Video Game-Playing Robot Acts More "Human" than Humans
Allison GuyComputer-controlled players in video games can usually be spotted for their repetitive, illogical or unemotional behavior. Unlike humans, non-player characters (NPCs) don't get …
Computer-controlled players in video games can usually be spotted for their repetitive, illogical or unemotional behavior. Unlike humans, non-player characters (NPCs) don't get …
' Team Human ' is a manifesto—a fiery distillation of media theorist Douglas Rushkoff’s most urgent thoughts on civilization and human nature. In one hundred lean and incisive …
Principle number four: Humane technology should resonate with the human senses, rather than numbing them. If you're an office worker or a video game fanatic , you may spend most …
Humans and other hominids have a reputation for bringing about mass extinctions. Homo erectus has been blamed for the disappearance of many African carnivores, our ancestors …
Buckle up for a new video from our favorite performance philosopher Jason Silva: To Be Human Is To Be Transhuman.
Humanity has for a long time considered itself the most important species on the planet. We are quite happy to share the world with other species, but we think we know who's in …
NNN director Koert van Mensvoort writes a letter to humanity.
And now for the sixth and final principle: Humane technology improves the human condition and helps people realize the dreams they have of themselves. No matter what your …
Our second principle: Humane technology revives human intuitions, in particular those we might have forgotten about. 'Conventional' technology aims to overcome our hominid …
The third principle of humane technology: It should take human values as a cornerstone of its development. Technology doesn't have to be expensive or electronic to be humane. …
When you look through a super-telescope, you can still see the planet Earth. Once called the blue planet, she now looks red and parched. We had no choice but to abandon her… On a …
New technologies – from artificial intelligence to synthetic biology – are set to alter the world, the human condition, and our very being in ways that are hard to imagine. The …
We must be mindful about how we engage with technology: what we use it for, why, and whether it helps us or hinders us. Sometimes our tech seems to be flowing in inhumane …
Around the world thousands of people are on organ donor waiting lists. While some of those people will receive the organ transplants they need in time, the sad reality is that …
Stick-on shoes, wakeup lights, bionic limbs: these are examples of humane technology. But what exactly does this mean? It can best be explained in contrast with its opposite. …
We must be mindful about how we engage with technology: what we use it for, why, and whether it helps or hinders us. Sometimes our tech seems to be flowing in inhumane directions, …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
In 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …
What if design began to put everything but the human first? The needs of the human not paramount to the design process, but instead the other entities that we cohabit planet earth …
The nature of humanity in the twenty-first century is, according to sociologist Steve Fuller, a ‘bipolar disorder’ beset with dualisms of identification such as divine/animal, …
Meet Humanity beyond Race, it's Beautiful
Dutch mechanical-engineer Jarnos Smeets dreams of flying like bird. Nothing new really, many people have had this dream for ages. Yet being an engineer and all, Jarnos is seriously propelling his dream towards a reality.
Occupying the 52nd floor of Tokyo’s Mori Tower, Mori Art Museum is internationally renowned for its visionary approach and highly original curation of contemporary art. The …
The artificial womb is on the verge of becoming a reality, but how it will affect our culture is for us to decide.
As we go about our daily activities, we may lose sight of our connections with nonhuman life. Here are three exhibitions to encourage you to step outside of your everyday and …
Written by Kevin Kelly , published in The Technium . I claim that technology has its own agenda. What is the evidence that technology as a whole, or the technium as I call it, is …
Pair-bonding sets humans apart from our relatives. But where did it come from?
The SAVE THE HUMANS! book is now available on our web shop.
Featuring different cities at night, the Next Nature Glowing Planet T-shirt highlights the enchanting beauty of our glimmering world.
Scientists keeping a human embryo alive in lab for 13 days for the first time.
Is human activity altering the planet on a scale comparable to major geological events of the past? Scientists are now considering whether to officially designate a new …
In Ngogo, Gombe and elsewhere in Africa, bands of male chimpanzees regularly make organized raids on neighboring troops and batter their enemies to death. These grim, warring …
The definition of the noosphere as "the sphere of human thought on earth" is woefully anthropocentric. It ignores that fact that our fellow sentient organisms have noospheres of …
Wu Tzu-ning presents a posthuman reality from genetic engineering to digital afterlife.
Human test subjects felt empathy for dinosaur robots being cuddled or abused.
In 2016 a team of biologists has successfully kept a human embryo alive in the lab for 13 days, breaking the previous record of nine days.
Interview witth TEDx on how people are technological by nature, yet how we also need humane technology to remain human, or become even more human than we are today.
We tend to think of plastic as a cheap, inferior and ugly material used to make children’s toys, garden furniture and throwaway bottles. But as an experiment, imagine for a moment …
Eating meat has made us who we are today: evolved, intelligent humans, able to use a verbal language.
Read the Letter to Humanity in Morse Code.
On the occasion of the Earth Day, 22 April 2017, philosopher Koert van Mensvoort wrote his Letter to Humanity.
Intensive agriculture may be nourishing most of the Earth’s inhabitants, but it’s doing the opposite to earth itself. Its dependence on singular crops, heavy ploughing machinery, …
Global warming is "very likely" a human-caused problem that will last for centuries and require concerted international action to reduce its potentially devastating impacts, a …
We call upon you, dear readers, to participate in a new publication from the Next Nature Network: SAVE THE HUMANS!.
By Karen Kaplan, Los Angeles Times , December 11, 2007 The pace of human evolution has been increasing at a stunning rate since our ancestors began spreading through Europe, Asia …
What are the characteristics of the perfect leader? The answer could be found looking at nature.
Next Thursday, February 11, the Hoxton Hotel in Amsterdam dedicates an evening to our newest publication: 'Save the Humans!'
Scientists in the UK applied for permission to create part-cow, part-human embryos for research aimed at treating diseases such as Parkinson's and Alzheimer's. The embryos created …
Humans are the only species on earth that cooks its food. Not only do we cook our food, but we usually find the flavor of cooked foods preferable to the raw version. Compare the …
All too often, technology frustrates us. It forces our behavior into constrained pathways. Even more insidious, technology can knock us out of alignment with our values, goals or …
Principle number five: Humane technology doesn't outsource people, but instead empowers them. How healthy or humane is it to have an escalator to the gym? Humane technology should …
The human body as an instrument is a cool example of how culture and nature are merging. Calvin Harris used a giant human synthesizer to perform his single. The material used is …
The increasing ‘liveliness’ of machines and accessibility to the virtual world has raised questions about whether it is possible to uncouple the mind from the body in through a …
Nissan’s Engineers Are Creepily Trying To Replicate Human Skin
For our new book "Save the Human" we invite you to submit quotes that question the autonomy of mankind in the digital computer era and study the future of the independent creative spirit.
Company Blue Frontiers wants to build 7.500 square meters of floating city made up of linked platforms, starting 2018. They hope to complete it by 2020.
Imagine being 16 and studying for a job that soon won't exist. What kind of future is that? New occupations will come thanks to robotization.
This question is an excerpt from the Pyramid of Technology toolkit In the late nineties, the Tamagotchi egg was released. A small egg-shaped device that contained a digital …
Lots of clouds this week. The peculiar picture above shows the eruption of mount Pinatubo in 1991, which apparently resulted in a certain amount of global cooling (next to some …
Arne Hendricks thinks we can solve the ecological crisis by shrinking every human on earth to 50cm tall: http://bit.ly/sxxNr1 #powershow
The American Chemical Society has announced a new method of producing gelatin that sounds like good news for cannibals and the canni-curious. Researchers are able to create …
So you thought the Internet was made by and for people? Think again. A study by Incapsula , a provider of cloud-based security for web sites (mind you where this data comes from), …
Krill, those tiny members of the ocean's planktonic community, have an importance disproportionate to their size. They are a vital food for whales, penguins and increasingly, …
Historian Yuval Noah Harari takes us on a journey through the whole human history.
Scientists have been trying to develop GM pigs that could be used to solve the shortage of organs for transplant patients.
If we'll ever get to go to Mars as tourists , we wouldn't get lost. Ordnance Survey , the official British mapping agency, recently released a new detailed map of the Red Planet. …
In 16th and 17th centuries, some medical theory believed that a miniature human body can be produced in a flask by an alchemist.
I never expected anthropomorphobia to be evoked by a fish! This hybrid species fish was born between a carp and a leather carp in the pond of a personal house in Chongju. Each of …
"We live in a time where everything or everyone can be upgraded or ‘pimped'. After the worldwide acceptance of plastic surgery, it was time to subject our worldly possessions …
All living creates produce light by default, so do humans . Now researchers from US, China, Korea and Singapore collaborated have collaborated in order to create ultra-thin …
Alveoli in human lungs serve as the inspiration for designing better, stronger ways of storing compressed natural gas.
The food writer Bee Wilson, author of Consider the Fork , has put forth a surprising theory about forks and teeth that has received widespread online coverage. According to …
All humans on Earth put together are not enough to fill the Grand Canyon. We are so small yet so present.
Robots are coming to replace humans at work, are they a real threat to the world’s unemployed?
Three minutes in the mind of Juan Enriquez, director of Synthetic Genomics.
A musical robot able to improvise a jazz solo in response to an actual person performing jazz.
Is human cloning here? Chinese scientist is ready to clone people at his ‘replication factory’.
Go world champion Ke Jie has lost two games of 'Go' against Google's DeepMind AI system AlphaGo.
Imagine a graveyard without tombstones, instead there are growing trees that contain genetic material of the deceased people burried there. Biopresence creates Human DNA trees by …
Think of this sonic vibe-technology inside any MP3 player ;)
What will the human race look like in 1, 2, 3, 4 million years? Will it be one human race? Will there be a human race? Impressions of future scenario's must come from scientists, …
Artist Nadine Jarvis fabricates pencils from carbon left over of cremated humans -- it's part of a larger "research project into post mortem." She notes that "240 pencils can be …
Starting next spring, a complete human-genome sequence can be ordered the Californian startup Complete Genomics for just $5,000, Techreview reports. Currently sequencing still …
Modern society seems to have transformed human nature into a pathology. Our emotions are controlled by drugs. We are forced to operate within a narrow bandwith of what are …
Anthropomorphobic object of the week. Created by Sarah Hatch .
For a while now printer ink is probably the most expensive liquid per litre on earth. Still we need our images so badly that we accept this fact. The Human Printer manages to make …
"It's time to recognize the Internet as a basic human right" its inventor Sir Tim Berners-Lee has said.
AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …
I think all Nature has a fractal structure, from Planet to Atoms. Website: Fractalary: Fractals from Planet to Atoms
This peculiar, half-human creature could be your cousin. No really; it is a sculpture by Patricia Piccinini entitled The Young Family , which, in turn, is part of a larger …
Fleshmap touch investigates the collective perception of erogenous zones. Hundreds of people ranked how good it would feel to touch or be touched by a lover in different points of …
As a gamer, I come across many visions of possible futures. But this trailer from the upcoming video game Deus Ex: Human Revolution , the third part in the Deus Ex series shocked …
The economic system and profit motive has been a driving force that steers and even dictates social change. Investors and stockbrokers have been a major influence to these social …
Clothing giant H&M no longer uses real humans in its online catalog. The company has admitted that it pastes real models' heads on computer-generated bodies. At least there's …
Part 10 in the 11 part series Anthropomorphism and Design . The hidden danger with interactive products is that they will become so good at fulfilling our needs that they start to …
Researchers in the US have been shocked to discover a beluga whale whose vocalisations were remarkably close to human speech.
Just when you thought the Second Life hype was long gone, meet Ukrainian body artist Valerie Lukyanova who aims to turn Second Life into First Life. They call her the Human …
Imagine the devastation when there are more Lego minifigs on Earth than humans...
The Human Hamster Wheel Desk is the latest result of workspace evolution. Office work has domesticated us!
A new biotech startup seeks to hack our cells to use solar energy instead of carbon and oxygen.
To thread the uncanny valley is a conscious choice for many artists and enthusiasts, as a means to evoke, through their work, powerful emotions, thoughts and everything in between.
De Motu is an interactive music app that let you experience your body through music and influence the sound with your own body.
This video by Nature explains the complexity of networks on our planet.
Artist Lauren McCarthy launched a project called LAUREN in which she embodies a eponymous human smart home assistant.
Under the title Human Nature, designing the equilibrium, eleven designers will answer questions about a future in which Humankind and Nature enter into a new relationship. An …
Gene editing is advancing at a faster pace than most of us can keep up with. One significant recent announcement was gene editing tool CRISPR’s application to non-genetic diseases …
Driving long distances without a passenger can be lonely. If you’ve ever done it, you might have wished for a companion to talk to – someone emotionally intelligent who can …
Eric Hoffer (1902-1983) You dehumanize a man as much by returning him to nature - by making him one with rocks, vegetation, and animals - as by turning him into a machine. Both …
A tribute to the virtual world boomeranging back to the physical world by Mega64 . Or do you rather prefer the corny japanese gameshow version? Via Engadget ,
Why not use the human body to grow products for the medical industry? The designer Michael Burton envisions Future Farm where the body is used as a farm to cultivate clinical and …
Our peculiar image of the week was created by artist Levi van Veluw , who reinvents the classical fine art of landscape painting, by moving from the traditional 'oil on canvas' to …
Within our society, imitation and simulation are typically seen as inferior symbols of a distorted mediated culture – think of fake Rolexes, plastic Christmas trees, silicone …
Much attention has recently been devoted to 'gay' animals. It's not the fact that many species have enthusiastic homosexual lives that should be surprising – there are convincing …
Part 8 of the 11 part series Anthropomorphism and Design . Anthropomorphic products blur the boundaries between products and people. Ethical norms for people don’t usually apply …
In combining the classic feeling of handling a book with the interactivity of the computer, Waldek W?grzyn of the Academy of Fine Arts in Katowice, Poland, has created a new human-computer interface.
Will writing software eventually replace journalists?
Artist Maja Smrekar modified yeast with her own DNA to produce human lactic acid.
Workers are completely controlled by algorithms in Amazon's fulfillment center
Warning, this video on the impact of automation on human labor might cause you to re-plot you professional career.
New media technology from South Korea: a gigantic human display compiled from supporters cheering their soccer teams . One pixel per supporter. See also: Skyscreen , A4 e-paper .
Dolphins in Port Adelaide, Australia, have been observed performing a remarkable trick : tail-walking, a trait so rare it has only been seen in the wild one other time. More …
Cake or death? Cake! The Slice cake is a (vegetarian) vision of the forms lab-grown meat may take in the future.
What does Barbie look like when she has the proportions of a normal 19-year-old?
Buckle up for a cinematic espresso shot from performance philosopher and NNN ambassador Jason Silva.
French performance artist hatches 10 hen's eggs in Palais de Tokyo.
Lyrebird is an AI model capable of synthesizing anyone’s voice from just a one-minute audio sample.
This unpractical yet not less pretty anthropomorphic furniture piece was created by photographer David Blazques . We are clueless on whether it is in permanent use, yet it serves …
Just a project for now, but a far more creative way to deal with unsightly public works than tree-shaped antennas.
There’s no place on earth untouched by human activity: This was clear as Lucas Foglia whizzed across the vast, white expanse of Alaska's Juneau Ice Field last summer. He was …
What makes us human? And why do we sometimes fear artificial intelligence? And what about technological singularity - the moment in time when artificial intelligence outperforms …
With the invention of the radio antenna in the late 19th century, we became a different species: Introducing the human insect. A species, able to communicate across oceans using …
Are you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …
Nature has always been a source of inspiration for many artists and designers, yet the urgency to connect to nature is more pressing than ever. Environmental issues such as …
Read Nicholas Carr's essay on the transhumanist dream of having wings.
We had the honor of hosting Bruce Sterling in our Next Nature Network headquarters to talk to him about the concept of the convergence of humans and machines.
Speculative designer Agi Haines' work focuses on (re)designing the human body, and speculates upon future scenarios.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
Floris Kayak discusses online hoaxes and the future of technology.
Bioprinter creates bespoke lab-grown body parts for transplant.
A psychiatrist argues that beer gave us civilization - but do intoxicants play a deeper evolutionary role than that?
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
The connection we share through the Internet has laid the foundation for a whole new digital infrastructure, in which blockchain technology is heralded by many believers for being …
Meet the 'Eco-Visionaries' , these are the architects, artists and designers who respond to some of the most urgent ecological issues of our times. This exhibition reveals how …
Sen is a space television network that provides visuals from other planets in order to prepare us for our multi-planetary life.
New study suggests that the real environmental problem is embodied in the things we buy.
Is the use of personal devices becoming a replacement for the spectrum of emotions that make us all humans?
Our bodies are microbiomes, suffering from our habit of cleanliness.
Nigel Gifford is developing a drone that will be relatively inexpensive, disposable and edible.
You are what you eat; a quite common message in the midst of our self-growth society. We have to eat well to become the best version of ourselves - more productive, healthier …
The ultimate personal hygiene product, feces odor tablets, is another Japanese innovation sold by the Takano Yori Beauty Clinic . These pills promise to make your excrement …
For the first time in history the world population counts more people who are too fat than too thin.
Now that the team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …
I remember the smoke the most. That pungent smell permeating the camps of tribal people. Everything they touch is infused with the lingering perfume of smoke – their food, …
If Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …
Previously, experiences of time emerged from nature as given – offering seasons, the rhythm of humans, plants and animals. Nowadays, people integrate nature-time, body-time, inner-time, clock-time, and global 24/7 systems-time. Human beings, in past, current and next natures, have to deal with emergence and design of time in order to survive.
When techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …
A stunning pre-history of the anthropocene
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
When I was a kid, my parents took me to the beach every summer. We’d swim in the ocean and play on our inflatable raft in the surf. When the tide was low, I’d build a sand castle …
Do humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.
Marxist philosopher Slavoj Žižek discusses the 'naturalization' of capitalism and how ecology became a new field of capitalist investment. He also argues that the ultimate …
Today we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …
Technology is nestling itself within us and between us, has knowledge about us and can act just like us.
For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …
How technology becomes nature in seven steps
We have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.
This project - the Next Nature Network - is about Nature's brand image. One might surmise that "Nature," being 100 percent all-natural, can't have any brand image. The facts …
Like it or loathe it, the robot revolution is now well underway and the futures described by writers such as Isaac Asimov , Frederik Pohl and Philip K. Dick are fast turning from …
The introductory essay from the Yes, Naturally book - available in our store!
We recently spoke to Ilari Laamanen, to peel the outcrops of Momemtum9, and unveil the overlapping themes to the next nature philosophy.
Our deficiencies have always driven us, even among our distant ancestors, back in the last Ice Age. Having neither the speed and strength to hunt large prey, nor sharp teeth and …
For years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …
Make no mistake, you're not looking at the latest Barbie line: These are the The Pussycat Dolls. Formerly an LA stripper show burlesque show, now upgraded to be pop music …
In configuring our next nature, artists and scientists explore new languages that move beyond the Anthropocene - the era of human beings. These semantics would bridge the gap …
We live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …
In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …
From nutrients within an organism, to organisms within collectives, to populations within a territory and so on - nature offers models on how to deal with highly complex systems.
The human environmental impact on our planet is hardly underestimated nowadays. Scientist agree humans are to blame for Global Warming – some are already dreaming up scenario’s of …
Invasive species become the animal symbols for a man-made world.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Digital and genetic techniques increasingly influence life. Our belief in progress through technology stands in the way of a moral debate on this development. By Rinie van Est We …
During the event The Biosphere Code, Stockholm University researcher Victor Galaz and colleagues outlined a manifesto for algorithms in the environment.
A Dutch artist designs a Utopian eco-socialist online society.
The next step is to embrace and celebrate how cultural artifacts are escaping control, becoming autonomous, and forming the “next nature”.
Interview with Liam Young on his work in speculative architecture, the future, and our role in nature as humans.
There it is. A hefty hen, with its head up high and its beak out. And a gigantic VR headset over its beady little eyes. What does this battery hen see? ‘An experience of a free …
The first time I explained biomimicry to a stranger was not in a talk or a workshop but in a big-box bookstore just after Biomimicry: Innovation Inspired by Nature had come out. I …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Let’s talk about the most controversial of "m words"—monogamy. And let’s have this conversation with in mind its prehistoric origins. Our modern picture of prehistoric societies …
At the edge of the woods along the motorway near the Dutch town of Bloemendaal, there stands a mobile telephone mast disguised as a pine tree. This mast is not nature: at best, it …
The history of art through the ages reveals a constancy that, by conscious or unconscious applications, provides us with an omnipresent correlation dealing with the …
Rachel Armstrong discusses living buildings, Venice's foundations, millennial nature and how to improve our future.
Every day brings fresh and ever more alarming news about the state of the global environment. To speak of mere “climate change” is inadequate now, for we are in a “ climate …
Imagine if everyone spoke a language that you don’t understand. It’s not a foreign language–it’s been spoken around you since the day you were born–but where as everyone else …
One of the arguments that environmentalists use against factory farming and burning fossil fuels is that these activities are "unnatural" or that they "go against nature." But …
A respected astrobiologist argues that a radical new process called geoengineering might be the only way to save us from climate change.
Last month I had the opportunity to immerse myself in Tokyo’s newly opened digital art landscape, the Mori Digital Art Museum. The museum stands out for it enables virtual …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and plot your …
Our bodies are maps of our ancestor's social lives. We evolved, physically and behaviorally, in incredibly complex social groups. Such intense sociability may have favored the …
We humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.
The idea that AI can compose electronic music may sound a little off to people. It raises essential questions about creativity as a product exclusive to humans: can an AI be …
What do in-vitro human skin, spider silk and cow manure have in common? They are all unlikely materials that can cloth, protect and inspire humans, as realized by award-winning …
Steven Levy writes in Wired on the unexpected turn of the Artificial Intelligence revolution: rather than whole artificial minds, it consists of a rich bestiary of digital fauna, …
Google's PlaNet will be soon able to tell you where a photograph was taken by simply looking at its contents.
We talked with Bas Haring to discuss the conception, image and will of the robot. Read our conversation with him and update your ideas about robots.
A large-scale asian food market serving in vitro meat, a transatlantic expo on the future of nature and a travelling exhibition that explores our relationship with AI. These five …
Is social media ruining the world? Dramatic political polarization. Rising anxiety and depression. An uptick in teen suicide rates. Misinformation that spreads like wildfire. The …
There is a domain of creatures that diffusively encircles an entire planet. There are so many of them that they occupy every conceivable ecological niche. Yet, despite their …
Artist Arne Hendriks gave a lustrous talk on the possibilities of downsizing humanity to better fit the earth.
In this essay, anti-civilization, anarchist philosopher John Zerzan critiques the concept of 'next nature.' He argues that rather than freeing us, our self-domestication through …
In vitro meat has the capacity to transform meat production as we know it, introducing an entirely new way of thinking about and interacting with food.
As if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …
Written by Werner Lippert & Peter Wippermann, Curators of the Entryparadise exhibition (26/8 until 3/12, 2006, at Kohlenwäsche, Zollverein) Design is about to undergo a …
The Singularity , as popularized by Ray Kurtzweil, refers to a near term, theoretical time when machine intelligence greatly surpasses our own. At this point we will experience a …
Technology helps us understand the unfolding of the Anthropocene.
A recent study demonstrated how artificial light is a serious threat to plant pollination. It puts plant reproduction in danger, as well as the whole ecosystem.
Scientists developed a procedure to repair your heart with a spinach leaf.
A gadget called HumanCharger promises "the sun in your pocket" to give you energy, by beaming light through your ears.
A team of German researchers published a study earlier this week indicating people can be duped into leaving a robot turned on just because it “asks” them to. The …
Biotechnology is nearly as old as humanity itself. The food you eat and the pets you love? You can thank our ancestors for kickstarting the agricultural revolution, using …
We live in turbulent times. Thanks to science and technology, we are able to perceive our environment down to the atomic level. We can read DNA, manipulate cells, cut and paste …
John Zerzan, published in Green Anarchy issue #24 - Spring/Summer 2007 The rapidly mounting toll of modern life is worse than we could have imagined. A metamorphosis rushes …
The Made and the Born: Neo-Biological civillization, written by Kevin Kelly, excerpt from Out of Control : The New Biology of Machines, Social Systems and the Economic World, …
From chef, to nurse, and also lover. Get ready, a new generation of robots is going to invade our lives!
A road safety campaign in the Australian state of Victoria exposed an educational, yet confronting picture to raise awareness to the vulnerable human body on the road.
Interview with Mike Thompson and Susana Cámara Leret.
Robots are getting stronger and smarter every day. They are taking over our whole lives. How long will I have my job before a robot steals it?
A rosy-cheeked kid learns her first words, cries when her babysitter leaves, smiles when she’s happy, but she’s not real. BabyX is an AI research-in-progress by a company named Soul Machines.
Over time, our bodies, our food and our environment have become more and more subject to design. As designers, we hold the responsibility and have the unique chance to envision …
Would you like a dog snout, cat eyes or fluffy bunny ears? The choice is yours. Virtual selfie filters have become a widespread phenomenon on social media platforms such as …
This story is part of Next Generation, a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
In science fiction and popular science, 2030 is often suggested as the year in which our planet will run out of oil. Similarly, 2100 will be the year that, according to …
Pink chickens, synthesized tiger penises and salads grown from bodily fluids - how could they shape our future? In a Next Nature collaboration with the Gogbot Festival, the …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Erich Berger has a 96 year old grandmother who is a cyborg. She features dentures, hearing aids, glasses, pace maker, a metal implant on the pinkie toe, and more. Quotes from the …
We humans simply feel more comfortable with technological change when it comes in a familiar form that refers to an existing and accepted object, habit, value, tradition or intuition.
Meet Amelia, the first robot to work along with human coworkers in a council job.
Researchers prove that pristine landscapes haven’t existed for thousands of years, therefore we should change or mindset before trying to save the planet.
Ecosexuality reconceptualizes our perspective on the biosphere by having consensual experiences with it.
How can we design a cryptocurrency for the better of humanity and ecology? In this last chapter of the crypto deep dive series , we will dissect two kinds of blockchain …
Last week, the gene editing world was hit by news the equivalent of a nuclear bomb. In a video on YouTube , Dr. Jiankui He at Southern University of Science and Technology in …
As modern humans, we are out of balance with our natural environment. With use of technology, we try to prolong our human lifespan and create materials that live longer than we …
Humans have been manipulating living things for thousands of years. Examples of early biotechnologies include domesticating plants and animals and then selectively breeding them …
Surrounded by greyness and with the air around you having a dusty, burnt taste; for a long time this is what it has been like to live in many of the world’s highly polluted …
With great pleasure we announce our plans for 2021-2024: ‘Hello, Superorganism’ . Our human presence has a huge impact on the planet; plastic in the oceans, climate change, mass …
For many people, the most distressing part of the coronavirus pandemic is the idea of social isolation. If we get ill, we quarantine ourselves for the protection of others. But …
The first essay ever written on Next Nature, published in Next Nature Pocket and in Entry Paradise, New Design Worlds . ( download pdf ) (German version: Erkundungen im Nächste …
An interviewer once asked Pablo Picasso why he paints such strange pictures instead of painting things the way they are. Picasso asks the man what he means. The man then takes out …
This years edition of the Ars Electronica festival , which has been hangout for international experts from the arts and sciences for almost three decades, focuses on the nature …
Recently, a video clip has been circulating the web that purportedly shows a rabbit born earless due to the radiation at Fukushima. BoingBoing has a convincing take-down of the …
Hendriks’s activity explores the positive transformative power of creative impulses and the importance of fundamental free scientific research.
The Actroid robot holds clues for climbing out of the uncanny valley.
An "electronic personhood" for robots has been discussed in the European Parliament recently, raising big questions about equality, citizenship, legal and ironically, human rights for artificial intelligent machines.
The sun sustains our planetary system. Its energy fuels life. And in the future, the sun will also fuel our cars. That’s the premise of Dutch startup Lightyear, a startup specialized in solar powered electric cars.
Sophia the Humanoid, a human-like robot in appearance and mannerisms, was granted citizenship by Saudi Arabia and became the first robot with citizenship.
A Swedish shopping center is bucking the trend of mindless consumption. At the ReTuna Återbruksgalleria every product is made of recycled materials.
The new Next Nature book is here ! Next Nature fellows, ambassadors, members and newly interested people came together on the 4th of June to celebrate the book launch with a …
Historians often trace the dawn of human civilisation back 10,000 years, when Neolithic tribes first settled and began farming in the Fertile Crescent, which stretches through …
Today we cannot meet, touch or hug our loved ones. And while we all like the feeling of the touch of another human being, physical contact does not just feel nice, it is crucial …
Patricia Piccinini is an artist interested in the relationship between humans and non-humans, the natural and the artificial, science and storytelling. Working with silicone, …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
A Pomeranian dog in Hong Kong grabbed the international media’s attention this week after scientists found traces of coronavirus in the canine. Following confirmation that the …
Here, you are allowed to design your reproductive lifestyle and intimate relationships without any biological, economical and technological limitations.
Picture this: it's 40,000 years ago, and you are an early Homo sapiens. You are standing on the savanna. Look around you. What do you see? No billboards, no traffic signs, no …
Look around you and try to find the most natural thing in the room you are in now. It is you. Now, you wouldn’t be so sure in the apocalyptic Los Angeles of 2019 depicted in Blade …
Recent work of artist Jalila Essaïdi exemplifies of how science and art can meet and create meaningful inventions for society. Jalila Essaïdi used the spider silk produced by …
In 2009 the Initiative for Science, Society and Policy coined the phrase ‘living technology’ [1] to draw attention to a group of emerging technologies that are useful because they …
Some months ago we wrote about the dream of mechanical-engineer Jarno Smeets to fly like bird . Over the last few months Jarno worked steadily to materialize his dream. Today …
If you happen to be in the neighborhood you might want to drop by at the exhibition Post Natural Organisms of the European Union in Amsterdam. The small but delicate expo, curated …
During the late 1930’s the philosopher Walter Benjamin wrote its widely influential essay ‘The work of Art in the Age of Its Technical Reproducibility’. While describing a general …
Climate change is one of the biggest challenges of today and various scenarios, ranging from artificial trees , pollution trading , co2 capturing to geo-engineering, have been …
British philosopher David Pearce believes we should to stop animals from hunting and killing other animals.
Bio-hackers developed a protocol to augment human sight to see into the near infrared range.
Due to human action, 1300 bird species are seriously in decline. Other birds have learned to live with humans and profit from their presence.
We recently talk to Nadine Bongaerts about the role and impact of synthetic biology, the gap between biosciences and society and the importance of communication to overcome the fear of new technologies.
Dystopian future scenarios filled with evil robots are everywhere. We are afraid of robots treating us badly, but what will happen if it'll be the other way around? According to …
Dutch experience designer Leanne Wijnsma designs for the human instinct and puts the sense of smell back to where it belongs, as modern hazards have shifted to the digital realm.
We asked Shubhendu Sharm, our first ECO coin award nominee about his method, business and hopes for the future.
Color-blind artist Neil Harbisson designed a brain-implanted antenna that converts colors into sound. This enables him to hear colors he cannot see, and extends his vision to …
As you read this, a strange object that looks like a 2,000-foot floating pool noodle is drifting slowly through the central north Pacific Ocean. This object is designed to solve …
As evolution goes on, the human body is evolving too. What does it mean to be human in times of advanced biotechnology and genetic engineering? Are our bodies ready for our …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
At just a millimeter wide, Xenobots are “neither a traditional robot nor a known species of animal", they are "a new class of artifact: a living, programmable organism”, says …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
We live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …
Picnic Green Challenge calls upon people like you to invent a product or service that can help to save the world. Restore the planet's harmony and lets you win 500.000 Euro on the …
Human-product relationships increasingly play out in a realm which was previously considered exclusive for human-human and human-animal relationships. Panasonic now redesigned one …
Are we on the verge of a future human evolution, one that isn’t, at least in it’s very core, “the survival of the fittest”, but rather “the evolution of the richer”? Think about …
Are you ready for some techno-optimism? Buckle up and enjoy the ride with bio-tech evangelist Gregory Stock . Some quotes from his prophetic TED talk : "We are seizing control of …
Anthropomorphobia is the fear of acknowledging qualities we wish to consider only human in non-human things. Sufferers from the condition used to have trouble mostly at fairs or …
My name is Jason Silva. I've spent the last 5 years hosting and producing a tv show on Al Gore's Emmy-winning Current TV network and I'm a fellow at the Hybrid Realities …
Imagine your cruise to the Galapagos came with a ghoulish warning: "Your hair will fall out, your skin will blister, you'll probably get cancer and your children's children might …
Christian Schwägerl is a correspondent for Der Spiegel and the author of Menschenzeit (The Age of Man). He will be presenting his views on the Anthropocene at the Next Nature …
As cities push to the edges of the wilderness, wild animals are increasingly com
Designer, artist and engineer Dan Chen has developed the ' End of Life Care Machine ', a machine designed to guide and comfort dying patients with a carefully scripted message. …
Like we did to old nature before, we must now cultivate our technological environment.
How geology and humanity turn ancient algae into high-tech gadgets.
Humans act as bio-excavators that literally move mountains.
Engineering mosquitoes to ignore the scent of human flesh.
About 4 or 5 million years ago, major changes in the Earth's climate brought about grassland regions where giant mammals could graze.
Nowadays humans suffer from diseases that didn't exist in the past, a trend that will probably continue into the future. A wide range of new disorders, especially related to the …
There is a new artificial skin technology that could give humans magnetoception in the future.
Some of our greatest cultural and technological achievements took place between 1945 and 1971. Why has progress stalled?
Read Benjamin Aldes Wurgaft's essay on judaism in relation to the production of laboratory-grown meat.
Robert Gordon says all the major inventions have been made, but that's only true for our limited knowledge of future possibilities.
We are entering an age of technological singularity, in which artificial intelligence and biological enhancement are combined in order to construct the next stages of human evolution.
Dutch fashion designer specialized in wearable technology, Pauline van Dongen researches the human body in relation to its surroundings.
Lunar Insurrection is a group of architects that explores the creative possibilities of the moon as a potential territory for human activity and inhabitation. In Vol.2 , their …
On June 17th a NNN Fellow Day was organized to explore the future project: Next Senses.
It took less than 24 hours for Twitter to corrupt an innocent AI bot and teach it morally repugnant things.
Mythology still surrounds us, we just relate to it differently. Games and movies have replaced pantheons and folk tales. Fairies and gnomes left the forests and the rivers and moved to virtual realities.
“An illegal theme park exposing the ideology of the aesthetics of hacking”. “A hybrid drone targeting technological domination”. “A psychedelic fridge to raise doubt about fake …
Have a look at our series Robots at Work! In this episode we present you five jobs for creators, the ones that build with their hands.
If humans would disappear from the face of the Earth today, we would still leave 30 trillion tons of mass in the geological record. Certainly, "we were here" is written all over.
What if we could redesign the system to work for humanity and the planet we call home? What would the economy of ecology look like?
Dear Louise Brown, On behalf of the future I would like to congratulate you on your birthday. It has been 40 years that you where born into this world on July 25th 1978, …
Right now, somewhere in a laboratory in California, the Netherlands or Japan, a technician is taking a few thousand skeletal muscle cells from a living animal, and placing them in …
We sat down with Shahar Livne, an Israeli-born designer who graduated from the Design Academy in Eindhoven to talk about her vision on the future of plastics.
Conventional wisdom says that you can’t replace the human touch in terms of medical care, but in our rapidly changing technological environment, it appears that this perception …
This question is an excerpt from the Pyramid of Technology toolkit Cooking is a process through which humans outsource part of their bodily functions to technology (think …
From flocks of birds to fish schools in the sea, or towering termite mounds , many social groups in nature exist together to survive and thrive. This cooperative behaviour can be …
Would you pray to a Robot deity? A group of Japanese buddhists is already doing so. Meet Mindar , the robot divinity shaped after the buddhist Goddess of Mercy, also known as …
A koala bear isn’t actually a bear, it’s a marsupial. Whales aren’t fish, they’re mammals . Tomatoes aren’t vegetables, they’re fruit . Almost nothing is actually a nut . Peanuts, …
Matilde Boelhouwer is a designer whose work speculates between art, design, science, biology and food. Matilde shapes this obligation into a studio which mainly focuses on the …
The Singapore Food Agency has approved “chicken bites” containing meat made from real chicken cells that were grown outside of a chicken’s body. Alongside similar news from Israel …
From all the memes that have reached me through my screen since the outbreak of the corona pandemic, there is one that perfectly reflects my thoughts in the beginning of March …
A future physical anthropologist who knows nothing about the human race and would dig up a contemporary desktop computer, might conclude homo desktopus must have been the user of …
No, this is not another example in our fake for real series , comparing an artificial with a human hand. Rather, you are looking at twice the same hand: with and without its …
The next step in biomimetic body extentions for propelling yourself through water. Man moves on from copying ducks to become a dolphin-like cyborg. With these fins you can be …
The Discovery series 'Ways to save the planet' the episode 'Wrapping Greenland ' shows how Dr. Jason Box uses reflective blankets to cover glaciers in Greenland. Due to global …
Sind wir noch zu retten? That was the slogan of this year’s Ars Electronica festival in Linz (Austria). Titled ‘REPAIR’, the media art festival urged to leave our scepticism and …
Is the evolution of the single bladed razor into an exorbitant five–bladed vibrating gizmo the outcome of human needs, or is there another force in play? Say hello to Razorius …
Welcome to the 11 part series The Golden Rules of Anthropomorphism and Product Design. In this series, we will be examining how designers can better integrate human-like forms or …
Traditionally, technology is seen as a force that diminishes our instincts and puts us at a distance of nature. Increasingly however, we realize technology can also energize and …
Sexuality and sensuality are phenomena which have been a nature for us as long as we humans exist. Not only humans experience these phenomena; also animals experience sexuality …
What animal is so naive to come into this world as a naked and crying infant, completely vulnerable, helpless, and an easy prey for any predator? Newborn lamb or giraffe’s babies …
Blue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …
The sublime is an aesthetic concept of 'the exalted,' of beauty that is grand and dangerous. Through 17th and 18th century European intellectual tradition, the sublime became …
A new theory claims it wasn't human deforestation that caused the ecological collapse of Easter Island, but something smaller and squeakier.
Media artist, filmmaker and wonderjunkie Jason Silva talks about technological evolution and why humans are gods with anuses.
Ever notice how ant colonies so successfully explore and exploit resources in the world … to find food at 4th of July picnics, for example? You may find it annoying. But as an …
Earlier this year, a group of Chinese scientists published a paper about the modification of the genome of human embryos with the cutting-edge powerful technique called CRISPRs. …
The Campaign Against Sex Robots, recently launched, is pushing towards banning the continuation of sex robots development.
The humanoid robot Yangyang can function autonomously, talking and gesturing while interacting with people.
The speculative 'Plastivore' bird thrives on a diet of fungi and plastics.
Zackary Scholl developed a program to produce a poem that passed the Turing Test.
It seems thinking machines could put the human race in danger. How realistic these fears are?
A team of cyborgs and digital enthusiasts developed a wearable technology for the body that perceives a human sixth sense.
A report on the Empowered by Robots conference during DDW16, demonstrating fruitful collaboration between humans and robots.
There is an artificial intelligent robot called ROSS that is taking over the work of thousands of lawyers. Working non-stop, reading faster then any human attorney can do.
A promising way to grow body parts: using an apple.
Energy-backed money could help transition humanity to a more sustainable world, both environmentally and economically.
The Modular Body is an online science fiction story by Floris Kaayk about the creation of OSCAR, a living organism built from human cells.
Aldous Huxley published Brave New World in 1932, bringing the idea of the artificial uterus to the big audience.
What if your co-worker was a robot? Dutch startup Smart Robotics is a job agency for robots that allows you to hire a smart-robot.
Scientists sent mango embryos to space lab in order to let them develop new genetic traits.
In various parts of the world, access to education is, or risks becoming, a huge crisis. UNESCO estimates that around 20 million new teachers are needed worldwide - and that's not …
We need to change the way we power our daily lives. Burning fossil fuels is the primary cause of climate change, yet this is still our main source of energy. Much of this energy …
The human body has always been an incredible machine, from the grand feats of strength and athleticism it can accomplish down to the fine details of each vein, nerve, and cell. …
Don’t be surprised when you catch a human face on a screen strolling through the Van Abbe museum for contemporary art in Eindhoven, as these are Europe’s very first robotic …
While many love to speculate about the sheer number of jobs that robots and artificial intelligence are going to replace in the near future, no one seems to be coming up with any …
Not only is air pollution bad for our lungs and heart , it turns out it could actually be making us less intelligent, too. A recent study found that in elderly people living in …
Earth’s oceans have seen better days. They’re inundated with plastic waste, both whole single-use plastics and tons of plastic microparticles that find their way back into our …
You know climate change is real when dead coral Pokemon start to wash up on (virtual) beaches. Behold, Cursola, world’s first dead coral Pokemon. On the origins of Cursola While …
In response to the nitrogen crisis, the Dutch cabinet is planning to reduce the speed limit during the day to 100 kph. In itself a sensible decision. But it is strange that this …
Some centuries ago landscape painters taught us to appreciate the quality of an untouched landscape. Ever since we have been doing everything to recreate it. We camouflage cell …
The world of design is in need of new materials that align with the urgency for sustainability. Issues such as climate change, plastic waste and harmful materials require us to …
A flock of drones that fly like birds, drifting blocks of concrete, a choreography of opening and closing flowers. The work of Studio Drift is challenging the distinction between …
What is the first thing that comes to mind when you hear the term 'biohacking'? Perhaps you are now thinking of a bunch of kids sitting in their kitchen with a DNA kit, (wannabe) …
Tropical forests are one of the world’s largest carbon stores and they help regulate the global climate. But they’re being erased at a terrifying rate. Deforestation claimed an …
What does it mean to become a cyborg? Better yet, aren't we cyborgs already? What then, does it mean to have a body? Is a 'standard' desirable, what does that even mean, and what …
Have you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …
Last week I was strolling through the aisles of the supermarket when I heard a buzzing sound coming from my pocket. I looked up from my cart and saw it was a message from …
Today our human impact on Earth is humongous. Climate change, plastic oceans, mass urbanization and deforestation. Scientist recently calculated the technosphere now outweighs the …
Mark Weiser (originally written for ACM Interactions ). What is the metaphor for the computer of the future? The intelligent agent? The television (multimedia)? The 3-D graphics …
Since the early days of the net, the electronic pastoral has lent itself to all sorts of dubious agendas pushed by science, the military and even libertarian tendencies. In the …
So you think climate change is new? So you think the flooding of landmass by the oceans is a new? So you must have not heard of the times when people walked from London to …
://nextnature.net The expanding research culture of synthetic biology demystified in this TV item on the International Genetically Engineered Machine competition . Via Posthuman …
Imagine we would have an alternative monetary currency for environmental value. Would the rain forest still be destroyed if there existed an ECO–currency to express its value and …
All buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …
The Center for PostNatural History doesn't house the dinosaurs or dioramas of your run-of-the-mill natural history museum. Instead, it's the first museum dedicated exclusively to …
Japanese professor Hiroshi Ishiguro from Osaka University has quite a track record of threading the uncanny valley. Remember his Doppelgänger Robot and Geminoid Female ? His …
Artist Arne Hendriks explores the possibilities and implications of downsizing the human species to better fit the earth.
At the turn of the millennium, miniaturized canines acquired the cherished status of living, designer handbag ornaments. These teeny tiny photogenic doggies, which had been …
The Berkeley Robotics & Human Engineering Laboratory is researching a way to improve the performance of human bodies. They are doing innovative research in the field of …
Christian Schwägerl , freelance journalist and biologist, author of the book The Anthropocene: The Human Era and How It Shapes Our Planet , introduces us into the Anthropocene , a …
The uncanny valley, a phrase coined by Japanese robotic researcher Masahiro Mori nearly three decades ago, describes the uncanny feeling that occurs when people look at …
An interview about the history and promises of synthetic biology, and the problem with the word "nature".
Breeding parasites to improve immune function, skin tone and even resistance to poison.
An interview with Daisy Ginsberg, artist and synthetic biologist.
Floris Kaayk, artist and fictive documentaries maker, confronts us with the impossible.
The EU Commission will hopefully reduce the consumption of disposable plastic bags within 5 years by 80%.
Power Loader: the power amplification exoskeleton robot.
Since Darwin we tend to look at the biological world exclusively in economical terms. The idea that monkey's, frogs, or even ants do more than simply propagate, doesn't find much acceptance among scientists. And yet, even crayfishes at times seem to displace objects just for fun.
It's more than two years since I have started this exploration of the Anthropocene for Next Nature for you. We have visited many places together, places I have traveled to as a …
Researchers are working on artificial organs-on-chips will be used for drug development.
Sixteen-year-old Japanese singer Hatsune Miku grew in short time to a worldwide popstar. With her colourful appearance she counts millions of followers on social media, she …
Last April, a Chinese group of researchers published a paper that set the scientific world ablaze in a fierce debate. The paper was about their attempts to edit the DNA of a human …
Conceptual designer Thomas Thwaites is currently investigating and experiencing to live life as a goat.
An international team of scientists used nano-sized needles in order to promote production of new blood cells.
The new year is right around the corner, let’s forget about long-term future for a while to check out what new tech trends will hit it big in 2016. At the end of every year, …
Stephen Hawking gives his opinion on what technological unemployment, aka machines taking over our jobs, can represent for future human societies.
A futuristic Japanese hotel will be run by robots, designed to be extremely human-like.
Exploring the surface of Mars at least 15 years before a human being in flesh and blood will be able to, this is the new ambitious idea of the people at NASA.
Genetic engineers are developing techniques to kill several types of mosquitoes.
Replacing your old heart with a new heart from an animal may seem extreme? Well, this future may arrive sooner than we think.
A new wave of automation lies in pizza. Not only will robots deliver your pizzas in the future, they will even make them.
E.O. Wilson, a respected biologist, has proposed a radical idea: set aside half of the planet as nature preserves.
Will a small step for Ramazzottius Varieornatus be a giant leap for mankind?
According to a new study, humankind is now entering the "Age of Plastic". The research investigates the evidence that we are living in the Anthropocene, a time in which humanity is the main geological force.
In 1916 the artificial womb made its first appearance on the big screen in the movie "Homunculus" by Otto Rippert.
The movie The Matrix brought ectogenesis to the public eye.
NNN is currently doing a preliminary research into the idea of the artificial womb. This timeline will help you navigate through the investigation.
On August 8, NNN gave a workshop at BioClub Tokyo to share some insights on the future of technologies concerning human reproduction, sexuality and relationships.
Chef Watson knows over 10.000 recipes. The highbrow robotic cook invited us over for dinner during the first Neo-Futurist Dinner at Mediamatic.
We recently interviewed Lining Yao, Chinese interaction designer who uses organic materials as a technology that brings us back to nature.
The gift giving season is once again upon us and to help out those who are struggling to find that perfect gift for that special someone we have brought together a collection of Next Nature inspired gifts.
This is post number one of our serie 'Robots at Work'. In this episode we present you five jobs for caretakers, the ones that work with their hearts.
This is post number five of our serie 'Robots at Work'. In this last episode we present you five jobs for the extraordinary, the ones who won't let themselves be categorized.
The Texas Heart Institute researches in the field of organ transplantation. With the “ghost heart” — an heart organ scrubbed clean of all its former cells, the researches are on the verge of creating a sustainable and effective way of transplanting organs.
Humans and robots can work together to maximize the potential of both and boost productivity to new levels.
In our ongoing battle against climate change, it's hard to transcend from our human position and ‘think’ like nature. Given, nature doesn't think the way humans do, but it does …
Scientists believe the introduction of a hormone-like system, such as the one found in the human brain, could give AI the ability to reason and make decisions like people do. …
Scientists have created a mutant enzyme that breaks down plastic drinks bottles – by accident. The breakthrough could help solve the global plastic pollution crisis by enabling …
Nominate an inspiring project, platform, person or community who is tackling food waste for the ECO Coin Award 2018
Meet the teledildonics, an ingenious species of bi-directionally controlled sextoys from the future, available today. These touch emulating vibrators find each other on social sex …
ADE Green returns for the seventh consecutive year to the DeLaMar Theater in Amsterdam. Once more, Amsterdam Dance Event organizes this leading event to ignite sustainable action, …
A team of researchers from Tel-Aviv University developed a neural network capable of reading a recipe and generating an image of what the finished, cooked product would look like. …
Imagine you could communicate telepathically with a whale, listen to the WiFi networks in your environment, or experience smells through seeing color. Developments in technology …
Death certificates and commemorative plaques aren’t something you’d normally associate with a glacier. But that is exactly how Iceland recently mourned the loss of 700-year-old …
You might already have what’s often called a “smart home”, with your lights or music connected to voice-controlled technology such as Alexa or Siri. But when researchers talk …
The rise of artificial intelligence has brought us more advanced toys. If AI Barbie and her talking robotic friends are going to raise our kids, what would their parenting style …
Up to half of the world’s sandy beaches are at risk of disappearing by the end of this century if no action is taken to limit greenhouse gas emissions. That’s according to a new …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
Imagine waking in the night, and feeling the vibrations of an earthquake on the other side of the world pulsing through your body. This is a reality for Catalan-born artist Moon …
As our reality exists increasingly within digital realms, our virtual world demands a virtual identity. Our work is hybrid, our social identity is online and our connection is …
Dutch photographer Koen Hauser blends parts of the human body with parts from anatomical models. You know, the ones you had in biology class and gave you this fine colorful …
By ALEX WRIGHT, Published in NY Times December 2, 2007 The growing popularity of social networking sites like Facebook , MySpace and Second Life has thrust many of us into a new …
The goals of "understanding humanity" and "humanizing robots" are tightly related to each other. Infanoid Project is trying to relate robotics to human sciences in order to …
Humans have domesticated animals for thousands of years. The earliest known evidence of a domesticated dog is a jawbone found in a cave in Iraq and dated to about 12,000 years ago …
'The LED Dog Tail Communicator' is an initiative of James Auger and Jimmy Loizeau, and it is part of the larger 'Augmented Animals' project. Its focus points to technological …
The fabrication of forests with artificial trees is one of the best strategies to stop climate change, according to scientists of the Institution of Mechanical Engineers . The …
We’ve written earlier about man–made bacteria that eat waste & shit petrol . How about a genetically modified bacteria that can eat CO2 and excrete methane that could power …
Drinkpeedrinkpeedrinkpee is a project by Britta Riley and Rebecca Bray about the role our bodies play in larger ecosystems. It's an installation about the Urine to Fertilzer DIY …
For over 40 years Australian artist Stelios Arcadious Stelarc has made art with medical instruments, prosthetics, robots, virtual reality systems and biotechnology to investigate …
On May 12, 2009 the ACLU and the (not-for-profit) Public Patent Foundation, filed a lawsuit, charging that patents on two human genes associated with breast and ovarian cancer are …
DNA related tools, once expensive and restricted to research and crime labs, are rapidly becoming affordable. Like GPS – once a high-tech wonder now turned into a everyday gadget …
Bird spotting is not a typical activity for us next nature explorers, yet occasionally we bump into some birds worth mentioning (remember the amazing copy-paste bird , rubber duck …
We are living in the future and we find it boring. The best place to gather evidence for this claim is the supermarket. To begin with, try and have a fresh look at the word: …
If a tattooed pig is a bit too much for you, why not go for a tattooed goldfish? They bring you lost of luck and are available Chinese characters such as “Wealth, Dragon, …
Remember Asimo ? Honda has now developped a new Brain-Machine Interface technology that allows humans to control the humanoid robot simply by thinking certain thoughts. The BMI …
Alright, we were mistaken. Money isn't virtual after all. A recent TV commercial of a Greek bank shed light on the issue. Your money lives, is anthropomorphic and inhabits an …
Professor Hiroshi Ishiguro ( Intelligent Robotics Laboratory at Osaska University) has done it again! This time in coöperation with robot-maker Kokoro Co. Ltd . Objective: to …
The Quest for Fire (1981) shows the Next Nature of 80.000 BC. Set in a world without highways, supermarkets, airports, Internet, television, farming, money or written language, …
Koyaanisqatsi (1982) is a film with no actors, no storyline, and no dialogue. The only things we see are landscapes, images of cities, and people going about their regular lives. …
Did you know that about 20 percent of your body isn't really yours? It has been patented by some corporation you probably never heard of. You can't patent gold, you can't patent …
Lady Gaga is famous for fashion that exaggerates or obscures her body, but a few months ago, she made a foray into 'actual' body-modification. Gaga appeared on Jay Leno's talk …
Until now, most people have likely regarded bird-feeders as merely a pleasant addition to their gardens. But scientists have now discovered that bird-feeders in the UK are …
City rats, it seems, prefer the same foods that humans do: Greasy, fatty, sweet, and salty. Although rats are usually seen as the billy goats of city life, ready to chow down on …
We normally think of polluted water as the source of disease, not the cure for it. The Gowanus Canal in Brooklyn, affectionately known as the Super Fun Superfund , is one of the …
It works like this. Position yourself with a friend in front of a battery hen and flap your arms as fast as you can when the music sets in. The harder you flap the faster your …
Manko sighed. Nada: 'Did you like it?' Manko: 'I have to admit that if this is the starter, I'm not sure I'll survive the main course.' Everyone at the table laughed. Manko: 'Let …
Earth has had a geosphere, atmosphere and biosphere for a few billion years. Only within the last several thousand years has earth gained a global noosphere, the intangible …
Intentionality separates culture from nature. A dog is intentional, a fox is not; a park is intentional, a forest is not. Since trash, ruined buildings, and automated computer …
Protei is a sailing robot that's designed to clean up oil spills without human assistance. After sailing upwind, the bot drifts downwind, zigg-zagging across the surface to absorb …
The protozoa Toxoplasma gondii makes an unobtrusive home in nearly every warm-blooded species, but it's prolific life is limited: Toxo can only reproduce in cat stomachs. The …
It has been a trend for people to grow taller and taller during the evolution. When people get taller, they will need more energy, food and space. Since the human population is …
In the film Plastic Bag , the title character spends a lifetime (or more) on a quest for a creator not even aware of his existence. A stunning short by Ramin Bahrani, director of …
Has nature become a fairytale or do we want it to be one? In their installation The Clockwork Forest , artist collective Greyworld seems to opt for the latter. The work of art …
The earth operates on a 24 hour cycle, and so do humans. For most of history, we didn't have much choice in the matter. However, in the absence of visual cues light sunlight, some …
While evidence indicates that humans domesticated themselves , we're not the only primates capable of self-domestication. Bonobos and baboons have shown they are just as capable …
Anthropomorphic products enter the human social space. Humans have the most complex social behavior of any organism on Earth. Anyone or anything trying to join in should be careful to do it right.
At Next Nature, we often argue that "our image of nature as static, balanced and harmonious is naive and up for reconsideration ." Paleontologist Peter J. Ward happens to agree. …
This last Monday rang in the Chinese Year of the Dragon. Not restricted just to the benevolent, snake-like creature of Chinese mythology, or to the greedy, princess-stealing …
The boundary between humans and machines is slowly but steadily blurring. The Immortal is a machine which exists out of several life-support machines connected with wires and electric cords.
Google becomes the authority on existential questions about aging.
It’s long been a desire of the human species to have complete control over our own thoughts. We’ve all had these moments where we curse our brain. Asking questions like: “Why …
There are robots that look like people, and then there are robots, like the Ecobot III, that look nothing like humans but have our same biological needs: they have to eat, digest …
A new kind of piezotronic transistor mesh could make for robotic skin that’s as sensitive as your own is, covered in thousands of tiny mechanical hairs.
Algae as the future alternative fuel for the human body.
Lab grown meat is part of the trajectory that agricultural technology is already following.
In 100,000 years human beings might look like a manga character: big intense eyes, high forehead, large head, straight nose, more pigmented skin, and perfect symmetry. “There will …
In this talk at TEDxGhent, our own Dr. Van Mensvoort shows how technology becomes nature in seven steps and what engineers, inventors, designers and entrepreneurs can learn from that.
Many people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.
Govedare paints the human impact on natural environments, showing how nature has become a subset of culture.
Breathtaking satellite images that will change how you see the World.
A selection of nine enthralling and striking concepts of future way of transportation.
Scientists think the laws governing the structure of galaxies in outer space are the same laws underlying the growth of cities.
The world’s largest indoor farm is not the only firm developing vertical agriculture. Japanese company Spread plans to grow more than ten million heads of lettuce a year by …
An exoskeleton chair that allows the body to move freely.
While the Watson technology is exponentially increasing its processing power on an annual basis and steadily moving from answering trivia questions, to cooking advice, onto medical advice, it is about time we confront it with the million dollar question: "Watson, what do you want?".
This potentially revolutionary device includes LED lights and temperature sensors to provide medication directly to the wounded section of the skin.
This piece from Ars Technica details the breadth in the variety of energy sources emitting from our every day interactions.
Stewart is a tactile interface that mediates the communication between human and self-driving car.
A sky garden of cacti and artificial life forms floating a hundred thousand feet above the Earth's surface.
Over the past decade scientists have tried to get technology surfaces to be as sensitive as our skin, especially as our fingertips. Human tact is a very sophisticate interface …
Nasa funded a program to turn astronauts’ poop into food.
An AI was intended to improve human-like experiences in regards to the company’s customer service chatbots, but has fallen into a suicidal depression instead.
C-sections have an unexpected side effect on human evolution. Newborn heads are getting bigger, while the mothers birth cannals are becoming smaller.
Our peculiar image of the week comes from the Great Barrier Reef. You've probably seen images of this vibrant underwater attraction before. If you're lucky, maybe you've seen it …
Facebook had just fired their curatorial team for the ‘Trending’ news section over an algorithm, resulting in false stories attacking a news anchor, a writer, and Mac Donald’s.
A group of researchers is working to optimize the way we sleep, increasing our relaxation, and therefore reducing the time devoted to our naps.
A new community currency that rewards recyclers with local discounts and deals.
We tend to believe that the fruit and the vegetables we eat today are "natural" and the same as they always were. It turns out that in the past this familiar food didn't look like this at all.
We recently handed this year’s ECO Coin Award to Dutch designer Dave Hakkens, founder of the Precious Plastic movement. With his open sourced recycling machines, he provides people around the world the knowledge to start recycling plastic locally.
Garbage dumps may not be very attractive places for us but they sure are for animals. A study published in Science Advances shows how certain groups of storks modified (and …
Robots in health care could lead to a doctorless hospital.
Sleeping underwater has always been your dream? Thanks to an ambitious project it will be soon reality.
An industrial robot just tattooed the first person ever in San Francisco.
Researchers discovered a way to store data in five dimensions on a nano structured glass able to survive for billion of years.
This automated store in Sweden doesn’t have any human employees, only a smartphone app.
While we can’t just leave the coast permanently without upsetting the delicate balance of this new environment we created, we can take better care of it to ensure that it is around for years to come.
A lamb born at the equivalent of 23 weeks in a human gestational period was kept alive in an artificial womb and developed just as if it was in a normal womb.
22 teams of computer scientists have unveiled a set of algorithms able to predict the odor of different molecules based on their chemical structure. Computers learn how humans smell
Do you feel information overloaded? Do you experience stress? Do you feel like you are addicted to your smartphone, laptop, or the Internet? Get yourself digital detoxed!
To explore deep sea Standfort University developed OceanOne: a humanoid diving robot, which at the same time creates a simulation of the underwater experience on land.
The complicated system of a female menstruation cycle was reproduced on a computer chip for the first time.
This floating gym harnesses human energy to sail down the Seine River in Paris.
Craftsmanship is generally very appreciated, but it takes a lot of time to master a craft. Therefore, as a robot coach you train - you guessed it, a robot - to transfer your …
A new contraceptive has appeared on the horizon, bringing the prospect of an alternative form of male birth control one step closer.
The Punishment is an installation featuring a robotic arm that mimics a kid's handwriting perfectly, and repetitively writes "I must not hurt humans".
This is post number three of our serie 'Robots at Work'. In this episode we present you five jobs for facilitators, the ones who love to work with technology.
The United Arab Emirates released plans to build a city on Mars.
The Amazonian rainforest was already transformed over two thousand years ago by people who built hundreds of large, mysterious earthworks.
The world’s first bio-brick grown from human urine has been unveiled by University of Cape Town (UCT) master’s student in civil engineering Suzanne Lambert, signalling an …
Humanity is facing the disconnection between biological reproduction and the body, facilitated by the emerging technology of the Artificial Womb. Envisioned in bleak science …
What to do about the plastic planet ? The seas are steadily filling up with plastic , and it's vital to find ways to address the problem . One way to do this is to move away from …
And it’s already showing incredible results. VR transports us to faraway worlds without even asking us to leave our chairs. Yet we usually hear about it in the context of video …
It was just little over a year ago that bike sharing schemes started to take off in China. Yet in the blink of an eye, millions of bikes painted in vivid colours, popped up in and …
Back in the mid-twentieth century, before the first moon landing, people had all sorts of ideas about the golden age of space travel in front of them. Colonize the moon! Fly …
New technologies are changing the landscape, but the latest trend reshaping rural environments and agriculture is agroforestry: the art of planting trees.
As we showed with HUBOT , we can use new technologies and robotics to make our work more enjoyable, interesting and humane. Aside from our speculative jobs, a lot of robotic …
The emerging technology of the artificial womb confronts us with a series of moral and societal questions. How to cope with that? Join us on 29 March at Eindhoven University of …
Today is World Animal Day , a day to put the spotlight on man's best friends in order to improve their welfare standards around the globe. At Next Nature HQ, we honor this day by …
Rooftops covered with grass, vegetable gardens and lush foliage are now a common sight in many cities around the world. More and more private companies and city authorities are …
Oded Ezer is a typographer from Israel who never fails to push boundaries, or rather, discard them altogether. Ezer is a rebellious force that swings between commercial and …
Meet Pirjo Kääriäinen, professor of design driven fibre innovation at Aalto University, Finland. Kääriäinen founded CHEMARTS —a collaborative program at the university that brings …
During the Antarctic summer, thousands of mesmerising blue lakes form around the edges of the continent’s ice sheet, as warmer temperatures cause snow and ice to melt and collect …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
10 design requirements to fully immerse ourselves into the 21st Century—in which technology makes our world richer, not poorer.
Biosphere 2 is a manmade closed ecological system in Oracle, Arizona. Constructed between 1987 and 1989, it was used to test if and how people could live and work in a closed …
A short story by Terry Bisson. For those who prefer video to literature, there's also this seven-minute film adaptation . "They're made out of meat." "Meat?" "Meat. They're made …
The Earth is heating up. The sun will blow up within 5 billion years. The human race will probably go extinct before entering the posthuman stage, or the probabillity that we are …
This French Aids campaign is a wonderful example of biomimicmarketing (using images of old nature for propaganda or marketing purposes). They may be disturbing but the message …
Phone, internet, television, photography, even books or music: today it is hard for the mind to escape from virtual worlds. A day without communication or interaction could make …
The Vin Memoriam concept introduces a new ritual in the mourning process after losing a loved one. When a person has passed away, a small amount of blood can be processed into a …
The free cultural paper Amsterdam Weekly discusses the Natural Revolution of and includes tree tips for successful living in the next version of nature. Download PDF (148kb) . …
The sun always shines on TV in China. "At this summer’s Beijing Olympics, China puts a 50-year experiment to the test: Officials are betting weather modification can keep the sun …
Rule #1: A robot may not injure a human being or, through inaction, allow a human being to come to harm. Remember Isaac Asimov's classic three laws of robotics ? Surely thats …
So you thought that animated Pixar Lamp from the movies was just a fantasy? Not anymore. Luxalive is a prototype of an reading lamp that moves according to the character of its …
May 17th 2008. Biggest Visual Power Show: Next Nature in LA . More pictures below. We are all born in a world that has been designed already. BVPS intro video by Floris Kaayk. Big …
Unlike many people fear that computers will overtake humans, Ray Kurzweil states that robots will merge with humans, robots the size of cells which can do the job way more …
Next Monday when your colleagues ask you what you have been doing for the weekend, you might answer you something default like you went out with friends, danced, biked to the …
As we bid farewell to 2009, it’s a good time to look back at our explorations of the year. Here are some of our most popular and peculiar posts, in case you missed them the first …
Susan Blackmore studies memes: ideas that replicate themselves from brain to brain like a virus. She makes a bold new argument: Humanity has spawned a new kind of meme, the teme, …