Video Game-Playing Robot Acts More "Human" than Humans
Allison GuyComputer-controlled players in video games can usually be spotted for their repetitive, illogical or unemotional behavior. Unlike humans, non-player characters (NPCs) don't get …
Search results for Human Planet
'Team Human' is a manifesto for humankind
NextNature.net' Team Human ' is a manifesto—a fiery distillation of media theorist Douglas Rushkoff’s most urgent thoughts on civilization and human nature. In one hundred lean and incisive …
Humane Technology #4: Resonate with human senses
Allison GuyPrinciple number four: Humane technology should resonate with the human senses, rather than numbing them. If you're an office worker or a video game fanatic , you may spend most …
Humans Caused Mass Extinctions Before There Were Even Humans
Allison GuyHumans and other hominids have a reputation for bringing about mass extinctions. Homo erectus has been blamed for the disappearance of many African carnivores, our ancestors …
To Be Human Is To Be Transhuman
Alessia AndreottiBuckle up for a new video from our favorite performance philosopher Jason Silva: To Be Human Is To Be Transhuman.
Talking Nonhuman Nonsense
Eloïse PeredrukNonhuman Nonsense is a research-driven design and art studio existing somewhere between utopia and dystopia. They wonder upon our relationship with the non-human, embracing …
Earth is so strongly impacted by its human inhabitants that it's now a “hybrid planet”
Jack CaulfieldHumanity has for a long time considered itself the most important species on the planet. We are quite happy to share the world with other species, but we think we know who's in …
Letter to Humanity
Koert van MensvoortNNN director Koert van Mensvoort writes a letter to humanity.
Humane Technology #6: Improve the Human Condition
Allison GuyAnd now for the sixth and final principle: Humane technology improves the human condition and helps people realize the dreams they have of themselves. No matter what your …
Humane Technology #2: Revive Human Intuitions
Allison GuyOur second principle: Humane technology revives human intuitions, in particular those we might have forgotten about. 'Conventional' technology aims to overcome our hominid …
Humane Technology #3: Take Human Values as a Cornerstone
Allison GuyThe third principle of humane technology: It should take human values as a cornerstone of its development. Technology doesn't have to be expensive or electronic to be humane. …
Why superhuman technologies will affect us all
peter joostenWhen you look through a super-telescope, you can still see the planet Earth. Once called the blue planet, she now looks red and parched. We had no choice but to abandon her… On a …
Why human enhancement requires technological citizenship
Ira van Keulen and Rinie van EstNew technologies – from artificial intelligence to synthetic biology – are set to alter the world, the human condition, and our very being in ways that are hard to imagine. The …
Can technology be humane?
NextNature.netWe must be mindful about how we engage with technology: what we use it for, why, and whether it helps us or hinders us. Sometimes our tech seems to be flowing in inhumane …
Human-animal hybrids are coming and could be used to grow organs for transplant
Mackenzie GrahamAround the world thousands of people are on organ donor waiting lists. While some of those people will receive the organ transplants they need in time, the sad reality is that …
On inhumane technology
Jack CaulfieldStick-on shoes, wakeup lights, bionic limbs: these are examples of humane technology. But what exactly does this mean? It can best be explained in contrast with its opposite. …
Six principles of humane technology
Allison GuyWe must be mindful about how we engage with technology: what we use it for, why, and whether it helps or hinders us. Sometimes our tech seems to be flowing in inhumane directions, …
Next Generation: Towards the Plastic Human with Max Ahluwalia
NextNature.netThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
A path to humane technology
Koert van MensvoortIn 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …
Discussing non-human centered design with Kelvin Godee and Simon Wijrdeman
Eloïse PeredrukWhat if design began to put everything but the human first? The needs of the human not paramount to the design process, but instead the other entities that we cohabit planet earth …
The Ecological Human
Rachel ArmstrongThe nature of humanity in the twenty-first century is, according to sociologist Steve Fuller, a ‘bipolar disorder’ beset with dualisms of identification such as divine/animal, …
Meet Humanity beyond Race, it's Beautiful
Koert van MensvoortMeet Humanity beyond Race, it's Beautiful
Fly like a Bird? Get Human Birdwings
Koert van MensvoortDutch mechanical-engineer Jarnos Smeets dreams of flying like bird. Nothing new really, many people have had this dream for ages. Yet being an engineer and all, Jarnos is seriously propelling his dream towards a reality.
This exhibition investigates how humanity will live tomorrow
NextNature.netOccupying the 52nd floor of Tokyo’s Mori Tower, Mori Art Museum is internationally renowned for its visionary approach and highly original curation of contemporary art. The …
Ectogenesis, Artificial Womb, Human Egg?
Hendrik-Jan GrievinkThe artificial womb is on the verge of becoming a reality, but how it will affect our culture is for us to decide.
Three exhibitions that explore the relationship between humans and the environment
Freya HutchingsAs we go about our daily activities, we may lose sight of our connections with nonhuman life. Here are three exhibitions to encourage you to step outside of your everyday and …
Humans Are the Sex Organs of Technology
Written by Kevin Kelly , published in The Technium . I claim that technology has its own agenda. What is the evidence that technology as a whole, or the technium as I call it, is …
Did Monogamy Make Us Human?
Allison GuyPair-bonding sets humans apart from our relatives. But where did it come from?
OUT NOW: Save the Humans! Book
NextNature.netThe SAVE THE HUMANS! book is now available on our web shop.
Glowing Planet T-Shirt
NextNature.netFeaturing different cities at night, the Next Nature Glowing Planet T-shirt highlights the enchanting beauty of our glimmering world.
Longest Lived Human Embryo in a Lab
Elle Zhan WeiScientists keeping a human embryo alive in lab for 13 days for the first time.
The Anthropocene Debate: Marking Humanity’s Impact
Elizabeth KolbertIs human activity altering the planet on a scale comparable to major geological events of the past? Scientists are now considering whether to officially designate a new …
Neither Warfare nor Dumplings Are Innate to Human Nature
Allison GuyIn Ngogo, Gombe and elsewhere in Africa, bands of male chimpanzees regularly make organized raids on neighboring troops and batter their enemies to death. These grim, warring …
The Non-Human Noosphere
Allison GuyThe definition of the noosphere as "the sphere of human thought on earth" is woefully anthropocentric. It ignores that fact that our fellow sentient organisms have noospheres of …
The Posthuman Farm
Ruben BaartWu Tzu-ning presents a posthuman reality from genetic engineering to digital afterlife.
We Feel Empathy for Robots (Even if They Don't Look Human)
Stefan FinckenHuman test subjects felt empathy for dinosaur robots being cuddled or abused.
2016 - Human Embryo Lives 13 Days in Lab
Elle Zhan WeiIn 2016 a team of biologists has successfully kept a human embryo alive in the lab for 13 days, breaking the previous record of nine days.
Human Nature Forecast
Koert van MensvoortInterview witth TEDx on how people are technological by nature, yet how we also need humane technology to remain human, or become even more human than we are today.
Plastic Planet
Koert van MensvoortWe tend to think of plastic as a cheap, inferior and ugly material used to make children’s toys, garden furniture and throwaway bottles. But as an experiment, imagine for a moment …
Meat-Eating Made Us Humans
Margherita OlivoEating meat has made us who we are today: evolved, intelligent humans, able to use a verbal language.
Letter to Humanity in 25 Languages, Plus One!
NextNature.netRead the Letter to Humanity in Morse Code.
Van Mensvoort Writes a Letter to Humanity
NextNature.netOn the occasion of the Earth Day, 22 April 2017, philosopher Koert van Mensvoort wrote his Letter to Humanity.
Three ways farms of the future can feed the planet and heal it too
Karen Rial-LoveraIntensive agriculture may be nourishing most of the Earth’s inhabitants, but it’s doing the opposite to earth itself. Its dependence on singular crops, heavy ploughing machinery, …
Humans to Blame for Global Warming
Koert van MensvoortGlobal warming is "very likely" a human-caused problem that will last for centuries and require concerted international action to reduce its potentially devastating impacts, a …
Save The Humans – Submit your Quote
NextNature.netWe call upon you, dear readers, to participate in a new publication from the Next Nature Network: SAVE THE HUMANS!.
Study finds humans still evolving and quickly
Dr NaturalBy Karen Kaplan, Los Angeles Times , December 11, 2007 The pace of human evolution has been increasing at a stunning rate since our ancestors began spreading through Europe, Asia …
Animals Give Leadership Lesson to Humans
Margherita OlivoWhat are the characteristics of the perfect leader? The answer could be found looking at nature.
Save The Humans @ The Hoxton Hotel
Next Thursday, February 11, the Hoxton Hotel in Amsterdam dedicates an evening to our newest publication: 'Save the Humans!'
Scientists want to create human-cow hybrid
Koert van MensvoortScientists in the UK applied for permission to create part-cow, part-human embryos for research aimed at treating diseases such as Parkinson's and Alzheimer's. The embryos created …
Apes Like Cooked Food, and What that Means for Human Evolution
Allison GuyHumans are the only species on earth that cooks its food. Not only do we cook our food, but we usually find the flavor of cooked foods preferable to the raw version. Compare the …
Humane Technology #1: Feels Natural
Allison GuyAll too often, technology frustrates us. It forces our behavior into constrained pathways. Even more insidious, technology can knock us out of alignment with our values, goals or …
Humane Technology #5: Empower People
Allison GuyPrinciple number five: Humane technology doesn't outsource people, but instead empowers them. How healthy or humane is it to have an escalator to the gym? Humane technology should …
Humanthesizer
Vincent KlerkxThe human body as an instrument is a cool example of how culture and nature are merging. Calvin Harris used a giant human synthesizer to perform his single. The material used is …
Is the Human Body Redundant?
Rachel ArmstrongThe increasing ‘liveliness’ of machines and accessibility to the virtual world has raised questions about whether it is possible to uncouple the mind from the body in through a …
The Soft Touch of a Human Hand
Martin TetterooNissan’s Engineers Are Creepily Trying To Replicate Human Skin
Save the Humans - Call for Quotes
NextNature.netFor our new book "Save the Human" we invite you to submit quotes that question the autonomy of mankind in the digital computer era and study the future of the independent creative spirit.
Living on Water for a Sustainable Planet
Charlotte KuijpersCompany Blue Frontiers wants to build 7.500 square meters of floating city made up of linked platforms, starting 2018. They hope to complete it by 2020.
Robotization Makes Work More Human
Koert van MensvoortImagine being 16 and studying for a job that soon won't exist. What kind of future is that? New occupations will come thanks to robotization.
Q: How will a technology enter the human habitat?
Hendrik-Jan GrievinkThis question is an excerpt from the Pyramid of Technology toolkit In the late nineties, the Tamagotchi egg was released. A small egg-shaped device that contained a digital …
Fight climate change: Hack the Planet
Dr NaturalLots of clouds this week. The peculiar picture above shows the eruption of mount Pinatubo in 1991, which apparently resulted in a certain amount of global cooling (next to some …
Incredibly Shrinking Humanity
Allison GuyArne Hendricks thinks we can solve the ecological crisis by shrinking every human on earth to 50cm tall: http://bit.ly/sxxNr1 #powershow
Transgenic Jell-O, more human than ever!
Allison GuyThe American Chemical Society has announced a new method of producing gelatin that sounds like good news for cannibals and the canni-curious. Researchers are able to create …
Internet Traffic is now 51% Non-Human
Koert van MensvoortSo you thought the Internet was made by and for people? Think again. A study by Incapsula , a provider of cloud-based security for web sites (mind you where this data comes from), …
Watch Out Whales, Humans Want Your Krill
Allison GuyKrill, those tiny members of the ocean's planktonic community, have an importance disproportionate to their size. They are a vital food for whales, penguins and increasingly, …
A Brief History of Humankind
Koert van MensvoortHistorian Yuval Noah Harari takes us on a journey through the whole human history.
GM Pigs for Animal-to-Human Organ Transplant
Alessia AndreottiScientists have been trying to develop GM pigs that could be used to solve the shortage of organs for transplant patients.
A Map of Mars for Regular Humans
Margherita OlivoIf we'll ever get to go to Mars as tourists , we wouldn't get lost. Ordnance Survey , the official British mapping agency, recently released a new detailed map of the Red Planet. …
1537 - Homunculus: the Semi-Human
Elle Zhan WeiIn 16th and 17th centuries, some medical theory believed that a miniature human body can be produced in a flask by an alchemist.
Hybrid Carp with human face
Koert van MensvoortI never expected anthropomorphobia to be evoked by a fish! This hybrid species fish was born between a carp and a leather carp in the pond of a personal house in Chongju. Each of …
Pimp My Planet
Koert van Mensvoort"We live in a time where everything or everyone can be upgraded or ‘pimped'. After the worldwide acceptance of plastic surgery, it was time to subject our worldly possessions …
The Human LED screen
Marco van BeersAll living creates produce light by default, so do humans . Now researchers from US, China, Korea and Singapore collaborated have collaborated in order to create ultra-thin …
Chrysler Looks to Human Lungs for a Better Gas Tank
Jonathon MarkowskiAlveoli in human lungs serve as the inspiration for designing better, stronger ways of storing compressed natural gas.
Did Forks Really Give Modern Humans an Overbite?
Allison GuyThe food writer Bee Wilson, author of Consider the Fork , has put forth a surprising theory about forks and teeth that has received widespread online coverage. According to …
All Humans Piled Together Are So Tiny
Francesca BarchiesiAll humans on Earth put together are not enough to fill the Grand Canyon. We are so small yet so present.
Human Workers Get Increasingly Obsolete
Alessia AndreottiRobots are coming to replace humans at work, are they a real threat to the world’s unemployed?
A Modest Future for Humanity
Koert van MensvoortThree minutes in the mind of Juan Enriquez, director of Synthetic Genomics.
Jazz-Playing Robot Challenges Human-Computer Interactions
Margherita OlivoA musical robot able to improvise a jazz solo in response to an actual person performing jazz.
Human Cloning Now Possible in China
Daniel FragaIs human cloning here? Chinese scientist is ready to clone people at his ‘replication factory’.
AI Defeats Human at Go
Ruben BaartGo world champion Ke Jie has lost two games of 'Go' against Google's DeepMind AI system AlphaGo.
Biopresence - Human DNA Trees
Koert van MensvoortImagine a graveyard without tombstones, instead there are growing trees that contain genetic material of the deceased people burried there. Biopresence creates Human DNA trees by …
Radio controlled human
Arnoud van den HeuvelThink of this sonic vibe-technology inside any MP3 player ;)
Next humans
Arnoud van den HeuvelWhat will the human race look like in 1, 2, 3, 4 million years? Will it be one human race? Will there be a human race? Impressions of future scenario's must come from scientists, …
Pencils made from cremated humans
Dr NaturalArtist Nadine Jarvis fabricates pencils from carbon left over of cremated humans -- it's part of a larger "research project into post mortem." She notes that "240 pencils can be …
Human genome sequencing soon child play?
Koert van MensvoortStarting next spring, a complete human-genome sequence can be ordered the Californian startup Complete Genomics for just $5,000, Techreview reports. Currently sequencing still …
Human Nature as Pathology
Koert van MensvoortModern society seems to have transformed human nature into a pathology. Our emotions are controlled by drugs. We are forced to operate within a narrow bandwith of what are …
Human garbage can
Koert van MensvoortAnthropomorphobic object of the week. Created by Sarah Hatch .
The Human Printer
Rolf CoppensFor a while now printer ink is probably the most expensive liquid per litre on earth. Still we need our images so badly that we accept this fact. The Human Printer manages to make …
Web Access Is A Basic Human Right
Alessia Andreotti"It's time to recognize the Internet as a basic human right" its inventor Sir Tim Berners-Lee has said.
20k human chip
Arnoud van den HeuvelAAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …
Fractalary: Fractals from Planet to Atoms
Jules RuisI think all Nature has a fractal structure, from Planet to Atoms. Website: Fractalary: Fractals from Planet to Atoms
Human animal hybrid
Koert van MensvoortThis peculiar, half-human creature could be your cousin. No really; it is a sculpture by Patricia Piccinini entitled The Young Family , which, in turn, is part of a larger …
Mapping the human desire to be touched
Dr NaturalFleshmap touch investigates the collective perception of erogenous zones. Hundreds of people ranked how good it would feel to touch or be touched by a lover in different points of …
Human Augmentation™
TimoAs a gamer, I come across many visions of possible futures. But this trailer from the upcoming video game Deus Ex: Human Revolution , the third part in the Deus Ex series shocked …
Trading Humans for Trading Algorithms
Stefan FinckenThe economic system and profit motive has been a driving force that steers and even dictates social change. Investors and stockbrokers have been a major influence to these social …
Who Needs Real Humans? Not H&M
Allison GuyClothing giant H&M no longer uses real humans in its online catalog. The company has admitted that it pastes real models' heads on computer-generated bodies. At least there's …
#10: Enhance Human Experience, Don’t Replace it
NextNature.netPart 10 in the 11 part series Anthropomorphism and Design . The hidden danger with interactive products is that they will become so good at fulfilling our needs that they start to …
Beluga Whale makes Human-like Sounds
SelbyResearchers in the US have been shocked to discover a beluga whale whose vocalisations were remarkably close to human speech.
Human Barbie
Koert van MensvoortJust when you thought the Second Life hype was long gone, meet Ukrainian body artist Valerie Lukyanova who aims to turn Second Life into First Life. They call her the Human …
Lego Minifigs Will Take Over The Planet By 2019
Silvia CelibertiImagine the devastation when there are more Lego minifigs on Earth than humans...
The Human Hamster Wheel Desk
Alessia AndreottiThe Human Hamster Wheel Desk is the latest result of workspace evolution. Office work has domesticated us!
Hacking Human Cells to Use Solar Power
Yunus Emre DuyarA new biotech startup seeks to hack our cells to use solar energy instead of carbon and oxygen.
Human-Like Robot Makes Freaky Joke About the Future of Mankind
Daniel FragaTo thread the uncanny valley is a conscious choice for many artists and enthusiasts, as a means to evoke, through their work, powerful emotions, thoughts and everything in between.
Musical Journey Through the Human Body
Alessia AndreottiDe Motu is an interactive music app that let you experience your body through music and influence the sound with your own body.
The Complex Networks of Our Planet
Margherita OlivoThis video by Nature explains the complexity of networks on our planet.
The Human Smart Home Assistant
Charlotte KuijpersArtist Lauren McCarthy launched a project called LAUREN in which she embodies a eponymous human smart home assistant.
Human Nature, designing the equilibrium with Koert van Mensvoort
NextNature.netUnder the title Human Nature, designing the equilibrium, eleven designers will answer questions about a future in which Humankind and Nature enter into a new relationship. An …
First human CRISPR trial in the US aims to cure inherited blindness
Vanessa Bates RamirezGene editing is advancing at a faster pace than most of us can keep up with. One significant recent announcement was gene editing tool CRISPR’s application to non-genetic diseases …
Five ways AI could make your car as smart as a human passenger
Max EizaDriving long distances without a passenger can be lonely. If you’ve ever done it, you might have wished for a companion to talk to – someone emotionally intelligent who can …
NOT (Natural) AND NOT (mechanical) = human
Hendrik-Jan GrievinkEric Hoffer (1902-1983) You dehumanize a man as much by returning him to nature - by making him one with rocks, vegetation, and animals - as by turning him into a machine. Both …
Human Tetris
Dr NaturalA tribute to the virtual world boomeranging back to the physical world by Mega64 . Or do you rather prefer the corny japanese gameshow version? Via Engadget ,
Human body farm
ElinWhy not use the human body to grow products for the medical industry? The designer Michael Burton envisions Future Farm where the body is used as a farm to cultivate clinical and …
Human Landscape
Koert van MensvoortOur peculiar image of the week was created by artist Levi van Veluw , who reinvents the classical fine art of landscape painting, by moving from the traditional 'oil on canvas' to …
Mirror Neurons – Simulation at the basis of Human Civilization
Koert van MensvoortWithin our society, imitation and simulation are typically seen as inferior symbols of a distorted mediated culture – think of fake Rolexes, plastic Christmas trees, silicone …
The Human Construction of Gay Animal Culture
Allison GuyMuch attention has recently been devoted to 'gay' animals. It's not the fact that many species have enthusiastic homosexual lives that should be surprising – there are convincing …
Rule #8: Use Human Ethics
NextNature.netPart 8 of the 11 part series Anthropomorphism and Design . Anthropomorphic products blur the boundaries between products and people. Ethical norms for people don’t usually apply …
Book as Human-Computer Interface
Stefan FinckenIn combining the classic feeling of handling a book with the interactivity of the computer, Waldek W?grzyn of the Academy of Fine Arts in Katowice, Poland, has created a new human-computer interface.
Computer Algorithms Are Already Replacing Human Journalists
Allison GuyWill writing software eventually replace journalists?
Maya YogHurt: Fermented Drink Made with Human Lactic Acid
Jiwon KimArtist Maja Smrekar modified yeast with her own DNA to produce human lactic acid.
World's Worst Job? Being a Human Robot at Amazon's Fulfillment Center
Hendrik-Jan GrievinkWorkers are completely controlled by algorithms in Amazon's fulfillment center
Humans Need Not Apply
Koert van MensvoortWarning, this video on the impact of automation on human labor might cause you to re-plot you professional career.
Human LCD
Koert van MensvoortNew media technology from South Korea: a gigantic human display compiled from supporters cheering their soccer teams . One pixel per supporter. See also: Skyscreen , A4 e-paper .
One Generation in, Dolphins Still Transmit Human Tricks
Allison GuyDolphins in Port Adelaide, Australia, have been observed performing a remarkable trick : tail-walking, a trait so rare it has only been seen in the wild one other time. More …
Cake Made from Human Skin
Allison GuyCake or death? Cake! The Slice cake is a (vegetarian) vision of the forms lab-grown meat may take in the future.
If Barbie Had Human Proportions
Alessia AndreottiWhat does Barbie look like when she has the proportions of a normal 19-year-old?
Technology Made us Human
Koert van MensvoortBuckle up for a cinematic espresso shot from performance philosopher and NNN ambassador Jason Silva.
Human Artist Hatches Ten Chicken Eggs
Ruben BaartFrench performance artist hatches 10 hen's eggs in Palais de Tokyo.
New AI Model Can Mimic Any Human Voice
Elle Zhan WeiLyrebird is an AI model capable of synthesizing anyone’s voice from just a one-minute audio sample.
Human Furniture
Koert van MensvoortThis unpractical yet not less pretty anthropomorphic furniture piece was created by photographer David Blazques . We are clueless on whether it is in permanent use, yet it serves …
Human-Shaped Power Lines
Alessia AndreottiJust a project for now, but a far more creative way to deal with unsightly public works than tree-shaped antennas.
Lucas Foglia's photography explores the uneasy relationship between humans and nature
Laura MalloneeThere’s no place on earth untouched by human activity: This was clear as Lucas Foglia whizzed across the vast, white expanse of Alaska's Juneau Ice Field last summer. He was …
Explore your relationship with AI in this exhibition
NextNature.netWhat makes us human? And why do we sometimes fear artificial intelligence? And what about technological singularity - the moment in time when artificial intelligence outperforms …
Interview Mark Wigley: "We are living in an ecology of antenna"
Ruben BaartWith the invention of the radio antenna in the late 19th century, we became a different species: Introducing the human insect. A species, able to communicate across oceans using …
Colonizing Mars: Not with humans, but plants
MaithriThe idea of colonizing Mars has become the big speculative future of humanity on Earth. But, artist Alexandra Daisy Ginsberg has radically different ideas to contribute to the …
Anthropomorphobia
Koert van MensvoortAre you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …
Curator Gène Bertrand on design for human needs
Meike SchipperNature has always been a source of inspiration for many artists and designers, yet the urgency to connect to nature is more pressing than ever. Environmental issues such as …
I Want Wings!!!!!!!!!!!!!!
Nicholas CarrRead Nicholas Carr's essay on the transhumanist dream of having wings.
Interview: Bruce Sterling on the Convergence of Humans and Machines
NextNature.netWe had the honor of hosting Bruce Sterling in our Next Nature Network headquarters to talk to him about the concept of the convergence of humans and machines.
Interview: Agi Haines, Speculative Artist Who Wants to Redesign the Human Body
Ruben BaartSpeculative designer Agi Haines' work focuses on (re)designing the human body, and speculates upon future scenarios.
Next Generation: AI meets human creativity in Sofia Crespo's Neural Zoo
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
Interview: Floris Kaayk, the Visionary Creative Mind Behind Human Birdwings
Alessia AndreottiFloris Kayak discusses online hoaxes and the future of technology.
Bio-Printer Creates Living Body Parts
Margherita OlivoBioprinter creates bespoke lab-grown body parts for transplant.
Did Booze Make Us Modern?
Allison GuyA psychiatrist argues that beer gave us civilization - but do intoxicants play a deeper evolutionary role than that?
Next Generation: VR creator Bas Jansen asks, is there a place for humans?
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
Cyborgnest: redefining human senses
Liam BekaertNature provided humans with an extensive set of sensory modalities, allowing our brain to constantly gather sundry inputs from the outer world. These sensory inputs help us …
The future infrastructure of the blockchain might be green and humane
Koen BlezerThe connection we share through the Internet has laid the foundation for a whole new digital infrastructure, in which blockchain technology is heralded by many believers for being …
This expo confronts a planet in a state of emergency
Meet the 'Eco-Visionaries' , these are the architects, artists and designers who respond to some of the most urgent ecological issues of our times. This exhibition reveals how …
Space Television Network
Julie ReindlSen is a space television network that provides visuals from other planets in order to prepare us for our multi-planetary life.
The Biggest Impact on the Planet Comes from Household Consumption
Margherita OlivoNew study suggests that the real environmental problem is embodied in the things we buy.
Technology: Intrusive or Supportive?
Ioana TomiciIs the use of personal devices becoming a replacement for the spectrum of emotions that make us all humans?
A digital twin of the Earth could make the planet climate-neutral
MaithriWhile Elon Musk may be trying to initiate efforts to colonize Mars, scientists on Earth are attempting to build an accurate digital twin of the planet to simulate in the future. …
We Are more Bacteria than Human
Ingmar NieuweboerOur bodies are microbiomes, suffering from our habit of cleanliness.
Beijing's dust storm: part humans, part nature
NextNature.netThe skies in Beijing turned orange recently, thanks to what was widely reported as a massive sandstorm . The problem, at least in terms of public health, is that it was not …
An Edible Drone for Humanitarian Aid
Ruben BaartNigel Gifford is developing a drone that will be relatively inexpensive, disposable and edible.
Ouroboros Steak: Producing meat using human cells
Nellie FriedrichYou are what you eat; a quite common message in the midst of our self-growth society. We have to eat well to become the best version of ourselves - more productive, healthier …
Controlling Human Odour
Florian Conradi and Michelle ChristensenThe ultimate personal hygiene product, feces odor tablets, is another Japanese innovation sold by the Takano Yori Beauty Clinic . These pills promise to make your excrement …
More People Are Too Fat Than Too Thin
Ingmar NieuweboerFor the first time in history the world population counts more people who are too fat than too thin.
Watch: BBC reports on world's first artificial womb for humans
NextNature.netNow that the team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …
The World Without Technology
Kevin KellyI remember the smoke the most. That pungent smell permeating the camps of tribal people. Everything they touch is infused with the lingering perfume of smoke – their food, …
Should we clone Neanderthals?
Zach ZorichIf Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …
Time Between Emergence and Design
carolinenevejanPreviously, experiences of time emerged from nature as given – offering seasons, the rhythm of humans, plants and animals. Nowadays, people integrate nature-time, body-time, inner-time, clock-time, and global 24/7 systems-time. Human beings, in past, current and next natures, have to deal with emergence and design of time in order to survive.
An Ecstatic Dialogue with Richard Doyle
Jason SilvaWhen techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …
A Stroll Through the Bubbles of Chemicals and Men
Etienne TurpinA stunning pre-history of the anthropocene
Next Generation: Exploring the vegetal cyborg with Marie Declerfayt
NextNature.netThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
Hello, superorganism
Koert van MensvoortWhen I was a kid, my parents took me to the beach every summer. We’d swim in the ocean and play on our inflatable raft in the surf. When the tide was low, I’d build a sand castle …
From Eco-Apartheid to Earth Democracy
Vandana ShivaDo humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.
Ecology – A New Opium for the Masses
Marxist philosopher Slavoj Žižek discusses the 'naturalization' of capitalism and how ecology became a new field of capitalist investment. He also argues that the ultimate …
Towards a global society as a superorganism
Ruben Baart and Britta de VriesToday we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …
Intimate Technology: the Battle for Our Body and Behaviour
Rinie van EstTechnology is nestling itself within us and between us, has knowledge about us and can act just like us.
Next Nature Interview
For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …
Pyramid of Technology: How technology becomes nature in seven steps
Koert van MensvoortHow technology becomes nature in seven steps
The Anthropocene Explosion
Koert van MensvoortWe have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.
Next Nature Introduction
Bruce SterlingThis project - the Next Nature Network - is about Nature's brand image. One might surmise that "Nature," being 100 percent all-natural, can't have any brand image. The facts …
It could be time to start thinking about a cybernetic Bill of Rights
Mike RyderLike it or loathe it, the robot revolution is now well underway and the futures described by writers such as Isaac Asimov , Frederik Pohl and Philip K. Dick are fast turning from …
Yes, Naturally
Ine GeversThe introductory essay from the Yes, Naturally book - available in our store!
Interview: Curator Ilari Laamanen on Momentum9, the Nordic Biennial
Ruben BaartWe recently spoke to Ilari Laamanen, to peel the outcrops of Momemtum9, and unveil the overlapping themes to the next nature philosophy.
Technosphere outweighs the biosphere
NextNature.netOur deficiencies have always driven us, even among our distant ancestors, back in the last Ice Age. Having neither the speed and strength to hunt large prey, nor sharp teeth and …
The Coronation
Charles EisensteinFor years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …
The Uncanny Valley of the Pussycat Dolls
Koert van MensvoortMake no mistake, you're not looking at the latest Barbie line: These are the The Pussycat Dolls. Formerly an LA stripper show burlesque show, now upgraded to be pop music …
Microbiocene: A microbiological archeology of the future
Linda ValentaIn configuring our next nature, artists and scientists explore new languages that move beyond the Anthropocene - the era of human beings. These semantics would bridge the gap …
In conversation with cyborg musician Kai Landre
Eloïse PeredrukWhat does the merge of bodies and technology mean for the human? For cyborg Kai Landre, cybernetic extensions become body parts and not technology. Kai began his transition to a …
Nurturing Architecture
Ruben BaartThe way we currently build is not sustainable. We will have to develop a sustainable living environment that matches our human needs, intuitions and potential.
‘Optimism is our duty’: A conversation with Koert van Mensvoort
Ruben BaartWe live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …
In conversation with cyborg choreographer Moon Ribas
Ruben BaartIf we could extend our senses in order to perceive the planet in a deeper way, would our understanding and our behavior towards it be different? We caught up with cyborg …
The Playboy Interview
In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …
Could Biomimicry Help us Solve the Refugee Crisis?
Daniel FragaFrom nutrients within an organism, to organisms within collectives, to populations within a territory and so on - nature offers models on how to deal with highly complex systems.
Can microbes communicate with alien species?
NextNature.netAre we alone in the universe? The famous Seti (Search for Extraterrestrial Intelligence) programme has been trying to answer this question since 1959. American astronomer Carl …
Ancient Man Impacted Environment Already
Koert van MensvoortThe human environmental impact on our planet is hardly underestimated nowadays. Scientist agree humans are to blame for Global Warming – some are already dreaming up scenario’s of …
Totem Animals for the Anthropocene
Ted HeistmanInvasive species become the animal symbols for a man-made world.
Next Generation: Get to know Valerie Daude
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Moral Shortcomings in the Technology Debate
Rinie van EstDigital and genetic techniques increasingly influence life. Our belief in progress through technology stands in the way of a moral debate on this development. By Rinie van Est We …
The Biosphere Code Manifesto
NextNature.netDuring the event The Biosphere Code, Stockholm University researcher Victor Galaz and colleagues outlined a manifesto for algorithms in the environment.
To decarbonize flying, we need biofuels
David Simon LeeWhile aviation accounts for 2.4% of all emissions from fossil fuel use globally, two-thirds of the sector’s warming effect depends on something other than its CO₂ emissions. And …
Meet the lungs of the sea: phytoplankton
Abigail McQuatters-GollopPhytoplankton are microscopic algae living throughout the ocean’s surface waters. They can’t swim and are at the mercy of the currents and tides. Despite their small size, …
Seeking Symbiosis
Ruben BaartVisual artist Heleen Blanken explores the complex relationship between people, nature and technology.
Can This Virtual World Save the Real One?
Alessia AndreottiA Dutch artist designs a Utopian eco-socialist online society.
Next Nature and the Curse of Oil
Tere VadénThe next step is to embrace and celebrate how cultural artifacts are escaping control, becoming autonomous, and forming the “next nature”.
Interview: Liam Young on Speculative Architecture and Engineering the Future
NextNature.netInterview with Liam Young on his work in speculative architecture, the future, and our role in nature as humans.
Getting rid of that bit of unspoiled green
Sanne vander BeekThere it is. A hefty hen, with its head up high and its beak out. And a gigantic VR headset over its beady little eyes. What does this battery hen see? ‘An experience of a free …
An introduction to Biomimicry
Janine BenyusThe first time I explained biomimicry to a stranger was not in a talk or a workshop but in a big-box bookstore just after Biomimicry: Innovation Inspired by Nature had come out. I …
Next Generation: Hearing the first breath of Earth with Dora Lionstone
NextNature.netThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
On the prehistoric origins of modern sexuality
Ruben BaartLet’s talk about the most controversial of "m words"—monogamy. And let’s have this conversation with in mind its prehistoric origins. Our modern picture of prehistoric societies …
Real Nature is not Green
Koert van MensvoortAt the edge of the woods along the motorway near the Dutch town of Bloemendaal, there stands a mobile telephone mast disguised as a pine tree. This mast is not nature: at best, it …
The 21th Century Paradigm
The history of art through the ages reveals a constancy that, by conscious or unconscious applications, provides us with an omnipresent correlation dealing with the …
Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture
Alessia AndreottiRachel Armstrong discusses living buildings, Venice's foundations, millennial nature and how to improve our future.
How climate fiction novels allow us to imagine possible futures
Adeline Johns-PutraEvery day brings fresh and ever more alarming news about the state of the global environment. To speak of mere “climate change” is inadequate now, for we are in a “ climate …
Why I'm turning my son into a cyborg
Vivienne MingImagine if everyone spoke a language that you don’t understand. It’s not a foreign language–it’s been spoken around you since the day you were born–but where as everyone else …
Next Generation: Exploring cybernetic ecologies with Marie Walker-Smith
Liam BekaertThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
You Can Never Go Back To Nature
Annalee NewitzOne of the arguments that environmentalists use against factory farming and burning fossil fuels is that these activities are "unnatural" or that they "go against nature." But …
Counteracting Climate Change with Geoengineering
Jack CaulfieldA respected astrobiologist argues that a radical new process called geoengineering might be the only way to save us from climate change.
How a museum encourages its visitors to examine their relationship with their environment
Linda ValentaLast month I had the opportunity to immerse myself in Tokyo’s newly opened digital art landscape, the Mori Digital Art Museum. The museum stands out for it enables virtual …
Next Generation: Pei-Ying Lin is cooking with viruses
Britta de VriesThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and plot your …
We Domesticated Ourselves
Allison GuyOur bodies are maps of our ancestor's social lives. We evolved, physically and behaviorally, in incredibly complex social groups. Such intense sociability may have favored the …
The Enlightenment Is Dead, Long Live the Entanglement
Danny HillisWe humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.
How AI is reshaping electronic music
Linda ValentaThe idea that AI can compose electronic music may sound a little off to people. It raises essential questions about creativity as a product exclusive to humans: can an AI be …
In conversation with Jalila Essaïdi
Freya HutchingsWhat do in-vitro human skin, spider silk and cow manure have in common? They are all unlikely materials that can cloth, protect and inspire humans, as realized by award-winning …
The AI Revolution Is On
Ruben DaasSteven Levy writes in Wired on the unexpected turn of the Artificial Intelligence revolution: rather than whole artificial minds, it consists of a rich bestiary of digital fauna, …
A.I. Can Guess Exact Locations of Images
Margherita OlivoGoogle's PlaNet will be soon able to tell you where a photograph was taken by simply looking at its contents.
Conversation with Dutch Philosopher Bas Haring: Robot, Colleague or Foe?
Ruben BaartWe talked with Bas Haring to discuss the conception, image and will of the robot. Read our conversation with him and update your ideas about robots.
Five must-see exhibitions before 2020
NextNature.netA large-scale asian food market serving in vitro meat, a transatlantic expo on the future of nature and a travelling exhibition that explores our relationship with AI. These five …
What we can learn from 'The Social Dilemma'
Vanessa Bates RamirezIs social media ruining the world? Dramatic political polarization. Rising anxiety and depression. An uptick in teen suicide rates. Misinformation that spreads like wildfire. The …
Bacteria "R" Us
Rachel ArmstrongThere is a domain of creatures that diffusively encircles an entire planet. There are so many of them that they occupy every conceivable ecological niche. Yet, despite their …
Further Incredibly Shrinking Man
Koert van MensvoortArtist Arne Hendriks gave a lustrous talk on the possibilities of downsizing humanity to better fit the earth.
Next What?
John ZerzanIn this essay, anti-civilization, anarchist philosopher John Zerzan critiques the concept of 'next nature.' He argues that rather than freeing us, our self-domestication through …
The Carnery - A Cultured Future with In Vitro Meat
NextNature.netIn vitro meat has the capacity to transform meat production as we know it, introducing an entirely new way of thinking about and interacting with food.
How AI and genomics will impact the future of making babies
Vanessa Bates RamirezAs if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …
When will the first baby be born in space?
Chris ImpeyWhen the first baby is born off-Earth, it will be a milestone as momentous as humanity’s first steps out of Africa . Such a birth would mark the beginning of a multi–planet …
Next Senses
Eloïse PeredrukNext Senses explores the unchartered territory of how we could experience the world with technology
Entryparadise
Written by Werner Lippert & Peter Wippermann, Curators of the Entryparadise exhibition (26/8 until 3/12, 2006, at Kohlenwäsche, Zollverein) Design is about to undergo a …
The NBIC Convergence: When Machines and Matter ‘Have Sex’
Rachel ArmstrongThe Singularity , as popularized by Ray Kurtzweil, refers to a near term, theoretical time when machine intelligence greatly surpasses our own. At this point we will experience a …
Anthropo-scene #9: Sense, Sensors, Sensitivity
ChristianTechnology helps us understand the unfolding of the Anthropocene.
Artificial Light Threatens Pollination
Daniel FragaA recent study demonstrated how artificial light is a serious threat to plant pollination. It puts plant reproduction in danger, as well as the whole ecosystem.
Heart Repair with Spinach Leaves
Julie ReindlScientists developed a procedure to repair your heart with a spinach leaf.
Recharge! Sun for Your Brain Cells
Julie ReindlA gadget called HumanCharger promises "the sun in your pocket" to give you energy, by beaming light through your ears.
People are less likely to turn a robot off if it asks them not to
Tristan GreeneA team of German researchers published a study earlier this week indicating people can be duped into leaving a robot turned on just because it “asks” them to. The …
Suzanne Lee wants to live in a sustainable material world. Built with biology, not oil
Ruben BaartBiotechnology is nearly as old as humanity itself. The food you eat and the pets you love? You can thank our ancestors for kickstarting the agricultural revolution, using …
What will the virus teach us about life?
Koert van MensvoortWe live in turbulent times. Thanks to science and technology, we are able to perceive our environment down to the atomic level. We can read DNA, manipulate cells, cut and paste …
Breaking Point?
John Zerzan, published in Green Anarchy issue #24 - Spring/Summer 2007 The rapidly mounting toll of modern life is worse than we could have imagined. A metamorphosis rushes …
Out of Control
The Made and the Born: Neo-Biological civillization, written by Kevin Kelly, excerpt from Out of Control : The New Biology of Machines, Social Systems and the Economic World, …
Robot’s Best Friend
Alessia AndreottiFrom chef, to nurse, and also lover. Get ready, a new generation of robots is going to invade our lives!
Designed to Survive Our Roads
Ruben BaartA road safety campaign in the Australian state of Victoria exposed an educational, yet confronting picture to raise awareness to the vulnerable human body on the road.
Interview: Mike Thompson and Susana Cámara Leret, Designers Exploring Alternative Ways of Thinking & Doing
Ingmar NieuweboerInterview with Mike Thompson and Susana Cámara Leret.
The Robots Are Coming!
Koert van MensvoortRobots are getting stronger and smarter every day. They are taking over our whole lives. How long will I have my job before a robot steals it?
Virtual Baby Acts and Looks Impossibly Real
Charlotte KuijpersA rosy-cheeked kid learns her first words, cries when her babysitter leaves, smiles when she’s happy, but she’s not real. BabyX is an AI research-in-progress by a company named Soul Machines.
Your Next Nature guide to Dutch Design Week 2018
Meike SchipperOver time, our bodies, our food and our environment have become more and more subject to design. As designers, we hold the responsibility and have the unique chance to envision …
How animal filters unmask the estranged relation to our wild self
Meike SchipperWould you like a dog snout, cat eyes or fluffy bunny ears? The choice is yours. Virtual selfie filters have become a widespread phenomenon on social media platforms such as …
Next Generation: Biophilic design with Daniel Elkayam
Freya HutchingsThis story is part of Next Generation, a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
The Coming World: Ecology as the new politics
NextNature.netIn science fiction and popular science, 2030 is often suggested as the year in which our planet will run out of oil. Similarly, 2100 will be the year that, according to …
There's a new urgency for speculative design. Here's why
Freya HutchingsPink chickens, synthesized tiger penises and salads grown from bodily fluids - how could they shape our future? In a Next Nature collaboration with the Gogbot Festival, the …
Next Generation: Louise Silfversparre illustrates the remains of the Anthropocene
Eloïse PeredrukThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Geodesign
Nellie FriedrichWe have identified eight key defining moments that tell the story of geodesign, from ancient insight to artificial intelligence.
Interview with a cyborg
Arnoud van den HeuvelErich Berger has a 96 year old grandmother who is a cyborg. She features dentures, hearing aids, glasses, pace maker, a metal implant on the pinkie toe, and more. Quotes from the …
Innovative Nostalgia
Koert van MensvoortWe humans simply feel more comfortable with technological change when it comes in a familiar form that refers to an existing and accepted object, habit, value, tradition or intuition.
Robots Taking Government Jobs
Ruben BaartMeet Amelia, the first robot to work along with human coworkers in a council job.
Untouched Nature Is Entirely Gone
Margherita OlivoResearchers prove that pristine landscapes haven’t existed for thousands of years, therefore we should change or mindset before trying to save the planet.
Ecosexuality: Make the Biosphere Your Lover
Ruben BaartEcosexuality reconceptualizes our perspective on the biosphere by having consensual experiences with it.
The future of the ECO Coin
Koen BlezerHow can we design a cryptocurrency for the better of humanity and ecology? In this last chapter of the crypto deep dive series , we will dissect two kinds of blockchain …
Welcome to the CRISPR baby world—here’s what you should know
Vanessa Bates RamirezLast week, the gene editing world was hit by news the equivalent of a nuclear bomb. In a video on YouTube , Dr. Jiankui He at Southern University of Science and Technology in …
Maurizio Montalti talks nature’s cycle of life
Meike SchipperAs modern humans, we are out of balance with our natural environment. With use of technology, we try to prolong our human lifespan and create materials that live longer than we …
How biotechnology could shape the future of product design
Ruben BaartHumans have been manipulating living things for thousands of years. Examples of early biotechnologies include domesticating plants and animals and then selectively breeding them …
How China is enjoying blue skies — thanks to the coronavirus
Britta de VriesSurrounded by greyness and with the air around you having a dusty, burnt taste; for a long time this is what it has been like to live in many of the world’s highly polluted …
NNN announces 2021-2024 plans: 'Hello, Superorganism'
NextNature.netWith great pleasure we announce our plans for 2021-2024: ‘Hello, Superorganism’ . Our human presence has a huge impact on the planet; plastic in the oceans, climate change, mass …
Why physical distancing feels so unnatural to us
Isabelle Catherine Winder and Vivien ShawFor many people, the most distressing part of the coronavirus pandemic is the idea of social isolation. If we get ill, we quarantine ourselves for the protection of others. But …
A message from volcanic rocks
Laura van den BrinkAlthough it’s seductive to think of human beings as the dominant species on earth, many others play important roles too. Bacteria, insects, algae colonies, rocks and the …
What our Next Nature fellows are reading this summer
Eloïse PeredrukWe asked our fellows , those who dedicate their hearts and minds to explore the next nature and bring our goals and projects in the attention of a wider audience. From artists, to …
What our team is reading this summer
NextNature.netThe Next Nature team explores how our technological environment becomes so omnipresent, complex, intimate and autonomous that it becomes a nature of its own. From life on mars, to …
Exploring Next Nature (2004)
Koert van MensvoortThe first essay ever written on Next Nature, published in Next Nature Pocket and in Entry Paradise, New Design Worlds . ( download pdf ) (German version: Erkundungen im Nächste …
A Society of Simulations
Koert van MensvoortAn interviewer once asked Pablo Picasso why he paints such strange pictures instead of painting things the way they are. Picasso asks the man what he means. The man then takes out …
Ars Electronica Festival goes Next Nature
This years edition of the Ars Electronica festival , which has been hangout for international experts from the arts and sciences for almost three decades, focuses on the nature …
The Monsters We Deserve
Allison GuyRecently, a video clip has been circulating the web that purportedly shows a rabbit born earless due to the radiation at Fukushima. BoingBoing has a convincing take-down of the …
Interview: Arne Hendriks, Researcher and "Father" of The Incredible Shrinking Man
Alessia AndreottiHendriks’s activity explores the positive transformative power of creative impulses and the importance of fundamental free scientific research.
The "Actroid" Lives in the Uncanny Valley
Allison GuyThe Actroid robot holds clues for climbing out of the uncanny valley.
Personhood Status for Robots
Julie ReindlAn "electronic personhood" for robots has been discussed in the European Parliament recently, raising big questions about equality, citizenship, legal and ironically, human rights for artificial intelligent machines.
Solar Powered Electric Cars
Daniel FragaThe sun sustains our planetary system. Its energy fuels life. And in the future, the sun will also fuel our cars. That’s the premise of Dutch startup Lightyear, a startup specialized in solar powered electric cars.
Sophia: World's First Robot with a Citizenship
Jack CaulfieldSophia the Humanoid, a human-like robot in appearance and mannerisms, was granted citizenship by Saudi Arabia and became the first robot with citizenship.
ReTuna: the Shopping Mall Selling Nothing but Recycled Products
Jack CaulfieldA Swedish shopping center is bucking the trend of mindless consumption. At the ReTuna Återbruksgalleria every product is made of recycled materials.
Next Nature book launch: here's what you missed
The new Next Nature book is here ! Next Nature fellows, ambassadors, members and newly interested people came together on the 4th of June to celebrate the book launch with a …
How a 6.000-year-old fruit fly gave us cheese
John MorrisseyHistorians often trace the dawn of human civilisation back 10,000 years, when Neolithic tribes first settled and began farming in the Fertile Crescent, which stretches through …
How future fashion could help us cope with isolation
Ruben BaartToday we cannot meet, touch or hug our loved ones. And while we all like the feeling of the touch of another human being, physical contact does not just feel nice, it is crucial …
Interview: Patricia Piccinini discusses her latest solo exhibition 'Embracing the Future'
Freya HutchingsPatricia Piccinini is an artist interested in the relationship between humans and non-humans, the natural and the artificial, science and storytelling. Working with silicone, …
Next Generation: Sheng-Wen Lo hears ultrasound waves like pets do
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
Why your pets can't spread the coronavirus
Sarah L CaddyA Pomeranian dog in Hong Kong grabbed the international media’s attention this week after scientists found traces of coronavirus in the canine. Following confirmation that the …
How to design your future family
Ruben BaartImagine a place called Reprodutopia. How would such a place look like?
Information Decoration: Our Environment as an Information Carrier
Koert van MensvoortPicture this: it's 40,000 years ago, and you are an early Homo sapiens. You are standing on the savanna. Look around you. What do you see? No billboards, no traffic signs, no …
Next Nature Movie #4: Blade Runner
Koert van MensvoortLook around you and try to find the most natural thing in the room you are in now. It is you. Now, you wouldn’t be so sure in the apocalyptic Los Angeles of 2019 depicted in Blade …
Bulletproof Skin
Lisa van der VoortRecent work of artist Jalila Essaïdi exemplifies of how science and art can meet and create meaningful inventions for society. Jalila Essaïdi used the spider silk produced by …
Can Life Be a Technology?
Rachel ArmstrongIn 2009 the Initiative for Science, Society and Policy coined the phrase ‘living technology’ [1] to draw attention to a group of emerging technologies that are useful because they …
Man Flies Like a Bird
Koert van MensvoortSome months ago we wrote about the dream of mechanical-engineer Jarno Smeets to fly like bird . Over the last few months Jarno worked steadily to materialize his dream. Today …
Post Natural Organisms of the EU
Koert van MensvoortIf you happen to be in the neighborhood you might want to drop by at the exhibition Post Natural Organisms of the European Union in Amsterdam. The small but delicate expo, curated …
Walter Benjamin on Film and the Senses
René RiegerDuring the late 1930’s the philosopher Walter Benjamin wrote its widely influential essay ‘The work of Art in the Age of Its Technical Reproducibility’. While describing a general …
Will Eugenics Become an Acceptable Strategy to Avoid Climate Change?
Koert van MensvoortClimate change is one of the biggest challenges of today and various scenarios, ranging from artificial trees , pollution trading , co2 capturing to geo-engineering, have been …
A Plan to Eliminate Predators
Alessia AndreottiBritish philosopher David Pearce believes we should to stop animals from hunting and killing other animals.
Get Infrared Sight with a Vitamine Diet
Julia WeberBio-hackers developed a protocol to augment human sight to see into the near infrared range.
Anthropo-scene #7: Anthropocene Bird
ChristianDue to human action, 1300 bird species are seriously in decline. Other birds have learned to live with humans and profit from their presence.
Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society
NextNature.netWe recently talk to Nadine Bongaerts about the role and impact of synthetic biology, the gap between biosciences and society and the importance of communication to overcome the fear of new technologies.
Watch out for Bullied Robots
Alexandra BremersDystopian future scenarios filled with evil robots are everywhere. We are afraid of robots treating us badly, but what will happen if it'll be the other way around? According to …
Interview: Leanne Wijnsma, Designer for the Instinct Who Uses Smell as Medium
Ruben BaartDutch experience designer Leanne Wijnsma designs for the human instinct and puts the sense of smell back to where it belongs, as modern hazards have shifted to the digital realm.
ECO Coin Award Interviews: Shubhendu Sharma
Jack CaulfieldWe asked Shubhendu Sharm, our first ECO coin award nominee about his method, business and hopes for the future.
If you could have another sense, which sense would you choose?
Meike SchipperColor-blind artist Neil Harbisson designed a brain-implanted antenna that converts colors into sound. This enables him to hear colors he cannot see, and extends his vision to …
The world’s plastic problem is bigger than the ocean
Christopher J. PrestonAs you read this, a strange object that looks like a 2,000-foot floating pool noodle is drifting slowly through the central north Pacific Ocean. This object is designed to solve …
Exploring body architecture with Lucy McRae
Meike SchipperAs evolution goes on, the human body is evolving too. What does it mean to be human in times of advanced biotechnology and genetic engineering? Are our bodies ready for our …
Next Generation: Why Annie Larkins' egg project is essential for future food thinking
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Living robots made from frog stem cells may revolutionize medicine
Freya HutchingsAt just a millimeter wide, Xenobots are “neither a traditional robot nor a known species of animal", they are "a new class of artifact: a living, programmable organism”, says …
Next Generation: The speculative futures of Deborah Rhyner
NextNature.netThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
The new Next Nature book is here!
NextNature.netWe live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …
Notes on the plastisphere
Shahar LivneEvery piece of plastic that’s ever made, still exists. It results in a floating garbage dump in the ocean, full of life. While this (geo)design was never intentional, humans …
Deadline to save the World: 30th August
Koert van MensvoortPicnic Green Challenge calls upon people like you to invent a product or service that can help to save the world. Restore the planet's harmony and lets you win 500.000 Euro on the …
Gel Remote
Koert van MensvoortHuman-product relationships increasingly play out in a realm which was previously considered exclusive for human-human and human-animal relationships. Panasonic now redesigned one …
The Evolution of the Richer
Diogo CorreiaAre we on the verge of a future human evolution, one that isn’t, at least in it’s very core, “the survival of the fittest”, but rather “the evolution of the richer”? Think about …
How biotech will drive our evolution
Koert van MensvoortAre you ready for some techno-optimism? Buckle up and enjoy the ride with bio-tech evangelist Gregory Stock . Some quotes from his prophetic TED talk : "We are seizing control of …
Suffering from Anthropomorphobia?
Koert van MensvoortAnthropomorphobia is the fear of acknowledging qualities we wish to consider only human in non-human things. Sufferers from the condition used to have trouble mostly at fairs or …
Having Invented the Gods, Perhaps we can Turn into Them
Jason SilvaMy name is Jason Silva. I've spent the last 5 years hosting and producing a tv show on Al Gore's Emmy-winning Current TV network and I'm a fellow at the Hybrid Realities …
Disaster Edens: The Anti-Tourist Attraction
Allison GuyImagine your cruise to the Galapagos came with a ghoulish warning: "Your hair will fall out, your skin will blister, you'll probably get cancer and your children's children might …
The Earth on Loan
Allison GuyChristian Schwägerl is a correspondent for Der Spiegel and the author of Menschenzeit (The Age of Man). He will be presenting his views on the Anthropocene at the Next Nature …
Lions Relocate to the Suburbs
Allison GuyAs cities push to the edges of the wilderness, wild animals are increasingly com
End of Life Care Machine
Marco van BeersDesigner, artist and engineer Dan Chen has developed the ' End of Life Care Machine ', a machine designed to guide and comfort dying patients with a carefully scripted message. …
Nature is Dead, Long live Nature
Koert van MensvoortLike we did to old nature before, we must now cultivate our technological environment.
Anthropo-scene #1: From Rocks to Thoughts
ChristianHow geology and humanity turn ancient algae into high-tech gadgets.
Anthropo-scene #3: Morphing Earth, Piece by Piece
ChristianHumans act as bio-excavators that literally move mountains.
GM Mosquitoes: No Olfaction, No Sting
Alessia AndreottiEngineering mosquitoes to ignore the scent of human flesh.
Moments in Meat History Part I - Origins of Meat-eating and Hunting
Jonathon MarkowskiAbout 4 or 5 million years ago, major changes in the Earth's climate brought about grassland regions where giant mammals could graze.
Diseases Of The Future
Alessia AndreottiNowadays humans suffer from diseases that didn't exist in the past, a trend that will probably continue into the future. A wide range of new disorders, especially related to the …
Electronic Skin can Detect Magnetic Fields
Yunus Emre DuyarThere is a new artificial skin technology that could give humans magnetoception in the future.
The Golden Quarter
Michael HanlonSome of our greatest cultural and technological achievements took place between 1945 and 1971. Why has progress stalled?
But will lab-grown meat be kosher?
Benjamin Aldes WurgaftRead Benjamin Aldes Wurgaft's essay on judaism in relation to the production of laboratory-grown meat.
“Everything Is Already Invented”
Ingmar NieuweboerRobert Gordon says all the major inventions have been made, but that's only true for our limited knowledge of future possibilities.
From Homo Sapiens to Homo Optimus
Ioana TomiciWe are entering an age of technological singularity, in which artificial intelligence and biological enhancement are combined in order to construct the next stages of human evolution.
Interview: Pauline Van Dongen, Designer Merging Fashion and Technology
Margherita OlivoDutch fashion designer specialized in wearable technology, Pauline van Dongen researches the human body in relation to its surroundings.
Lunar Insurrection Vol.2: Harvest Moon
Daniel FragaLunar Insurrection is a group of architects that explores the creative possibilities of the moon as a potential territory for human activity and inhabitation. In Vol.2 , their …
Fellow Day: Next Senses
Ingmar NieuweboerOn June 17th a NNN Fellow Day was organized to explore the future project: Next Senses.
Racist Robots and Bloodthirsty Crowds
Daniel FragaIt took less than 24 hours for Twitter to corrupt an innocent AI bot and teach it morally repugnant things.
The Digital Mythology of... Super Mario
Daniel FragaMythology still surrounds us, we just relate to it differently. Games and movies have replaced pantheons and folk tales. Fairies and gnomes left the forests and the rivers and moved to virtual realities.
A Robot Will Spark the Next Avant-Garde
Nadine Roestenburg “An illegal theme park exposing the ideology of the aesthetics of hacking”. “A hybrid drone targeting technological domination”. “A psychedelic fridge to raise doubt about fake …
Jobs for Creators - Robots at Work #2
Mathilde NakkenHave a look at our series Robots at Work! In this episode we present you five jobs for creators, the ones that build with their hands.
Technosphere Weighs 30 Trillion Tons
Koert van MensvoortIf humans would disappear from the face of the Earth today, we would still leave 30 trillion tons of mass in the geological record. Certainly, "we were here" is written all over.
The Economy of Ecology
Lewis JustWhat if we could redesign the system to work for humanity and the planet we call home? What would the economy of ecology look like?
A happy birth day to Louise Brown
Hendrik-Jan GrievinkDear Louise Brown, On behalf of the future I would like to congratulate you on your birthday. It has been 40 years that you where born into this world on July 25th 1978, …
I like my steak lab-grown, not-grass fed
Angus HerveyRight now, somewhere in a laboratory in California, the Netherlands or Japan, a technician is taking a few thousand skeletal muscle cells from a living animal, and placing them in …
Interview: Designer Shahar Livne is geomimicing the future of plastics
Kelly StreekstraWe sat down with Shahar Livne, an Israeli-born designer who graduated from the Design Academy in Eindhoven to talk about her vision on the future of plastics.
Your next doctor might just be a robot
Jack CaulfieldConventional wisdom says that you can’t replace the human touch in terms of medical care, but in our rapidly changing technological environment, it appears that this perception …
Q: How will we co-evolve with technology?
Hendrik-Jan GrievinkThis question is an excerpt from the Pyramid of Technology toolkit Cooking is a process through which humans outsource part of their bodily functions to technology (think …
The social animals that are inspiring new behaviors for robot swarms
Edmund HuntFrom flocks of birds to fish schools in the sea, or towering termite mounds , many social groups in nature exist together to survive and thrive. This cooperative behaviour can be …
The religion named Artificial Intelligence
Linda ValentaWould you pray to a Robot deity? A group of Japanese buddhists is already doing so. Meet Mindar , the robot divinity shaped after the buddhist Goddess of Mercy, also known as …
What is a species?
Henry TaylorA koala bear isn’t actually a bear, it’s a marsupial. Whales aren’t fish, they’re mammals . Tomatoes aren’t vegetables, they’re fruit . Almost nothing is actually a nut . Peanuts, …
Interview Matilde Boelhouwer: Making urban environments flower again
Eloïse PeredrukMatilde Boelhouwer is a designer whose work speculates between art, design, science, biology and food. Matilde shapes this obligation into a studio which mainly focuses on the …
Is in vitro meat good news for animals?
NextNature.netThe Singapore Food Agency has approved “chicken bites” containing meat made from real chicken cells that were grown outside of a chicken’s body. Alongside similar news from Israel …
Swiping is the new touching
Nadine RoestenburgFrom all the memes that have reached me through my screen since the outbreak of the corona pandemic, there is one that perfectly reflects my thoughts in the beginning of March …
Homo Desktopus
Koert van MensvoortA future physical anthropologist who knows nothing about the human race and would dig up a contemporary desktop computer, might conclude homo desktopus must have been the user of …
Deliver us from Skeuomorph Prosthetics
Koert van MensvoortNo, this is not another example in our fake for real series , comparing an artificial with a human hand. Rather, you are looking at twice the same hand: with and without its …
Hyperfins
Tijn KooijmansThe next step in biomimetic body extentions for propelling yourself through water. Man moves on from copying ducks to become a dolphin-like cyborg. With these fins you can be …
Wrapping Greenland
kbohreThe Discovery series 'Ways to save the planet' the episode 'Wrapping Greenland ' shows how Dr. Jason Box uses reflective blankets to cover glaciers in Greenland. Due to global …
Ars Electronica 2010: Artists Adressing NextNature
Ties van de WerffSind wir noch zu retten? That was the slogan of this year’s Ars Electronica festival in Linz (Austria). Titled ‘REPAIR’, the media art festival urged to leave our scepticism and …
Razorius Gilletus – On the Origin of a Next Species
Koert van MensvoortIs the evolution of the single bladed razor into an exorbitant five–bladed vibrating gizmo the outcome of human needs, or is there another force in play? Say hello to Razorius …
11 Golden Rules of Anthropomorphism and Design: Introduction
NextNature.netWelcome to the 11 part series The Golden Rules of Anthropomorphism and Product Design. In this series, we will be examining how designers can better integrate human-like forms or …
Back to the Tribe
Koert van MensvoortTraditionally, technology is seen as a force that diminishes our instincts and puts us at a distance of nature. Increasingly however, we realize technology can also energize and …
Nintendo Portables Are Breeding Grounds For Sexy Fun
Vincent KlerkxSexuality and sensuality are phenomena which have been a nature for us as long as we humans exist. Not only humans experience these phenomena; also animals experience sexuality …
System Animals
Koert van MensvoortWhat animal is so naive to come into this world as a naked and crying infant, completely vulnerable, helpless, and an easy prey for any predator? Newborn lamb or giraffe’s babies …
The Sound of the Blue Canary
Berry EggenBlue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …
The Technological Sublime
Jos de MulThe sublime is an aesthetic concept of 'the exalted,' of beauty that is grand and dangerous. Through 17th and 18th century European intellectual tradition, the sublime became …
A More Interesting, More Depressing Theory of Easter Island's Downfall
Allison GuyA new theory claims it wasn't human deforestation that caused the ecological collapse of Easter Island, but something smaller and squeakier.
Interview: Jason Silva, Media Artist and Curator of Awe-Inspiring Ideas
Alessia AndreottiMedia artist, filmmaker and wonderjunkie Jason Silva talks about technological evolution and why humans are gods with anuses.
What Ant Colony Networks Can Tell Us About What’s Next for Digital Networks
Deborah GordonEver notice how ant colonies so successfully explore and exploit resources in the world … to find food at 4th of July picnics, for example? You may find it annoying. But as an …
Gene-Edited Micropigs Will Be Soon Sold As Pets
Wei Lun WangEarlier this year, a group of Chinese scientists published a paper about the modification of the genome of human embryos with the cutting-edge powerful technique called CRISPRs. …
Should Intelligent Sex Robots be Banned?
Daniel FragaThe Campaign Against Sex Robots, recently launched, is pushing towards banning the continuation of sex robots development.
Meet Yangyang, Actroid From China
Alessia AndreottiThe humanoid robot Yangyang can function autonomously, talking and gesturing while interacting with people.
Plastivore – A Bird that Feeds on Plastic
Koert van MensvoortThe speculative 'Plastivore' bird thrives on a diet of fungi and plastics.
Poem Passes the Turing Test
Yunus Emre DuyarZackary Scholl developed a program to produce a poem that passed the Turing Test.
Should We Fear Thinking Machines?
Maria RamosIt seems thinking machines could put the human race in danger. How realistic these fears are?
Artificial Senses for Navigation
Ruben BaartA team of cyborgs and digital enthusiasts developed a wearable technology for the body that perceives a human sixth sense.
Empowered by Robots Event Report
Mathilde NakkenA report on the Empowered by Robots conference during DDW16, demonstrating fruitful collaboration between humans and robots.
The First Artificial Intelligent Lawyer
Mathilde NakkenThere is an artificial intelligent robot called ROSS that is taking over the work of thousands of lawyers. Working non-stop, reading faster then any human attorney can do.
Augmented Biology: Growing Ears on Apples
Alejandro AlvarezA promising way to grow body parts: using an apple.
Solar Energy: the Hottest New Currency
Lewis JustEnergy-backed money could help transition humanity to a more sustainable world, both environmentally and economically.
The Modular Body
NextNature.netThe Modular Body is an online science fiction story by Floris Kaayk about the creation of OSCAR, a living organism built from human cells.
1932 - "Brave New World" Published
Hendrik-Jan GrievinkAldous Huxley published Brave New World in 1932, bringing the idea of the artificial uterus to the big audience.
Hire a Smart Robot
Daniel FragaWhat if your co-worker was a robot? Dutch startup Smart Robotics is a job agency for robots that allows you to hire a smart-robot.
A Truly Exotic Fruit: the Space Mango
Julie ReindlScientists sent mango embryos to space lab in order to let them develop new genetic traits.
How AI could revolutionize the teaching profession
Jack CaulfieldIn various parts of the world, access to education is, or risks becoming, a huge crisis. UNESCO estimates that around 20 million new teachers are needed worldwide - and that's not …
Call for projects: bring your groundbreaking creativity to tackle pressing energy issues
NextNature.netWe need to change the way we power our daily lives. Burning fossil fuels is the primary cause of climate change, yet this is still our main source of energy. Much of this energy …
Custom-grown bones, and other wild advances in regenerative medicine
Vanessa Bates RamirezThe human body has always been an incredible machine, from the grand feats of strength and athleticism it can accomplish down to the fine details of each vein, nerve, and cell. …
In Conversation with Marleen Hartjes: Introducing a digital door to the museum
Kelly StreekstraDon’t be surprised when you catch a human face on a screen strolling through the Van Abbe museum for contemporary art in Eindhoven, as these are Europe’s very first robotic …
This startup uses body heat to mine crypto
Camille CharluetWhile many love to speculate about the sheer number of jobs that robots and artificial intelligence are going to replace in the near future, no one seems to be coming up with any …
Air pollution may be making us less intelligent
Barbara MaherNot only is air pollution bad for our lungs and heart , it turns out it could actually be making us less intelligent, too. A recent study found that in elderly people living in …
This cool artificial reef was just deployed in Sydney Harbor
Vanessa Bates RamirezEarth’s oceans have seen better days. They’re inundated with plastic waste, both whole single-use plastics and tons of plastic microparticles that find their way back into our …
How Pokemon are affected by climate change
Ruben BaartYou know climate change is real when dead coral Pokemon start to wash up on (virtual) beaches. Behold, Cursola, world’s first dead coral Pokemon. On the origins of Cursola While …
Why electric cars should be allowed to drive faster
Koert van MensvoortIn response to the nitrogen crisis, the Dutch cabinet is planning to reduce the speed limit during the day to 100 kph. In itself a sensible decision. But it is strange that this …
299 trees grow in a football stadium
Ruben BaartSome centuries ago landscape painters taught us to appreciate the quality of an untouched landscape. Ever since we have been doing everything to recreate it. We camouflage cell …
Discussing bio-based material experiences with Elvin Karana
Meike SchipperThe world of design is in need of new materials that align with the urgency for sustainability. Issues such as climate change, plastic waste and harmful materials require us to …
In conversation with Studio Drift
Meike SchipperA flock of drones that fly like birds, drifting blocks of concrete, a choreography of opening and closing flowers. The work of Studio Drift is challenging the distinction between …
The beginner's guide to biohacking
Peter JoostenWhat is the first thing that comes to mind when you hear the term 'biohacking'? Perhaps you are now thinking of a bunch of kids sitting in their kitchen with a DNA kit, (wannabe) …
How Amazon trees write their own autobiographies
Chris HuntTropical forests are one of the world’s largest carbon stores and they help regulate the global climate. But they’re being erased at a terrifying rate. Deforestation claimed an …
(IM)POSSIBLE BODIES: Responsiblity and care in our cyborg future
NextNature.netWhat does it mean to become a cyborg? Better yet, aren't we cyborgs already? What then, does it mean to have a body? Is a 'standard' desirable, what does that even mean, and what …
POND: A symphony of lights and water
Nellie FriedrichHave you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …
‘We All Parent Earth’
Joyce NabuursLast week I was strolling through the aisles of the supermarket when I heard a buzzing sound coming from my pocket. I looked up from my cart and saw it was a message from …
Next Generation: Building Aquatecture with Shaakira Jassat
Eloïse PeredrukThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Cyborg mythologies #3: in god we trust, all others bring data
MaithriThis is #3 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …
Welcome to New Evoluon
NextNature.netToday our human impact on Earth is humongous. Climate change, plastic oceans, mass urbanization and deforestation. Scientist recently calculated the technosphere now outweighs the …
The World is not a Desktop
Mark Weiser (originally written for ACM Interactions ). What is the metaphor for the computer of the future? The intelligent agent? The television (multimedia)? The 3-D graphics …
Faustian Bargains and Pineapple Shampoo
Since the early days of the net, the electronic pastoral has lent itself to all sorts of dubious agendas pushed by science, the military and even libertarian tendencies. In the …
Doggerland – Mapping a Lost World
Koert van MensvoortSo you think climate change is new? So you think the flooding of landmass by the oceans is a new? So you must have not heard of the times when people walked from London to …
Synthetic biology demystified
Koert van Mensvoort://nextnature.net The expanding research culture of synthetic biology demystified in this TV item on the International Genetically Engineered Machine competition . Via Posthuman …
ECO Currency – A Proposal to Balance Economical and Environmental Value
Koert van MensvoortImagine we would have an alternative monetary currency for environmental value. Would the rain forest still be destroyed if there existed an ECO–currency to express its value and …
Self–Repairing Architecture
Rachel ArmstrongAll buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …
Take your transgenic kids to the CPNH
Allison GuyThe Center for PostNatural History doesn't house the dinosaurs or dioramas of your run-of-the-mill natural history museum. Instead, it's the first museum dedicated exclusively to …
Voodoo Phone
Koert van MensvoortJapanese professor Hiroshi Ishiguro from Osaka University has quite a track record of threading the uncanny valley. Remember his Doppelgänger Robot and Geminoid Female ? His …
Arne Hendriks – Incredible Shrinking Man
Koert van MensvoortArtist Arne Hendriks explores the possibilities and implications of downsizing the human species to better fit the earth.
Better Than Nature?
Rachel ArmstrongAt the turn of the millennium, miniaturized canines acquired the cherished status of living, designer handbag ornaments. These teeny tiny photogenic doggies, which had been …
Better Walking with Robotic Legs
Simon RiezebosThe Berkeley Robotics & Human Engineering Laboratory is researching a way to improve the performance of human bodies. They are doing innovative research in the field of …
Christian Schwägerl - Riding the Anthropocene
Koert van MensvoortChristian Schwägerl , freelance journalist and biologist, author of the book The Anthropocene: The Human Era and How It Shapes Our Planet , introduces us into the Anthropocene , a …
Monkeys Fall into the 'Uncanny Valley' Too
Koert van MensvoortThe uncanny valley, a phrase coined by Japanese robotic researcher Masahiro Mori nearly three decades ago, describes the uncanny feeling that occurs when people look at …
Artifice Earth: Adam Rutherford on the Promises of Synthetic Biology
NextNature.netAn interview about the history and promises of synthetic biology, and the problem with the word "nature".
Engineering Beneficial Parasites
Lloyd AlbertsBreeding parasites to improve immune function, skin tone and even resistance to poison.
Interview: Alexandra Daisy Ginsberg, Designer and Synthetic Biology Expert
Alessia AndreottiAn interview with Daisy Ginsberg, artist and synthetic biologist.
Beyond the Possible with Floris Kaayk
Koert van MensvoortFloris Kaayk, artist and fictive documentaries maker, confronts us with the impossible.
Reducing Plastic Bags by 80%
Julia WeberThe EU Commission will hopefully reduce the consumption of disposable plastic bags within 5 years by 80%.
The Power Amplification Robot
Alessia AndreottiPower Loader: the power amplification exoskeleton robot.
What’s the Point If We Can’t Have Fun?
David GraeberSince Darwin we tend to look at the biological world exclusively in economical terms. The idea that monkey's, frogs, or even ants do more than simply propagate, doesn't find much acceptance among scientists. And yet, even crayfishes at times seem to displace objects just for fun.
Anthropo-scene #10: From Thoughts to Geology
ChristianIt's more than two years since I have started this exploration of the Anthropocene for Next Nature for you. We have visited many places together, places I have traveled to as a …
Drugs Testing with Artificial Organs
Yunus Emre DuyarResearchers are working on artificial organs-on-chips will be used for drug development.
"The End": a Virtual Opera Singer, Millions of Fans and the Meaning of Death
Alexandra BremersSixteen-year-old Japanese singer Hatsune Miku grew in short time to a worldwide popstar. With her colourful appearance she counts millions of followers on social media, she …
Genome Editing - Bringing the Übermensch to a Shelf Near You
Daniel FragaLast April, a Chinese group of researchers published a paper that set the scientific world ablaze in a fierce debate. The paper was about their attempts to edit the DNA of a human …
Abandoning Modern Life to Live as a Goat
Wei Lun WangConceptual designer Thomas Thwaites is currently investigating and experiencing to live life as a goat.
Organs Could Self-Heal with Nanoneedles
Yunus Emre DuyarAn international team of scientists used nano-sized needles in order to promote production of new blood cells.
Which Technologies will 2016 Bring?
Wei Lun WangThe new year is right around the corner, let’s forget about long-term future for a while to check out what new tech trends will hit it big in 2016. At the end of every year, …
The Risk of Technological Unemployment
Daniel FragaStephen Hawking gives his opinion on what technological unemployment, aka machines taking over our jobs, can represent for future human societies.
The Hotel Run by Robots
Alessia AndreottiA futuristic Japanese hotel will be run by robots, designed to be extremely human-like.
Explore Mars with NASA's VR Experience
Margherita OlivoExploring the surface of Mars at least 15 years before a human being in flesh and blood will be able to, this is the new ambitious idea of the people at NASA.
What if Mosquitoes Were Only a Zoo Species?
Mathilde NakkenGenetic engineers are developing techniques to kill several types of mosquitoes.
Pigs Have a Heart for Us
Elise MarcusReplacing your old heart with a new heart from an animal may seem extreme? Well, this future may arrive sooner than we think.
Robots Are Making Pizza Now
Ruben BaartA new wave of automation lies in pizza. Not only will robots deliver your pizzas in the future, they will even make them.
Setting Aside Half the Earth for Nature
Ingmar NieuweboerE.O. Wilson, a respected biologist, has proposed a radical idea: set aside half of the planet as nature preserves.
This Indestructible Micro-Animal Will Help Us
Monika KozubWill a small step for Ramazzottius Varieornatus be a giant leap for mankind?
Welcome to the Age of Plastic
Margherita OlivoAccording to a new study, humankind is now entering the "Age of Plastic". The research investigates the evidence that we are living in the Anthropocene, a time in which humanity is the main geological force.
1916 - Artificial Womb Appeared in Cinema
Elle Zhan WeiIn 1916 the artificial womb made its first appearance on the big screen in the movie "Homunculus" by Otto Rippert.
1999 - Ectogenesis Enters The Matrix
Elle Zhan WeiThe movie The Matrix brought ectogenesis to the public eye.
Artificial Womb: the Timeline
NextNature.netNNN is currently doing a preliminary research into the idea of the artificial womb. This timeline will help you navigate through the investigation.
Artificial Womb Workshop at BioClub Tokyo
NextNature.netOn August 8, NNN gave a workshop at BioClub Tokyo to share some insights on the future of technologies concerning human reproduction, sexuality and relationships.
Dinner with Chef Watson
Ruben BaartChef Watson knows over 10.000 recipes. The highbrow robotic cook invited us over for dinner during the first Neo-Futurist Dinner at Mediamatic.
Interview: Lining Yao, Interaction Designer and Maker of Novel Materials
Alessia AndreottiWe recently interviewed Lining Yao, Chinese interaction designer who uses organic materials as a technology that brings us back to nature.
Next Nature Gift Guide 2017
NextNature.netThe gift giving season is once again upon us and to help out those who are struggling to find that perfect gift for that special someone we have brought together a collection of Next Nature inspired gifts.
Jobs for Caretakers - Robots at Work #1
Mathilde NakkenThis is post number one of our serie 'Robots at Work'. In this episode we present you five jobs for caretakers, the ones that work with their hearts.
Jobs for the Extraordinary-Robots at Work #5
Mathilde NakkenThis is post number five of our serie 'Robots at Work'. In this last episode we present you five jobs for the extraordinary, the ones who won't let themselves be categorized.
Scientists Create Ghost Heart
Julie ReindlThe Texas Heart Institute researches in the field of organ transplantation. With the “ghost heart” — an heart organ scrubbed clean of all its former cells, the researches are on the verge of creating a sustainable and effective way of transplanting organs.
How to Train Your Robot
Alejandro AlvarezHumans and robots can work together to maximize the potential of both and boost productivity to new levels.
This artwork lets trees tell the story of climate change
Linda ValentaIn our ongoing battle against climate change, it's hard to transcend from our human position and ‘think’ like nature. Given, nature doesn't think the way humans do, but it does …
Future AI may hallucinate and get depressed — just like the rest of us
Tristan GreeneScientists believe the introduction of a hormone-like system, such as the one found in the human brain, could give AI the ability to reason and make decisions like people do. …
Scientists accidentally create mutant enzyme that eats plastic bottles
Damian CarringtonScientists have created a mutant enzyme that breaks down plastic drinks bottles – by accident. The breakthrough could help solve the global plastic pollution crisis by enabling …
Open Call for ECO Coin Award 2018 Submissions
NextNature.netNominate an inspiring project, platform, person or community who is tackling food waste for the ECO Coin Award 2018
Face the future of intimacy with Kiiroo
Ruben BaartMeet the teledildonics, an ingenious species of bi-directionally controlled sextoys from the future, available today. These touch emulating vibrators find each other on social sex …
Why you should attend ADE Green
Ruben BaartADE Green returns for the seventh consecutive year to the DeLaMar Theater in Amsterdam. Once more, Amsterdam Dance Event organizes this leading event to ignite sustainable action, …
AI creates images of delicious food that doesn’t exist
Tristan GreeneA team of researchers from Tel-Aviv University developed a neural network capable of reading a recipe and generating an image of what the finished, cooked product would look like. …
These speculative 'Next Senses' allow you to augment your senses with technology
NextNature.netImagine you could communicate telepathically with a whale, listen to the WiFi networks in your environment, or experience smells through seeing color. Developments in technology …
Iceland is mourning a dead glacier
Rupert ReadDeath certificates and commemorative plaques aren’t something you’d normally associate with a glacier. But that is exactly how Iceland recently mourned the loss of 700-year-old …
Truly smart homes could help dementia patients live independently
Dorothy MonekossoYou might already have what’s often called a “smart home”, with your lights or music connected to voice-controlled technology such as Alexa or Siri. But when researchers talk …
A guide to parenting with AI Barbie
Siri BeerendsThe rise of artificial intelligence has brought us more advanced toys. If AI Barbie and her talking robotic friends are going to raise our kids, what would their parenting style …
Why half of the world's beaches could disappear by 2100
Simon Boxall and Abiy S. KebedeUp to half of the world’s sandy beaches are at risk of disappearing by the end of this century if no action is taken to limit greenhouse gas emissions. That’s according to a new …
Next Generation: Elissa Brunato's bio iridescent sequin shimmers with nature
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
Cyborg artist Moon Ribas feels earthquakes
Freya HutchingsImagine waking in the night, and feeling the vibrations of an earthquake on the other side of the world pulsing through your body. This is a reality for Catalan-born artist Moon …
Virtual makeup: maybe they're born with it, maybe it’s XR
Eloïse PeredrukAs our reality exists increasingly within digital realms, our virtual world demands a virtual identity. Our work is hybrid, our social identity is online and our connection is …
Cooling buildings with ultra-white paint
Andrew ParnellFrom icy tundras to billowing clouds, the colour white crops up repeatedly in our planet’s palette. This colour provides a natural way for light from the sun to reflect back from …
Enter the memesphere
Laura van den BrinkWhy memes might be the next tool to make sense of on our increasingly hybrid virtual and physical environment.
A Model's Body
Hendrik-Jan GrievinkDutch photographer Koen Hauser blends parts of the human body with parts from anatomical models. You know, the ones you had in biology class and gave you this fine colorful …
Friending, Ancient or Otherwise
By ALEX WRIGHT, Published in NY Times December 2, 2007 The growing popularity of social networking sites like Facebook , MySpace and Second Life has thrust many of us into a new …
Rhythm robot Keepon
Arnoud van den HeuvelThe goals of "understanding humanity" and "humanizing robots" are tightly related to each other. Infanoid Project is trying to relate robotics to human sciences in order to …
Remote pets
Arnoud van den HeuvelHumans have domesticated animals for thousands of years. The earliest known evidence of a domesticated dog is a jawbone found in a cave in Iraq and dated to about 12,000 years ago …
Tail communicator
Sara'The LED Dog Tail Communicator' is an initiative of James Auger and Jimmy Loizeau, and it is part of the larger 'Augmented Animals' project. Its focus points to technological …
Artificial 'Trees' to Stop Climate Change
Koert van MensvoortThe fabrication of forests with artificial trees is one of the best strategies to stop climate change, according to scientists of the Institution of Mechanical Engineers . The …
Bacteria that Turn CO2 into Energy
Koert van MensvoortWe’ve written earlier about man–made bacteria that eat waste & shit petrol . How about a genetically modified bacteria that can eat CO2 and excrete methane that could power …
DrinkPeeDrinkPeeDrinkPee
Arnoud van den HeuvelDrinkpeedrinkpeedrinkpee is a project by Britta Riley and Rebecca Bray about the role our bodies play in larger ecosystems. It's an installation about the Urine to Fertilzer DIY …
Ear on your arm? Why not?!
ewesFor over 40 years Australian artist Stelios Arcadious Stelarc has made art with medical instruments, prosthetics, robots, virtual reality systems and biotechnology to investigate …
Liberate the Breast Cancer Genes
Arnoud van den HeuvelOn May 12, 2009 the ACLU and the (not-for-profit) Public Patent Foundation, filed a lawsuit, charging that patents on two human genes associated with breast and ovarian cancer are …
Mapping the DNA World
Koert van MensvoortDNA related tools, once expensive and restricted to research and crime labs, are rapidly becoming affordable. Like GPS – once a high-tech wonder now turned into a everyday gadget …
Plastic Birds
Koert van MensvoortBird spotting is not a typical activity for us next nature explorers, yet occasionally we bump into some birds worth mentioning (remember the amazing copy-paste bird , rubber duck …
Supermarket – Our Next Savanna
Koert van MensvoortWe are living in the future and we find it boring. The best place to gather evidence for this claim is the supermarket. To begin with, try and have a fresh look at the word: …
Tattooed Goldfishes
Koert van MensvoortIf a tattooed pig is a bit too much for you, why not go for a tattooed goldfish? They bring you lost of luck and are available Chinese characters such as “Wealth, Dragon, …
Think Hello
Arnoud van den HeuvelRemember Asimo ? Honda has now developped a new Brain-Machine Interface technology that allows humans to control the humanoid robot simply by thinking certain thoughts. The BMI …
Cultivating the Money-verse
Orestis TsinalisAlright, we were mistaken. Money isn't virtual after all. A recent TV commercial of a Greek bank shed light on the issue. Your money lives, is anthropomorphic and inhabits an …
Geminoid Female
Arnoud van den HeuvelProfessor Hiroshi Ishiguro ( Intelligent Robotics Laboratory at Osaska University) has done it again! This time in coöperation with robot-maker Kokoro Co. Ltd . Objective: to …
Next Nature Movie #1: Quest for Fire
Koert van MensvoortThe Quest for Fire (1981) shows the Next Nature of 80.000 BC. Set in a world without highways, supermarkets, airports, Internet, television, farming, money or written language, …
Next Nature Movie #3: Koyaanisqatsi
Koert van MensvoortKoyaanisqatsi (1982) is a film with no actors, no storyline, and no dialogue. The only things we see are landscapes, images of cities, and people going about their regular lives. …
US Judge Rules Gene Patents Invalid ?because they are Natural
Koert van MensvoortDid you know that about 20 percent of your body isn't really yours? It has been patented by some corporation you probably never heard of. You can't patent gold, you can't patent …
American Hyperbodies
Allison GuyLady Gaga is famous for fashion that exaggerates or obscures her body, but a few months ago, she made a foray into 'actual' body-modification. Gaga appeared on Jay Leno's talk …
Birdfeeders spit Blackcaps in two species
Koert van MensvoortUntil now, most people have likely regarded bird-feeders as merely a pleasant addition to their gardens. But scientists have now discovered that bird-feeders in the UK are …
City Rats Love Ethnic Food
Allison GuyCity rats, it seems, prefer the same foods that humans do: Greasy, fatty, sweet, and salty. Although rats are usually seen as the billy goats of city life, ready to chow down on …
Evolutionary Janitors
Allison GuyWe normally think of polluted water as the source of disease, not the cure for it. The Gowanus Canal in Brooklyn, affectionately known as the Super Fun Superfund , is one of the …
Flap to Freedom
René RiegerIt works like this. Position yourself with a friend in front of a battery hen and flap your arms as fast as you can when the music sets in. The harder you flap the faster your …
![Visual of Manko & Life [#8]](https://nextnature.net/media/pages/magazine/story/2011/manko-life-8/f762250e48-1602632753/manco-8-868x486.jpg)
Manko & Life [#8]
Aston RevolaManko sighed. Nada: 'Did you like it?' Manko: 'I have to admit that if this is the starter, I'm not sure I'll survive the main course.' Everyone at the table laughed. Manko: 'Let …
Mapping the Utilisphere
Allison GuyEarth has had a geosphere, atmosphere and biosphere for a few billion years. Only within the last several thousand years has earth gained a global noosphere, the intangible …
Next Nature Services
Bas HaringIntentionality separates culture from nature. A dog is intentional, a fox is not; a park is intentional, a forest is not. Since trash, ruined buildings, and automated computer …
Protei, the Sail Bot that Cleans Up Oil
Allison GuyProtei is a sailing robot that's designed to clean up oil spills without human assistance. After sailing upwind, the bot drifts downwind, zigg-zagging across the surface to absorb …
The Cat Parasite that Sells Motorcycles
Allison GuyThe protozoa Toxoplasma gondii makes an unobtrusive home in nearly every warm-blooded species, but it's prolific life is limited: Toxo can only reproduce in cat stomachs. The …
The Incredible Shrinking Man
Lisa van der VoortIt has been a trend for people to grow taller and taller during the evolution. When people get taller, they will need more energy, food and space. Since the human population is …
The Soul is a Plastic Bag
Allison GuyIn the film Plastic Bag , the title character spends a lifetime (or more) on a quest for a creator not even aware of his existence. A stunning short by Ramin Bahrani, director of …
A Clockwork Forest
Hendrik-Jan GrievinkHas nature become a fairytale or do we want it to be one? In their installation The Clockwork Forest , artist collective Greyworld seems to opt for the latter. The work of art …
A Fake Sun for Your 25/7 Life
Allison GuyThe earth operates on a 24 hour cycle, and so do humans. For most of history, we didn't have much choice in the matter. However, in the absence of visual cues light sunlight, some …
Bonobos (And Maybe Baboons) Domesticated Themselves
Allison GuyWhile evidence indicates that humans domesticated themselves , we're not the only primates capable of self-domestication. Bonobos and baboons have shown they are just as capable …
Rule #7: Respect Social Standards
NextNature.netAnthropomorphic products enter the human social space. Humans have the most complex social behavior of any organism on Earth. Anyone or anything trying to join in should be careful to do it right.
Is Life on Earth Suicidal?
Allison GuyAt Next Nature, we often argue that "our image of nature as static, balanced and harmonious is naive and up for reconsideration ." Paleontologist Peter J. Ward happens to agree. …
Where Be Dragons? Try Your Instinctual Fear of Snakes
Allison GuyThis last Monday rang in the Chinese Year of the Dragon. Not restricted just to the benevolent, snake-like creature of Chinese mythology, or to the greedy, princess-stealing …
A Frankenstein-esque System
Fenna Klein TuenteThe boundary between humans and machines is slowly but steadily blurring. The Immortal is a machine which exists out of several life-support machines connected with wires and electric cords.
A Lifetime of Questions through Google
Hendrik-Jan GrievinkGoogle becomes the authority on existential questions about aging.
Customizing the Brain with Psychoactives
Jan Willem van der LindenIt’s long been a desire of the human species to have complete control over our own thoughts. We’ve all had these moments where we curse our brain. Asking questions like: “Why …
EcoBot III: a Robot that Produces Energy Fueled by Organic Matter
Alessia AndreottiThere are robots that look like people, and then there are robots, like the Ecobot III, that look nothing like humans but have our same biological needs: they have to eat, digest …
Electric Skin Could Allow Robots to Feel
Koert van MensvoortA new kind of piezotronic transistor mesh could make for robotic skin that’s as sensitive as your own is, covered in thousands of tiny mechanical hairs.
Fuel Your Body With Algae Headgear
Alessia AndreottiAlgae as the future alternative fuel for the human body.
Why Meat Grown in Labs is the Next Logical Step for Food Production
Avy RoyLab grown meat is part of the trajectory that agricultural technology is already following.
What Will We Look Like in 100,000 Years?
Alessia AndreottiIn 100,000 years human beings might look like a manga character: big intense eyes, high forehead, large head, straight nose, more pigmented skin, and perfect symmetry. “There will …
How Technology becomes Nature
NextNature.netIn this talk at TEDxGhent, our own Dr. Van Mensvoort shows how technology becomes nature in seven steps and what engineers, inventors, designers and entrepreneurs can learn from that.
In Vitro Meat: Animal Liberation?
NextNature.netMany people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.
Painting the Anthropocene
Alessia AndreottiGovedare paints the human impact on natural environments, showing how nature has become a subset of culture.
The Earth As You've Never Seen It Before
Alessia AndreottiBreathtaking satellite images that will change how you see the World.
Transportations Of The Future
Francesca BarchiesiA selection of nine enthralling and striking concepts of future way of transportation.
Cities Evolve in Similar Ways as Galaxies
Koert van MensvoortScientists think the laws governing the structure of galaxies in outer space are the same laws underlying the growth of cities.
Did a Robot Grow your Vegetable?
Alessia AndreottiThe world’s largest indoor farm is not the only firm developing vertical agriculture. Japanese company Spread plans to grow more than ten million heads of lettuce a year by …
Dynamic Exoskeleton Chair
Svetlana MironcikaAn exoskeleton chair that allows the body to move freely.
IBM Predicts Artificial Intelligence Future
Koert van MensvoortWhile the Watson technology is exponentially increasing its processing power on an annual basis and steadily moving from answering trivia questions, to cooking advice, onto medical advice, it is about time we confront it with the million dollar question: "Watson, what do you want?".
Meet the Band Aid of the Future
Margherita OlivoThis potentially revolutionary device includes LED lights and temperature sensors to provide medication directly to the wounded section of the skin.
Our Bodies, Our Fuel
Adriene LillyThis piece from Ars Technica details the breadth in the variety of energy sources emitting from our every day interactions.
Stewart Helps People to Trust Self-Driving Car
Erik van der VeenStewart is a tactile interface that mediates the communication between human and self-driving car.
Stratospheric Sky Garden with Proto Life
Alessia AndreottiA sky garden of cacti and artificial life forms floating a hundred thousand feet above the Earth's surface.
How Technology is Becoming More and More Sensitive
Margherita OlivoOver the past decade scientists have tried to get technology surfaces to be as sensitive as our skin, especially as our fingertips. Human tact is a very sophisticate interface …
Turning Poop Back Into Food
Alessia AndreottiNasa funded a program to turn astronauts’ poop into food.
AI Teenage Girl Hit by Depression
Ruben BaartAn AI was intended to improve human-like experiences in regards to the company’s customer service chatbots, but has fallen into a suicidal depression instead.
C-Sections Caused an Evolutionary Change
Mathilde NakkenC-sections have an unexpected side effect on human evolution. Newborn heads are getting bigger, while the mothers birth cannals are becoming smaller.
Colorless coral: How climate change is affecting the great barrier reef
Jack CaulfieldOur peculiar image of the week comes from the Great Barrier Reef. You've probably seen images of this vibrant underwater attraction before. If you're lucky, maybe you've seen it …
When FB Replaced Editors with Algorithm
Ruben BaartFacebook had just fired their curatorial team for the ‘Trending’ news section over an algorithm, resulting in false stories attacking a news anchor, a writer, and Mac Donald’s.
Evolution Will Change the Way We Sleep
Margherita OlivoA group of researchers is working to optimize the way we sleep, increasing our relaxation, and therefore reducing the time devoted to our naps.
Getting Wasted on Plastics
Lewis JustA new community currency that rewards recyclers with local discounts and deals.
How We Domesticated Food
Margherita OlivoWe tend to believe that the fruit and the vegetables we eat today are "natural" and the same as they always were. It turns out that in the past this familiar food didn't look like this at all.
Designer Dave Hakkens is putting plastic waste to better use
Ruben BaartWe recently handed this year’s ECO Coin Award to Dutch designer Dave Hakkens, founder of the Precious Plastic movement. With his open sourced recycling machines, he provides people around the world the knowledge to start recycling plastic locally.
Landfills Cause Changes in Bird Migration
Margherita OlivoGarbage dumps may not be very attractive places for us but they sure are for animals. A study published in Science Advances shows how certain groups of storks modified (and …
Medical Practice Aided by Robots
Ioana TomiciRobots in health care could lead to a doctorless hospital.
The New Era of Tourism is Underwater
Margherita OlivoSleeping underwater has always been your dream? Thanks to an ambitious project it will be soon reality.
Are Robots the Future of Tattoos?
Ruben BaartAn industrial robot just tattooed the first person ever in San Francisco.
Storing Knowledge for Eternity
Margherita OlivoResearchers discovered a way to store data in five dimensions on a nano structured glass able to survive for billion of years.
The Supermarket with No Employees
Alessia AndreottiThis automated store in Sweden doesn’t have any human employees, only a smartphone app.
Vacation in the Era of Marine Pollution
Megan Ray NicholsWhile we can’t just leave the coast permanently without upsetting the delicate balance of this new environment we created, we can take better care of it to ensure that it is around for years to come.
2017 - Artificial Womb Incubates Fetal Lamb
Elle Zhan WeiA lamb born at the equivalent of 23 weeks in a human gestational period was kept alive in an artificial womb and developed just as if it was in a normal womb.
Artificial Intelligence Learns to Smell
Julie Reindl22 teams of computer scientists have unveiled a set of algorithms able to predict the odor of different molecules based on their chemical structure. Computers learn how humans smell
Digital Detox: Disconnect to Reconnect?
Nadine RoestenburgDo you feel information overloaded? Do you experience stress? Do you feel like you are addicted to your smartphone, laptop, or the Internet? Get yourself digital detoxed!
Explore Depths from Your Chair
Mathilde NakkenTo explore deep sea Standfort University developed OceanOne: a humanoid diving robot, which at the same time creates a simulation of the underwater experience on land.
Female Menstrual Cycle on a Computer Chip
Julie ReindlThe complicated system of a female menstruation cycle was reproduced on a computer chip for the first time.
A Floating Gym in Paris
Ruben BaartThis floating gym harnesses human energy to sail down the Seine River in Paris.
HUBOT: Meet the Robot Coach
NextNature.netCraftsmanship is generally very appreciated, but it takes a lot of time to master a craft. Therefore, as a robot coach you train - you guessed it, a robot - to transfer your …
The New Male Birth Control
Ruben BaartA new contraceptive has appeared on the horizon, bringing the prospect of an alternative form of male birth control one step closer.
Preventive Punishment for Robots
Elle Zhan WeiThe Punishment is an installation featuring a robotic arm that mimics a kid's handwriting perfectly, and repetitively writes "I must not hurt humans".
Jobs for Facilitators - Robots at Work #3
Mathilde NakkenThis is post number three of our serie 'Robots at Work'. In this episode we present you five jobs for facilitators, the ones who love to work with technology.
Building a City on Mars by 2117
Elle Zhan WeiThe United Arab Emirates released plans to build a city on Mars.
Untouched Nature? Not in the Amazon
Alejandro AlvarezThe Amazonian rainforest was already transformed over two thousand years ago by people who built hundreds of large, mysterious earthworks.
This bio-brick is made out of urine mixed with sand and bacteria
Helen SwinglerThe world’s first bio-brick grown from human urine has been unveiled by University of Cape Town (UCT) master’s student in civil engineering Suzanne Lambert, signalling an …
Towards a design brief for the artificial womb
NextNature.netHumanity is facing the disconnection between biological reproduction and the body, facilitated by the emerging technology of the Artificial Womb. Envisioned in bleak science …
Edible packaging: Seaweed could replace plastic in disposable packaging
Jack CaulfieldWhat to do about the plastic planet ? The seas are steadily filling up with plastic , and it's vital to find ways to address the problem . One way to do this is to move away from …
Next hospitals: How virtual reality is shaping the future of medicine
Jack CaulfieldAnd it’s already showing incredible results. VR transports us to faraway worlds without even asking us to leave our chairs. Yet we usually hear about it in the context of video …
