconnect?

Do you feel information overloaded? Do you experience stress? Do you feel like you are addicted to your smartphone, laptop, or the Internet? Get yourself digital detoxed!

Visual of Explore Depths from Your Chair

Explore Depths from Your Chair

To explore deep sea Standfort University developed OceanOne: a humanoid diving robot, which at the same time creates a simulation of the underwater experience on land.

Visual of Female Menstrual Cycle on a Computer Chip

Female Menstrual Cycle on a Computer Chip

The complicated system of a female menstruation cycle was reproduced on a computer chip for the first time.

Visual of A Floating Gym in Paris

A Floating Gym in Paris

This floating gym harnesses human energy to sail down the Seine River in Paris.

Visual of HUBOT: Meet the Robot Coach

HUBOT: Meet the Robot Coach

Craftsmanship is generally very appreciated, but it takes a lot of time to master a craft. Therefore, as a robot coach you train - you guessed it, a robot - to transfer your …

Visual of The New Male Birth Control

The New Male Birth Control

A new contraceptive has appeared on the horizon, bringing the prospect of an alternative form of male birth control one step closer.

Visual of Preventive Punishment for Robots

Preventive Punishment for Robots

The Punishment is an installation featuring a robotic arm that mimics a kid's handwriting perfectly, and repetitively writes "I must not hurt humans".

Visual of Jobs for Facilitators - Robots at Work #3

Jobs for Facilitators - Robots at Work #3

This is post number three of our serie 'Robots at Work'. In this episode we present you five jobs for facilitators, the ones who love to work with technology.

Visual of Building a City on Mars by 2117

Building a City on Mars by 2117

The United Arab Emirates released plans to build a city on Mars.

Visual of Untouched Nature? Not in the Amazon

Untouched Nature? Not in the Amazon

The Amazonian rainforest was already transformed over two thousand years ago by people who built hundreds of large, mysterious earthworks.

Visual of This bio-brick is made out of urine mixed with sand and bacteria

This bio-brick is made out of urine mixed with sand and bacteria

The world’s first bio-brick grown from human urine has been unveiled by University of Cape Town (UCT) master’s student in civil engineering Suzanne Lambert, signalling an …

Visual of Towards a design brief for the artificial womb

Towards a design brief for the artificial womb

Humanity is facing the disconnection between biological reproduction and the body, facilitated by the emerging technology of the Artificial Womb. Envisioned in bleak science …

Visual of Edible packaging: Seaweed could replace plastic in disposable packaging

Edible packaging: Seaweed could replace plastic in disposable packaging

What to do about the plastic planet ? The seas are steadily filling up with plastic , and it's vital to find ways to address the problem . One way to do this is to move away from …

Visual of Next hospitals: How virtual reality is shaping the future of medicine

Next hospitals: How virtual reality is shaping the future of medicine

And it’s already showing incredible results. VR transports us to faraway worlds without even asking us to leave our chairs. Yet we usually hear about it in the context of video …

Visual of A next natural landscape of bikes