Picture this: it's 40,000 years ago, and you are an early Homo sapiens. You are standing on the savanna. Look around you. What do you see? No billboards, no traffic signs, no …
Remember the Information Decoration essay which argued our so-called information society barely employs our human bandwidth, as most of the data in our lives is presented in …
With this cooking timer gadget , you can explain information decoration to anyone. In addition to its default explicit digital time display, it has a modus in which the passing of …
In search for information people once used to go to libraries.
ching 64GB SD cards to each of our fingers challenges how we store and share information in a world were our digital privacy is at risk.
TomTom and Vodaphone want to use mobile phone signals sent from traffic jams to gather real-time travel information. The data will be used for TomTom users to establish if roads …
Scientists have written a message into the DNA of a living organism , a breakthrough they believe could lead to a new era of organic computers capable of healing themselves if …
When techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …
Enologix makes software that predicts how a wine will rate in reviews even before it is made. It claims that wine quality can be measured chemically, and a score assessed, much …
So you’re triggered by our call for products and now you’re considering to send in one, two or maybe three of your brilliant products for the Nano Supermarket? Good. Or – and this …
Hope you have a strong stomach for this one: There are many ways known for decorating the body (both human and f.e. swine ). But it's fascinating to see that so many "cutters" …
In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …
AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …
IVY is an external hard disk which shows the content of the hard disk on its skin. When no data is stored on IVY, its skin will remain blank. When you purchase IVY, it appears to …
Designer Carlijn Compen upgraded her watertap with some LED's that shift color along with the heat of the water. A simple yet effective example of information decoration that will …
German chancellor Angela Merkel is quite a phenomenon of colors. Blazer remains invariant.
Because date rape drugs are odorless, colorless and tasteless, victims don't normally realize they've been attacked until it's too late. In a clever, necessary bit of information …
Information decoration on a city scale. Every night from the 22 to the 29 of February 2008, the vapor emissions of he Salmisaari power plant in Helsinki will be illuminated to …
I reckoned Amsterdam did not have any sky scrapers, but I guess I wasn't looking through the right lenses. This sms-traffic Amsterdam skyline – made on new years eve 2007 – was …
The popular car brand is working on augmented reality goggles that enhance the driving experience.
Generative graphics and organic information design are making their way into the world of the applied arts. For the Max Planck Institute of Molecular Cell Biology and Genetics, …
The human body is increasingly recognized as a biometric source of information for a wide spectrum of issues, including security, psychopathology, personality and health. Earlier …
This video shows the design vision of Corning, a company that specializes in glass. Not just any glass, but glass incorporating technology, electronics and displays. And it sure …
As a child you probably had one of those temporary tattoos that come packed with over-sweetened chewing gum. It was a nice decoration, and a way to stand out. Recently researchers …
Breast cancer is a disease that comes with feelings of helplessness and loneliness. This nanotechnological necklace allows you to regain some control regarding your disease, in …
Startup Helix launched an online hub where you can digitally explore your genetic code by downloading different apps on your computer or smartphone.
For years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …
A periodic table of the most popular websites on the internet . websites are categorized according to search engines, internet tools, site ranking, aggregators, web comics, …
The Wilson Quarterly profiles the in January 2008 departed traffic engineer, Hans Monderman , of the "less is more" school of traffic control: " (...) Previously, Monderman, like …
Using thermochromatic ink, which changes color when the temperature exceeds a specific degree, designer Josien Pieters created a prototype of a dynamic wallpaper that …
Do away with dishonest health claims for eggs and uncertain promises of organic, free-range hens. With eggshells that change color according to hormones, medicines, and nutrients, …
Designed by Luc de Smet, Awear is a speculative bracelet that can detect and record the sources of allergies for children in uncontrolled environments, such as schools and …
A new way to project yourself against sharks while enjoying your favorite watersport!
Turning 100,000 entries from the Wikipedia into a growing nebula of human knowledge.
The multidisciplinary design consultancy Antrepo Team created a project named Minimalist Effect in the Maximalist Market in 2010.
When there is such abundance of areas where IoT could be applied, several ridiculous, unnecessary products are inevitable.
The Smell of Data alerts Internet users in any case of data leakage and communicates digital hazards by means of smell.
Researchers discovered a way to store data in five dimensions on a nano structured glass able to survive for billion of years.
Augmented reality applications are a promising alternative to GPS. At least that is what Blippar’s AR City app claims to be.
"A glowing green logo drawn by scientists on the wing of a genetically altered butterfly could herald the day that the insects are adorned with adverts and slogans . A team at the …
The Ticker Garden is a stand-alone data visualization application that monitors a stock portfolio. Different flowers represent the real-time performance of selected stocks via the …
The machine and the experience of the machine are becoming one. I've seen these kind of things in computer games, but now they are becoming real— Feels like plugging in to the …
These totems were developed by analyzing online pornography viewing habits. Custom software was written to sniff all incoming Web traffic at a discreet location, sorting packets …
New creatures arise through interactive media. Shadowmonsters found here Digitally generated ants found here
Snake, the video game that came out in the mid-to-late 1970s gained popularity in the 1990s for its inclusion on some mobile phones. Perhaps the reason why Martin Frey (Berlin) - …
Fascinating old nature. Somehow I find it hard to believe these weather photos are not computer rendered. Must be because of my Hollywood-special-effect-conditioned mind.
The pattern on the Animal Sweater suggests a new way to experience commercial imagery. The Animal sweater, designed by Karl Grandin, was first shown at The Biggest Visual Power …
This concept is a cutting board that has an integrated scale within a defined area on it's surface. This allows a person to both cut and measure ingredients on the same surface …
In the 1960s, scientists found that a particular jellyfish makes a protein that glows, known as green fluorescent protein. In the 1990s, using genetic engineering, researchers …
We designers often have to exchange business cards and usually they sit in a drawer forever, forgotten and out of date. In Japan there is quite a ritual about exchanging meishi or …
Food is no food. Food is scent. Food is temporary experience. Food is message. Welcome to this magical gastronomy tour. You will enjoy the tasty (video)links below: Works by Chef …
Here 's a work by Theodore Watson (Amsterdam) on the face of the Maritime Hotel (New York) The particles are attracted to one another but will repel away from the non-lit windows. …
This copy of Rodins "Le Penseur" / "The Thinker" (1880) shouldn't have that much on its mind... By using laser-technology, Korean researchers have crafted the microscopic version …
Where there is light, there is life. When you switch on the lamp, it provides you with light. You provide it with the generating power it needs togrow. Similar to living …
Lets face it: we spoiled western people are pretty much imprisoned by our self created safe environments and remotely disconnected from the wonders and chaotic surprises of old …
A nice light printer by rAndom International . The printer makes images with light on a light reactive surface. Really nice and high tech, but what I like is that the images fade …
Sometimes I have a hard time choosing between going out and staying home watching TV or my computerscreen. The great fashiondesigner Hussein Chalayan made these choices a lot …
Remember the e-paper brainstorm we had on this blog? Here's a nice example on that wallpaper-wish , though these "warps" are customly printed on fleece that can be papered the …
Schwan Consumer Brands, a leading frozen pizzas brand, has launched a challenging brand: UGLY. The design embraces the rising trend for natural, honest food and the notion that …
What is that growing on my car dashboard? Is that a tree? Indeed, Ford and Honda's next-generation dashboard instrument clusters feature trees (a vine in Ford's case) that grow …
Brain Kane proposes to fund the re-foresting of clearcut areas, with Greenvertising. See also: Branded butterfly wing , Plantvertising , Information Decoration , Dataplant , …
Economy is ecology . At least, according to the biomimicmarketeers of the US Wachovia Bank who created this weather report like newspaper advertisement. Nowadays most people worry …
No, this isn't the newest picture of some star system or nebula taken by Hubble telescope in deep space. This is a map of the internet. It might not be of much use since it is …
After selling his school , entrepreneur Teun Castelein is now selling the Dutch museum of graphic design.
An installment in the series of: " Things I have learned in my life so far ". sagmeister.com These dividing pages for Austrian magazine .copy spell out:"Starting / a / charity / …
Wednesday May 21st the boeing I was in, flew over some crop–fields near Schiphol (Amsterdam airport) where I took this picture. It reads: "Welcome home!". Unox is a famous Dutch …
Processed lunch meats etched with a laser cutter. The images show the source of the meat, making you more aware of where that great taste comes from. Link
To draw attention to a stand at the publishing house of the Frankfurter Buchmesse , a publisher hired some flies. The paper mini-banners -- attached with self-dissolving wax -- …
What you see is what you get – at least that is what you hope – with this biomimicked kiwinut juice packaging designed by Naoto Fukasawa. See also: Image consumption , Image …
Fleshmap touch investigates the collective perception of erogenous zones. Hundreds of people ranked how good it would feel to touch or be touched by a lover in different points of …
Never believed in pots of gold anyway. Related: Credit on Color - rainbow of credit cards | Datafountain - money translated into water | Ceci n'est pas une Roche | Faked Fireworks …
The American Chemical Society is holding a contest seeking short videos that answer the question: "What is nano ?" UC Berkeley graduate student Patrick Bennett and his colleagues …
How can we unfold the Earth? Making a map of the earth is an ancient problem. For thousands of years cartographers, mathematicians, and inventors have developed methods to …
The Eindhoven-based design team ' Edhv ' made an installation to turn creepy crawlers into genuine graphic designers. By letting crickets, woodlice, ants and many other insects …
The Swedish design group Front brings the principle of the digital computerdesktop trashcan back to the physical world. When your trashcan basket is full it bulges outward. When …
After a ban on flying last weeks due to the volcanic eruption in Iceland, the European airspace was slowly rebooting to its old state of activity. This movie shows the movement of …
With an optical trick, this German bottle of water is trying to prove its effectiveness for the body. Though drinking water is a necessity for life, the downside of this product …
As our everyday living spaces are packed with electronics and become increasingly sentient, we might one day wake up in a house that knows more about your family's state than you …
Hurray, the Next Nature tribe is growing! Today, we’ve welcomed our 2,000th friend on Facebook . And what better way is there to honour this person with a celebrational parade …
Protection is the fundamental purpose of the helmet. This helmet, a conceptual design project by Seungjoo Lee , enables the storage and protection of memories. Plug in your USB to …
Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …
You know the HeHe collective from their laser projection on a power plant emission cloud . But did you know these folks have a real emission clouds fetish going on? In this …
Haroon Baig from Germany has figured out a way to key up the amount of 50+ Twitter addicts. This progressive nostalgic cuckoo device displays new tweets from any twitter stream or …
Lucy McRae uses spandex to deterritorialize the body. #powershow #bodyart http://bit.ly/th7KyR
If a light switch would be hairy or snotty nobody would want to turn on the light anymore, which is exactly why designer Katrin Baumgarten created some of the most one nauseating …
In cities across Germany, Big Brother looks like a smiley face. The Fühlometer, a piece by Julius von Bismarck, Benjamin Maus, and Richard Wilhelmer, uses security cameras and …
So, what do you get when an owl watches too much animated TV cartoon series? An amazing shape-shifting Transformer Owl! Now seriously, we don't actually think this wondrous White …
The layers in this visualization represent an average of how thousands of Americans spent their day
Should made-to-order babies become a reality in the near future, one piece of the design puzzle has been solved now Pantone has release their SkinTone system. Indexing 110 skin …
Feeling grumpy and hungry? Unfortunately, the University of Tokyo's Happiness Counter refrigerator won't open up until you give it a big smile. The concept is based on the fact …
Displays have been on our desks for too long. Samsung makes space and introduces the Transparent Smart Window . This LCD touchscreen is powered by the sunlight shining from the …
A Chinese company wants to transform vacant lots into virtual shopping centers.
An astounding tangle of multi-colored water flowing throughout 18 arteries represents what happens every day in the pulsating heart of Tokyo. This is how Takatsugu Kuriyama , from …
Cars increasingly rely on technology designed to make driving easier and safer. But are these improvements creating less-skilled drivers?
Our peculiar image of the week is titled "High Frequency Captured on the Surface of Augmented Objects" by Ryota Matsumoto , Mixed Media 140718 110cmx85cm.
Textiles manufacturer 'Vlisco' updates African classic pattern to represent personal educational preferences.
A robot that applies computer controlled motion to precisely decorate your Easter eggs.
Smart Tags stick to containers of food and change color when something has expired.
The desire to avoid face recognition algorithms could bring us a whole new set of make up styles,
Some modern thinkers argue that new technology is making us antisocial.
Technology is nestling itself within us and between us, has knowledge about us and can act just like us.
The Smithsonian’s National Air and Space museum has taken the sun observation to the next level with a giant public display of images and data that show the sun in hyper-real detail.
My New Flame uses LED technology to faithfully recreate the experience of light from the ancient past
According to the Wikipedia page 'Wikipedia: Getting to Philosophy', more than 94% of all articles will eventually lead to the English article "Philosophy".
team of computer scientists at the universities of Germany and California has created what they call photoshoping videos in real time.
This video by Nature explains the complexity of networks on our planet.
If we'll ever get to go to Mars as tourists , we wouldn't get lost. Ordnance Survey , the official British mapping agency, recently released a new detailed map of the Red Planet. …
The Scrip, a new universal cash device is bringing back the old metallic sparkle of the money and mixing it with today’s technology in order to fill the deficiencies of our credit and debit cards.
Emoji are taking our communication to a faster, simpler level.
How much carbon does a Youtube video burn? Greenpeace's #ClickClean initiative calls on big tech companies, like Google, to use renewable energy sources.
What the Internet would look like if all data were ephemeral?
Volvo's driverless car system has trouble recognizing kangaroos because it gets confused by the hopping of the marsupial.
What if you could unlock your phone by simply looking at the camera? According to Apple, this is precisely how the iPhone X will work. But how secure is it?
“An illegal theme park exposing the ideology of the aesthetics of hacking”. “A hybrid drone targeting technological domination”. “A psychedelic fridge to raise doubt about fake …
The EyeQue personal vision tracker is a smartphone app that allows you to test your eyes from the comfort of your couch.
A virtual museum for poetry opens "its doors" at Museumplein in Amsterdam.
In our ongoing battle against climate change, it's hard to transcend from our human position and ‘think’ like nature. Given, nature doesn't think the way humans do, but it does …
In Bali, volcanic danger looms large. Scientists are trying to use drones to forestall the danger and make the invisible workings of the volcano visible.
Astonishingly, we’re still living in a world where most women feel uncomfortable talking about their periods and some don’t even have access to sanitary products. This is why …
Remember the datafountain ? Of course there are many other applications of information decoration: datawallpaper, datasounds, datafurniture and dataclimate. The picture above …
Philips presented an A4-sized colour electronic paper . A paper-thin and bendable viewing panel. "This represents the next generation in display technology," Chung In-Jae, chief …
Digital and genetic techniques increasingly influence life. Our belief in progress through technology stands in the way of a moral debate on this development. By Rinie van Est We …
Genealogy services have exploded over the past few years, and Spotify is capitalizing on the boom by providing curated playlist based on users’ DNA. Here's what you should know. …
Written by Werner Lippert & Peter Wippermann, Curators of the Entryparadise exhibition (26/8 until 3/12, 2006, at Kohlenwäsche, Zollverein) Design is about to undergo a …
For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …
Principle number four: Humane technology should resonate with the human senses, rather than numbing them. If you're an office worker or a video game fanatic , you may spend most …
Quoted in a recent interview about his work, Landscapes without Memory , artist Joan Fontcuberta asked, “Could a natural nature exist? The answer is no, or at least, not anymore: …
Amazon's Echo smart speaker may have witnessed a murder. But will it talk?
DNA is the densest known storage medium in the universe - and Harvard University researchers have managed to use it to store GIFs inside bacteria.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Toasted bread as an information display device (originally developed in 2001 but somehow still intruiging): a toaster that parses meteorological information from the web and then …
An online application that generates artificial flowers from text . Type in any sentence you like and it is being transformed to a fake flower. via information aestethics
Bio Mapping is a research project which explores new ways that we as individuals can make use of the information we can gather about our own bodies. The project envisages new …
Electromagnetic radiation of active mobile phone sets off the LEDs in relative proximity. Light shadow follows the conversation through the space. …
Now this is a spot on example of information decoration : a heat–sensitive wallpaper of which the printed flowers will be blooming when the radiator is on. Created by Shiyuan .
Although this TED video has been all over the web and commented on this website already, it still deserves a separate post: Desigineers Pattie Maes and Pranav Mistry of the MIT …
At ISEA 2010 , the International Symposium on Electronic Arts, media artists and media researchers from all over the world present their work in Dortmund (Germany). This year, …
In 2009, undergraduates at the University of Cambridge worked with scientists and artists to engineer E. coli into E. chromi , a new type of bacteria that secretes a range of …
A map of the most visited websites in each country. Google or Facebook, which one will conquer the world?
Do you think you are made from bits and bytes? Stop playing video games and spend some more time offline! Both atoms and bits are basic parts of matter.
Artists respond to biometric technology and data collecting software through subversive projects.
"To understand why a product is the way it is today, you need to learn about its evolutionary background." Meet Huub Ehlhardt, an engineer with a PhD in product design . Huub …
Imagine a graveyard without tombstones, instead there are growing trees that contain genetic material of the deceased people burried there. Biopresence creates Human DNA trees by …
Skin conductivity sensors are used to deduce the emotional state of the sleeper. This information is brought to 3-D studio where a script is used to transform this into physical …
Hotspot Bloom is a wearable flower that glows and changes color to indicate the signal strength of a nearby wireless network (802.11b/g). With its mobile interface, Hotspot Bloom …
A flower arcing from a frosted pane of glass. Rigged with a breath sensor and connected to an internet packet sniffer, the flower is cued in to the wireless network flowing in the …
An umbrella that provides information about the likelihood of rain so that users can make a simple, informed decision about whether to take the umbrella with them as they leave …
Just follow the yellow brick road ... thin red cable and you know where to go! Instead of looking at a small 6 inch screen, or listening to less than exact turn by turn …
The EnergyTree is a device dedicated to monitoring your household energy use. It monitors you energy output from sockets and any device that is using electricity. It also monitors …
Excuse me, I am lost. Can you point me to the information super highway? Rendering by Chris Baker, photo Erik Pawasser. Via Wired . See also: Car Navigation - Follow the red cable …
After the successful introduction of the NANO Supermarket in 2010 it became even more clear that the contest and the presented results produced discussions and many challenges to …
Ever notice how ant colonies so successfully explore and exploit resources in the world … to find food at 4th of July picnics, for example? You may find it annoying. But as an …
Created by Vik Muniz and Tal Danino, Flowers uses livers cells treated with smallpox vaccine in order to create floral patterns.
On the aftermath of such a historic day for Britain and the EU, it's easy to get swayed into the polarities of political discourse, particularly on social media and the Internet, where things heat up and move fast. The results of the referendum have just come out, and the Internet is already burning with tension. This is called "climate change" - just not the one you are used to hear about.
Have you ever wondered what the infosphere looks like? Dutch designer Richard Vijgen’s app Architecture of Radio is a field guide to the hidden world of digital networks.
What can we learn from listening to the buzz of bees' conversation? With the help of a new monitoring system, a Canadian researcher is hoping to find out.
Exploring methods to better connect people to the natural world, Waag Society, in collaboration with the Dutch Botanical Gardens Association, have developed an app that allows visitors to talk with plants.
How do trees feel? A team of scientists have developed a network of twittering trees to monitor their feelings and raise awareness over climate change.
Introducing nanobionic spinach plants that can detect explosives.
New technologies – from artificial intelligence to synthetic biology – are set to alter the world, the human condition, and our very being in ways that are hard to imagine. The …
Who are you, who do you want to be, and what do you need to do to get there? We are constantly pushed to lead the perfect life. The media present us with a picture of an existence …
Why memes might be the next tool to make sense of on our increasingly hybrid virtual and physical environment.
I am sorry I couldn't be there— I had an important meeting with my bathtub that could not be rescheduled. This bathtub with an internal multicolour LED light fitting, creating a …
On a day trip to Brighton in the summer of 2004, this dude found a stone in the shape of the letter B. And then the rest of the alphabet.
SINGAPORE (Reuters) Some people like to talk to their plants. Now, students at Singapore Polytechnic say they have created a plant that can communicate with people - by glowing …
A screen of water displays images by controlling drops of water falling down. Density creates light/dark shades that create the image— Project site
The GloCar uses LED lights to change body panel colours, intensity and frequency. A driver can thus choose at will to either stand out or blend in. Alongside the cosmetic value …
"In the morning paper, I can read the weather report as well as the stock quotes. But when I look out of my window I only get a weather update and no stock exchange info. Could …
The body suit pictured above has LEDs that illuminate according to the wearer's state of excitement. Skin signals are measured and change light emission through biometric sensing …
Take back the field. This past weekend, the OSU Linux Users Group descended on a field in Oregon to create a 45,000+ square foot crop circle of Firefox.
A tropical fish that fluoresces bright red is set to become the first genetically modified pet to go on sale in the US. Alan Blake and colleagues at Yorktown Technologies …
GPS drawings over land , on water , and in the air were created to investigate principles and techniques of geodesic drawing. The maps were made to measure travels and tracks and …
Remember the beautiful sequoiaview harddisk visualisation posted a while ago? Above a more illustrative harddisk tree visualisation by professor Jack van Wijk. Branches are …
The Stock market skirt Nancy Paterson made a blue taffeta & black velvet party dress that represents the real-time stock market situation by lowering or raising its hemline. …
There are people who think what makes a good wine comes from nature - factors like rain and soil and temperature. Then there are those who think it's a matter of second nature - …
There may even come a moment that our connection with an industrially manufactured coke bottle may be richer and more mythical that our relation with a genetically analysed and …
A transformation of the big flashing arrows from the computer game Need for Speed Underground 2, NFSU 2 to physical space. Although computer games generally try to imitate the …
pollution + streaming = pollstream; an intervention in environmental ethics. It creates a series of interactive environments in which members of the audience are in a process of …
The Power Aware Cord transports electrical power while simultaneously visualizing energy usage. Electrical transfer is represented through glowing pulses, flow, and intensity of …
a purse that visually keeps track of valuable items such as keys, wallets, personal identification cards, & cellular phones through various sensors embedded in the bag. if …
The Sababa is the first real time lava visualiser kit of global city flows. It takes the lava lamp one step further by reconstructing it according to the language of the current …
Semantic landscapes use the natural metaphore to visualize abstract data. The project above visualises different meanings of the word 'cold' in Biomedical patent documents.
Did you ever wonder where all that hard drive space went too? Sequoiaview generates organic-like views of the files and folders on your hard drives using cushion treemaps. …
A traditional textile heritage is celebrated with flocked wallpaper that comes to life as it reacts to ambient noise levels. The louder the space the brighter the wallpaper glows. …
A technique developed by the German Claus Winterfor an installation artist makes whatever word you type into a computer visible by a "water-curtain". The video shows the World …
The toy export map of the world. The toy import map of the world. The way we map things can make a world of difference. Worldmapper's maps transform traditional cartographic …
What happens to your digital presence when you die? Does your website, MySpace and Second Life live on? Nope, it goes to mydeathspace.com Funny enough, the Amsterdam based …
In his new series Running the Numbers , photographer Chris Jordan looks at contemporary American culture through the austere lens of statistics. Each image portrays a specific …
The AR+RFID Lab at KABK (Royal Academy of Art, The Netherlands) sends this marker card, wishing an Augmented Christmas. Funny they need a real tree for hanging those markers... …
This home-built hot air gun printing in sugar has great potential for making all kinds of interesting foods. Imagine getting tired of your second life avatar --> just print out …
In the UK farmers recall simple circles appearing on their land for generations. The British media first reported on the circles in the early 1980s. By 1990 crop circles had …
Henk Rozema displaying his invention (2006), the digital tombstone "Digizerk". It was only a question of time that global digitalization would be introduced on cemeteries. The …
This must be the best worst software concept I've seen this year.. An email mailbox represented as a 3D, virtual LAX airport. in this world's coolest email program, based on the …
Espace Pur by Marc Hottinger & Lucien Iseli (MID-ECAL) is an air ionizer that uses dust as pixels and that displays patterns thanks to it, in a very slow motion way. It cleans …
Future billboards will be looking back at you! The Eyebox2 can track the gaze of several people at once from 10 metres away in order to know how much attention the billboard is …
TiWalkMe is a clock (still in conceptual stage) designed to track 1,000 years using a forest seeded along a ribbon of land to tell time. Annual tree plantings set the pace, …
New media technology from South Korea: a gigantic human display compiled from supporters cheering their soccer teams . One pixel per supporter. See also: Skyscreen , A4 e-paper .
In 1998 at the introduction of the iMac , Apple declared that the "i" stood for "internet". Apple later adopted the "i" prefix across its consumer hardware and software lines. …
No, these aren't X-ray pictures, these are designers bags! Part of the Observe/me fashion line of bags, wallets, gloves and coats created for the modern observed people. …
Packet Garden is an experimental artwork that seeks to provide an alternative and accessible approach to visualizing daily internet use. Plants are also grown for each protocol …
The VIBE - emotional sensing necklace combines conductive ink and textile sensors. The necklace can read multiple biometric signals of the wearer and communicates them to other …
When he's not saving the word, artist Matt Siber is disecting street images and their typography. Seen before in many forms on this blog, but very well done!
Alright, we can agree most of old nature has been altered by human activity. We're not just talking rain forest, icecaps and genetically modified fruit and kittens . Now you might …
Aaron Larney made these urban camouflage printed hoodies, just in case you need to blend into your dorm's notice-board. See also: Urban Camouflage I .
The paths of air traffic over North America visualized in color and form. Created by Aaron Koblin .
... gathered into spheres and compared to the Earth. The water sphere (blue) in this computer visualization measures 1390 kilometres across and has a volume of 1.4 billion cubic …
The Ambient Umbrella shows when rain or snow is in the forecast by illuminating its handle. Light patterns intuitively indicate rain, drizzle, snow, or thunderstorms. Local …
Always dreamed of creating your own clouds? You can now create them... from text. Wordle is a toy for generating 'word clouds' from any text, url or rss stream you provide. The …
This gun style camera projects messages on the objects of which people take pictures. It can not be seen by the naked eye, but is only visible on the pictures strangers take of …
Lightweeds is a project by Simon Heijdens and currently exhibited at the MoMA - part of the Design and the Elastic Mind exhibition . The organisms - plants, weeds, trees - exist …
Now there is an interesting biomimicmarketing technique we had not seen before. For their new marketing campaign internet security company Messagelabs worked with digital artist …
Multicultural Gourmet Pack is a new meat package that contains a variety of butchered meat products based on different religions and believes. The pack contains a total of 4 …
In the countdown to the Biggest Visual Power Show 2008 in Los Angeles we post some video's of earlier presentations. The Powershow 2003 in Paradiso, Amsterdam had the world …
I used to hear voices in my head, but now they seem to be coming from the walls – am I back in to the womb? No wait.. it's a wall that reacts to the spectators voice (quicktime) . …
Now why is that girl so excitingly staring at a few blurry blobs on a flat screen? Is it because these blobs are connected to her breath... What? Yes that is right, you are …
The Telepresence Frame is a domestic object which utilises the fact that one's bodily functions are digitised in order to create a new form of telepresence. Allowing loved ones to …
Beauty and the Geek jeans by Erik de Nijs. The trousers offer a full Querty keyboard layout as well as a mouse, speakers and a little joystick. As he calls it: "Beauty is skin …
Water inside your phone used to be rather devastating, but with the NEC FOMA N702iS (only in Japan) , designed by Oki Sato, it is turned into a joy. Watch the faked fluid move on …
"I think we are all "work in progress", this necklace is featuring a cool progress bar to indicate that." Nice work Irina!
Many people tend to eat too fast. As a result they do not receive signals from the stomach that they are in fact full. The result can be overeating and obesity . To encounter …
Reliable data on economic growth is hard to come by in many parts of the world, especially in developing countries. Yet according to scientists, outer space offers a new …
Japanese design agency To-Genkyo proposes a dynamic freshness label for meat products. The hourglass-shaped label contains special ink that changes color based on the amount of …
"A clean river is a fun river." Peculiar ad by stirmarketing.com Related: Playing with Dry Water | Datafountain | A Future Love Story
The 150 people watching this Youtube-commercial right now, will copy the source and blog or twitter it forward because it diggs. 40 of them have remorse over the fact that it is …
Getting information as fast as possible and on the spot is the trend. So what could be more direct than having information fired directly into the eye? Today - together with his …
If a tattooed pig is a bit too much for you, why not go for a tattooed goldfish? They bring you lost of luck and are available Chinese characters such as “Wealth, Dragon, …
Sind wir noch zu retten? That was the slogan of this year’s Ars Electronica festival in Linz (Austria). Titled ‘REPAIR’, the media art festival urged to leave our scepticism and …
Augmented (hyper)Reality offers a glimpse of an alternate universe, with augmented reality cranked up to the next level.
The Intimacy dress takes our notion personal space to a next level: the closer someone approaches, the more transparent the dress becomes. As such, the garment becomes a sort of …
Now here is something for the NANO Supermarket : Massachusetts-based Draper Laboratories have developed a special injectable ink with nano–particles. This ink eventually could …
How to upcycle old newspapers? Mieke Meijer (a.o.) from Vij5 took a jar of glue and started imitating tree rings. "The product surprisingly mimics the quality of real wood" she …
Urban intervention, naughty boy-style! The public media interventionists of VR/Urban have designed a cool tool to intervene into next nature: the SMSlingshot. A wooden, embedded …
Inspired by body language of animals (in particular squamates and porcupines), designer Jop Japenga created a headphone with an adaptive skin that responds to the music played on …
This umbilical cord-inspired charger cable by interactive media artist Mio I-zawa comes to life when connected to an iPhone. Don't watch the video if you are anthropomorphobic . …
Printer ink is assumed to be the most expensive liquid on Earth. If you believe the many websites that quoted the figure above. But little research learns that this is figure is …
The ‘Decay’ project explores how traces of time and use can be embedded in textile. By wearing a carbon fibre suit over a white blouse, textile designer Marie Ilse Bourlanges …
As the name suggests, Birthmarks Tattoos , are fake - but permanent - birthmarks that you can add to your body. Aside from its decorative potential, Birthmarks Tattoo makes it …
Blue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …
The Animal Architecture Awards have just announced the winners of their 2011 contest. Taking first place is Simone Ferracina's Theriomorphous Cyborg , a (speculative) augmented …
This project explores the invisible terrain of WiFi networks in urban spaces by light painting signal strength in long-exposure photographs. A four-metre long measuring rod with …
Dutch designer Boris Rijksen experiences a culture shock when he enters the real world after a day of screen work. Before, the ‘digital immigrant’ struggled to understand digital …
Designer Hideyuki Kumagai must have been inspired by the seasonal colors of nature when he designed this thermometer. Stick the leaves to your window, or make a bush at your …
Nico is cute, cuddly and serious about your child’s health. Many adults smoke around children with no thought for their developing lungs. Covered in nicotine-sensitive nano-cloth, …
Roads are a ubiquitous, even defining aspect of our urban and suburban spaces. In the United States alone, parking lots and roads cover 16,000 square kilometers. So why must roads …
Artist Bartholomäus Traubeck created a hyper-nostalgic record player that, rather than making music from vintage vinyl records, uses slices of woods to generate sound.
Made to beat the real thing. By digital artist Andy Thomas .
Advertisers have figured how how to induce auditory hallucinations into your morning commute.
For every smartphone user to recognize, is that merely the lighting of your screen, a vibration or ring distracts you from almost every activity. Even when you are spending time …
These unbelievably rich and dazzling graphics were made to avoid enemy attack.
In the Ruriden cemetery, in Tokyo, over 2.000 Buddhas statues are illuminated by high-powered color changing LED lights.
Modern technologies give deaf people the ability to hear again, not only regular sounds but also the invisible Wi-Fi signals.
Updating the old paper magazine into the digital realm.
Before global positioning systems, we all used maps. And they could be very annoying.
We are all journalists in a century in which Twitter is the main news outlet.
These paintings by Johnny Abrahams look almost computer made - except they are not. Working mainly with black and white acrylic paints and with a lot of patience, the American …
The Bored and Brilliant project asks people to measure their smartphone use take some conscious steps to limit the digital interactions.
An artist installed a sculpture on the main street of Ljubljana, Slovenia, that measures the blueness of the sky.
The entire continent of Australia has shifted and that's a problem for GPS, meteorologists, automated cars and even drones.
Tracking your workout can help improve the safety and optimize routes for cyclists and pedestrians in your town.
James Bridle is comparing vast amounts of historical weather data and polling results in order to produce hybrid weather forecasts.
This live stream video of a Bald Eagles family nesting in Florida has counted more than 72 million viewers.
There is a WiFi network illegally configured that interferes with the rain radar creating a ray of "clouds" that won't bring any water.
The Pollution Pods installation replicates the smell and air quality of five different urban environments, forming the smell of a global economy.
As if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …
To some extent, it's a chicken-and-egg question: Are you unable to think about things you don't have words for, or do you lack words for them because you don't think about them? …
In configuring our next nature, artists and scientists explore new languages that move beyond the Anthropocene - the era of human beings. These semantics would bridge the gap …
When I was a kid, my parents took me to the beach every summer. We’d swim in the ocean and play on our inflatable raft in the surf. When the tide was low, I’d build a sand castle …
Have you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
It’s been over a decade since artificial retinas first began helping the blind see. But for many people, whose blindness originates beyond the retina, the technology falls short. …
The first essay ever written on Next Nature, published in Next Nature Pocket and in Entry Paradise, New Design Worlds . ( download pdf ) (German version: Erkundungen im Nächste …
Die Natur verändert sich mit uns (English version: Exploring Next Nature ) by Koert van Mensvoort , published in Entry Paradise, Neue Welten des Designs, Gerhard Seltman, Werner …
The eye passes on more information to the brain than the brain will process. In that sense, the brain functions as a filter. But on the battlefield the risk of neglecting …
Alright, we were mistaken. Money isn't virtual after all. A recent TV commercial of a Greek bank shed light on the issue. Your money lives, is anthropomorphic and inhabits an …
We humans simply feel more comfortable with technological change when it comes in a familiar form that refers to an existing and accepted object, habit, value, tradition or intuition.
Data doesn't live forever – and a new breed of archeologists are trying to recover it.
There is a similarity between strings of binary and strands of organic DNA: they both carry actionable information encoded into reconfigurable symbols. Using nature’s biodiversity …
How technology becomes nature in seven steps
Digital bits have lives. They work for us, but we totally ignore them. What do bits really want? Here are the life stories of four different bits.
A few days ago, these images of iconic buildings in Beijing as they look with and without intense smog have been posted on Weibo, one of China’s most popular social media …
Do you feel information overloaded? Do you experience stress? Do you feel like you are addicted to your smartphone, laptop, or the Internet? Get yourself digital detoxed!
Sensor specialists recently developed a sensor that mimics the mammalian eye.
As early as 2009-10 , researchers were looking at Twitter data mining as a way to predict the incidence of flu. At the time, the H1N1 virus, or “swine flu,” had made the jump from …
Travelling to work, meeting friends for a catch up or just doing some shopping are often taken for granted by people with no known disabilities. For the visually impaired, these …
What if design began to put everything but the human first? The needs of the human not paramount to the design process, but instead the other entities that we cohabit planet earth …
Is social media ruining the world? Dramatic political polarization. Rising anxiety and depression. An uptick in teen suicide rates. Misinformation that spreads like wildfire. The …
Are we alone in the universe? The famous Seti (Search for Extraterrestrial Intelligence) programme has been trying to answer this question since 1959. American astronomer Carl …
The digital world has been creeping closer to your face. Was a time when a laptop was about as personal as you got with a computer. Then came smartphones, and a few years later, …
Next Senses explores the unchartered territory of how we could experience the world with technology
One day you will step into the garden to look at the flowers - and the flowers will look back at you. Rich Fletcher, Nikolai Slavov, and Hiroshi Ishii from MIT Tangible Media …
Jos de Mul (Erasmus University Rotterdam), published in Next Nature Paperback, 2005 For someone whose main instrument is a computer, the world becomes a gigantic database. We see …
Mark Weiser (originally written for ACM Interactions ). What is the metaphor for the computer of the future? The intelligent agent? The television (multimedia)? The 3-D graphics …
The Augmented Cognition System will help the brain adapt to data on computer-screens. If there's too much/little data, it will decrease/increase the information for you. If the …
Paradise by the Laptop Light is a visual power event with short films, speedlectures, special guests and one laptop. It will be held on 23 November 2007 16:30, as part of STRP Art …
Nowadays, children know more corporate logo's and brands than bird or tree species. The average Western person has more worries about the instability of financial markets and …
Nature is itself a free market system. A rain forest is an unplanned economy, as is a coral reef. The difference between an economy that sorts the information and energy in …
Since the early days of the net, the electronic pastoral has lent itself to all sorts of dubious agendas pushed by science, the military and even libertarian tendencies. In the …
Whoever you are, whatever you do, wherever you may be. You can’t beat the real thing. It really refreshes and brings real satisfaction in every glass. It was not until America’s …
Paradise by the Laptop Light is a next nature event with short films, speedlectures, special guests and one laptop. It will be held on 12 September 2008 16:30-17:30, as the …
If you've ever wanted to know just exactly how much DNA you share with your ridiculously tall brother or doppelganger best friend, you'll soon be able to find out. 23andMe , a …
Meet midori-san , the first blogging houseplant! Through sensors connected to the leaves of this Sweetheart Hoya reads bioelectric currents through the plant, this gives …
An interviewer once asked Pablo Picasso why he paints such strange pictures instead of painting things the way they are. Picasso asks the man what he means. The man then takes out …
It is a well known secret that plastic hardly breaks down and almost all of the plastic ever made still floats around somewhere . With the great pacific garbage patch now twice …
DNA evidence has been the most bulletproof evidence for forensic sciences in recent years. Not anymore. A laboratory at Nucleix, a life-sciences company, has demonstrated it is …
DNA related tools, once expensive and restricted to research and crime labs, are rapidly becoming affordable. Like GPS – once a high-tech wonder now turned into a everyday gadget …
Lenka Clayton : A series of five digitally repaired images taken in Lebanon of buildings damaged by the 2006 conflict with Israel. The images were taken specifically for this …
Make no mistake, you're not looking at the latest Barbie line: These are the The Pussycat Dolls. Formerly an LA stripper show burlesque show, now upgraded to be pop music …
Coughing into your cell phone could soon save you a trip to the doctor's office. Thanks to software currently being developed by Star Analytical Services , people may soon be able …
My name is Jason Silva. I've spent the last 5 years hosting and producing a tv show on Al Gore's Emmy-winning Current TV network and I'm a fellow at the Hybrid Realities …
Hippopotamus: a 2,5cm-long tablet-shaped nonliving chewable animal, member of a multi-species flock known as the Animal Parade, which tastes like fruit and is found in little pill …
As neuroscience progresses, we gain access to previously inaccessible and unexplored areas of the human mind. Consequentially the intricate processes in our brain are cultivated …
No shellfish, no peanuts, no soy, no milk, no eggs. An increasing number of people suffer from various food allergies, which force them to constantly scan food packages for …
![Visual of Manko & Nothing [#5]](https://nextnature.net/media/pages/magazine/story/2011/manko-nothing-5/8f13acd5d1-1602632753/manco-4-868x486.jpg)
Manko was completely cut off from everything around him, virtually dead, buried alive inside of his own body. He remembered Zero's advice not to panic, but to no effect. He had no …
In combining the classic feeling of handling a book with the interactivity of the computer, Waldek W?grzyn of the Academy of Fine Arts in Katowice, Poland, has created a new human-computer interface.
Neural synapses in the human brain are extraordinarily complex structures. Responsible for relaying information between neurons, chemical synapses govern the release of over 100 …
The Singularity , as popularized by Ray Kurtzweil, refers to a near term, theoretical time when machine intelligence greatly surpasses our own. At this point we will experience a …
Need a personal trainer? Google's new sneakers fulfill the role of a human coach.
Wine and bacteria combine to make seamless clothing.
Baudrillard intersects with social media in the world of fake online girlfriends.
Media artist, filmmaker and wonderjunkie Jason Silva talks about technological evolution and why humans are gods with anuses.
Submit your speculative product to the NANO Supermarket and win 2500 euro.
Need a password that you'll never forget and can never be stolen? Try storing it in a pill in your gut.
Restoring the sense of touch with an artificial hand, using a brain interface.
In this approaching era, what might be biologically possible for plants?
There seems to be a high demand for the ability to self-diagnose. Consider Scanadu , a company developing a medical device for self-diagnosis, has become the highest funded …
We have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.
Stretchy artificial skin lets prosthetic hand sense heat, humidity, and pressure.
Super Mario is now able to learn and feel in the confines of his 8-bit universe.
Scientists in Russia have taken a next step in the development of artificial intelligence by creating a "brain" that is able to educate itself.
Francesca Barchiesi's glove concept allows the user to translate hand gestures into images and information.
Nowadays humans suffer from diseases that didn't exist in the past, a trend that will probably continue into the future. A wide range of new disorders, especially related to the …
Last April, a Chinese group of researchers published a paper that set the scientific world ablaze in a fierce debate. The paper was about their attempts to edit the DNA of a human …
Recently 338 sharks in Western Australia subscribed to the microblogging service. They are now tweeting out where they are.
It seems thinking machines could put the human race in danger. How realistic these fears are?
How to monitor the effects of El Niño ? The Nature Conservancy wants to take advantage of the massive image production that can be collected using smartphones and drones. From …
We humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.
Dutch experience designer Leanne Wijnsma designs for the human instinct and puts the sense of smell back to where it belongs, as modern hazards have shifted to the digital realm.
Interview with Mike Thompson and Susana Cámara Leret.
This is the WiFi drone, a useful companion that perfectly blend into our environment while providing us with information and connectivity.
While robots are becoming more and more human, with all their sensors and information processing abilities, may it be likely that they too could develop mental illnesses?
We know how it feels to catch a cold; how might it feel to catch malware?
Air New Zealand is equipping its flight attendants with AR headsets to explore in-flight optimization, giving its passengers a glimpse of what the future air travel service might look like.
Google cars can now measure urban air quality and collect data to create interactive maps with the most detailed views of pollution patterns ever created.
The gift giving season is once again upon us and to help out those who are struggling to find that perfect gift for that special someone we have brought together a collection of Next Nature inspired gifts.
If humans would disappear from the face of the Earth today, we would still leave 30 trillion tons of mass in the geological record. Certainly, "we were here" is written all over.
Toilet paper for smartphones now on offer at Japanese airport.
An external device that helps you conceive, carry and raise a child. Too scary? Or extremely useful? It's up to you to decide, your virtual midwife is here!
How many cyborgs did you see during your morning commute today? I would guess at least five. Did they make you nervous? Probably not; you likely didn’t even realize they were …
Blockchain is useful for more than cryptocurrency. It’s revolutionizing industry after industry. Next, it may change the way we get our food. The agriculture industry is complex. …
Recent years have proved that if you want to look for which countries are adopting innovative digital governing solutions, you don’t look at the usual tech suspects like the US or …
Don’t be surprised when you catch a human face on a screen strolling through the Van Abbe museum for contemporary art in Eindhoven, as these are Europe’s very first robotic …
In 2017, two years after her father died , Ira van Eelen decided to call the Dutch Arable Farming Union. She couldn't help but wonder how come the Netherlands was still not …
Conventional wisdom says that you can’t replace the human touch in terms of medical care, but in our rapidly changing technological environment, it appears that this perception …
Are you working on projects where technology and human interaction are involved, and are you looking for a new approach? As of today, we offer a brand new workshop concept for you …
Don’t adjust your TV set, that’s just a new computer-generated news anchor working out the bugs. Xinhua, a Chinese state-run media company, and Sogou, a Beijing-based search …
Not only is air pollution bad for our lungs and heart , it turns out it could actually be making us less intelligent, too. A recent study found that in elderly people living in …
Bio design crosses the border between the ‘made’ and the ‘born’. Enabling living organisms as essential design elements, it brings us products that adapt, grow, sense and repair …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
At this moment in time, many people are staying at home in order to flatten the curve . It is times like these that we realize how vital technology is to us and our societies. It …
Today we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …
Imagine if everyone spoke a language that you don’t understand. It’s not a foreign language–it’s been spoken around you since the day you were born–but where as everyone else …
While Elon Musk may be trying to initiate efforts to colonize Mars, scientists on Earth are attempting to build an accurate digital twin of the planet to simulate in the future. …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Most people think of mammoths as the iconic woolly species from the last Ice Age, which ended around 12,000 years ago. But mammoths originated in Africa around 5 million years …
Visual artist Heleen Blanken explores the complex relationship between people, nature and technology.
Digital becomes physical. Move your cursor using this mouse cursor. You can buy one here .
Written by Debbie Mollenhagen PART 1: FROM LINEAR TO CIRCULAR Designer living has become designing life. I often ask myself: did it taste like the real thing? But when I open my …
Crowd counter is a piece of software able to track moving features within a video clip. It works on the assumption that points that move together are most likely part of the same …
The extent to which new technologies are intervening with everyday life can hardly be underestimated. Virtual realities, nano- and biotechnology are increasingly providing new …
The new Bob Ross has arrived: his name be Gautam Rao. This painting shows a magnified part of the dock in OSX. I especially wanted to highlight the Picassoesque face on the Mac …
Will our mobile devices look like this in two years time? This is an example-application of the featherweight QVGA (320x240 pixels) active-matrix display: Phillips e-paper . (It …
The 'tooth phone' consists of a tiny vibrator and a radio wave receiver implanted into a tooth during routine dental surgery. Sound, which comes into the tooth as a digital radio …
Google has added it's first map of a Solar Planet to the google maps. The map of Mars provides detailed information of its mountains, craters, plaines and more (including …
However very little (background) information is given; in November or December 2006 the MyTelescope.com project and website are said to be up and running for everyone who want's …
A short story by Terry Bisson. For those who prefer video to literature, there's also this seven-minute film adaptation . "They're made out of meat." "Meat?" "Meat. They're made …
Epic is a fictional prospect (from 2004) on the future culture of media and internet-corporations. The human addiction to news and information must - according to this video - …
You have the impression that the disasters of the world do not touch you anymore? You feel vaguely sorry for other people's misfortunes but you don't feel the inner urge which …
Those crazy Germans are planning to build modern versions of pyramids that will function as gigantic burial sites. "The Great Pyramid can potentially be any human being's grave or …
Compubeaver by Kasey McMahon "I am interested in the way we interact with nature. As we become increasingly reliant on technology, we become disconnected from our natural …
Let's talk about hyperbreasts. Have you ever wondered why men like women with large breasts? Historically large breasts are presumably sexually attractive for men because they …
Kameraflage is a technique to put a layer on top of an image that can only be seen by digital cameras. In this way, an invisible layer of extra information can be added to a …
A bug that does the cleaning? This 1-meter (39-inch) tall, 1.35-meter (53-inch) long prototype robot ' named "Lady Bird" ' is designed to clean public restrooms at highway rest …
Just in case you hadn't seen this one . Informational spaces define physical spaces, rather than the other way around. The map is the territory? Let's just hope the territory can …
The history of art through the ages reveals a constancy that, by conscious or unconscious applications, provides us with an omnipresent correlation dealing with the …
Another project by Oded Ezer, Typosperma is the second experimental typo project in his 'Biotypography' series. As a paraphrase on the biotechnology definition, 'Biotypography' is …
Remember the article N is for Nature , describing the Californian company Enologix, which creates software to predict how wine critics will rate a wine, so that it can be produced …
Everyone knows some foods have more calories than others. For many people eating turned into an information science, having to continuously read the amount of calories of the …
Ambient Biomedia is an investigative project about using living beings, in particular plants, to display human lifestyle problems information. The working principle of our systems …
The free cultural paper Amsterdam Weekly discusses the Natural Revolution of and includes tree tips for successful living in the next version of nature. Download PDF (148kb) . …
To increase decrease CO2 a lot of plans are made to cover city buildings with roof gardens. One problem however is that those gardens tend to be quite heavy. Especially when you …
Playing God? – "We are not playing..." After having seen this TED talk by Craig Venter , I came across a cynical yet clarifying comic (etcgroup.org) on his plans to build a new …
GRONINGEN (NL) – Low-income people in the Dutch city Groningen should be able to buy a flatscreen television, according to the alderman of social affairs Peter Verschuren. The …
This Tuesday, search giant Google released an experimental tool that tracks the intensity and movement of the influenza virus across the United States by monitoring the number of …
://nextnature.net The convincing tone of the Iraqi Astronomy researcher Fadhel Al-Sa'd in his elaboration on the shape of the earth in an Iraqi television show, is just as …
Rule #1: A robot may not injure a human being or, through inaction, allow a human being to come to harm. Remember Isaac Asimov's classic three laws of robotics ? Surely thats …
The video below is featuring a computer-generated replica of actress Emily O’Brien’s face at high-definition resolution. The Image Metrics process takes a captured video and …
(Extracted directly from Pink Tentacle , thanks!): Researchers from Japan’s ATR Computational Neuroscience Laboratories have developed new brain analysis technology that can …
At first I thought this first pregnant man was a hoax, but after I saw it on Oprah I realized it must be 'real'. Well, the pregnant man is actually a former woman who had a sex …
Japanese scientists made people drive in circles to find out how traffic jams get born. Related: Human Swarms | Harvesting Traffic Information through GSMs | The things we design …
Get Wickd (props for the name boys – totally wicked!) is a tech-fashion brand that sells basic clothes with barcodes that can link your mobile phone to any page on the web, from a …
By MARCEL VAN DER DRIFT. Ten years from now, a cell phone gently sinks to the bottom of the river. It's one of the latest models. The clever design, trendy colours and nifty …
The shrinking size of electronics allows for the implantation of increasingly sophisticated electronic devices in the human body, paving the way for new prosthetics and …
By DAVID BARBOZA SHANGHAI — China made public on Tuesday regulations aimed at cracking down on the use of virtual currencies amid worries that a huge underground economy was …
As our lifes are increasingly regulated by electronics and there is a drive towards the miniaturization and portability of electronics on and around the body it seems only logical …
Remember the days when the flavor of a fruity drink was simply connected to an apple, orange, strawberry, kiwi, or perhaps – if you felt really exotic – an acai berry? Nowadays we …
Data-hungry companies like Google, Microsoft and Amazon could reduce their energy consumption with 40% by rerouting data to locations where electricity prices are lowest on a …
Chinese workers slaying monsters to earn gold for western consumers. It sounds surreal, but it is a far from virtual reality for the so-called 'gold farmers', who are working in …
On May 12, 2009 the ACLU and the (not-for-profit) Public Patent Foundation, filed a lawsuit, charging that patents on two human genes associated with breast and ovarian cancer are …
Following anorexia nervosa (under eating) and bulimia nervosa (overeating and compensating), orthorexia nervosa (obsessively healthy eating) is the latest eating disorder in the …
Only for the title already I wanted to post this as soon as I read it on Nature.com. The newsarticle is entitled " GM crop escapes into the American wild ." Brilliant! Let's walk …
The food printer seems to be one of those lustrous concepts that continues to pop-up in the fantasy of techno-connoisseurs. Some years ago James King already proposed a printed …
Douglas Coupland is a writer and artist based in Vancouver. For the canadian newspaper Globe and Mail, he wrote The ‘radical pessimist's guide to the next 10 years’ a dystopian …
Newly created synthetic particles that mimic red blood cells may one day carry drug molecules and/or oxygen through bloodstreams, scientists write in the Proceedings of the …
Bitquid is an installation by Jeroen Holthuis which shows digital information transferring in an analogue way, through the use of fluorescent liquid. Nowadays the use of internet …
In response to the latest oil spill famed photographer Steven Meisel made a shoot for the Italian Vogue (the only fashion magazine in the world worth reading, really) that …
By analyzing billions of phone calls, researchers at Scandinavian telecom company Telenor , mapped how social connections between people – measured partly by how often they called …
Could this 2.0-bird be suffering from Infobesity ? Then it must be the result of excessive infocalorie consumption. Following people and news-sources on microblogservices like …
In the older days, people had to cross natural barriers like mountains for survival purposes. Grains from one side of the mountain was traded with cloth from the other side, for …
Look around you and try to find the most natural thing in the room you are in now. It is you. Now, you wouldn’t be so sure in the apocalyptic Los Angeles of 2019 depicted in Blade …
All buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …
Corporate logos constantly have to adapt in order to survive. In the case of the Shell oil company this results in an image that ironically resembles the ones we know from the …
Avatars are commonly known as virtual characters in the digital realm representing a user. But what if avatars could house personal history, profile and ideas? Could that enable …
An earlier post on Next Nature learned that The Good People behind Webwill provide us with a service to extend our lives on social networks after our physical death. But what if …
Image consumption has never been as cool as in this brand new clip by Studio Smack , which was created for the upcoming Graphic Design Festival . The ‘Transparency Suit' …
Did you know that about 20 percent of your body isn't really yours? It has been patented by some corporation you probably never heard of. You can't patent gold, you can't patent …
Indulge in the paintings by Alex Gross . There is 'something' next nature about them... If happen to have more information on what that 'something' is, feel free to enlighten us …
That's no reindeer, and it's certainly no moose. It's an Irish Elk, Megaloceros giganteous , a deer that happens to be neither an elk, nor really all that Irish. What it does …
Are you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …
You look at the great dane and wonder what information the QR codes on its pelt might contain. You point your smart phone camera at the dog and realize you’ve been hit by a …
Some of you might remember the Next Nature article by Rolf Coppens called Withus Oragainstus . Since then there have been occasional newsreports on cyborg insects. For instance …
Along with the Heck cattle and Scottish Highlanders , another reconstructed species roams the Dutch dunes . The sturdy Konik horse , also known as the Polish primitive, is the …
![Visual of Manko & Time [#13, The End]](https://nextnature.net/media/pages/magazine/story/2011/manko-time-13-the-end/ad243e97e0-1602632753/manko13-868x486.jpg)
Many things have been rumored about the artist called Manko since he vanished about a year ago. Some even went so far as to claim he had died. So it was all over the news when …
Are we creating the penicillin or the asbestos of the 21st century? Prior to the arrival of the Nano Supermarket , we share some speculative nanotech products with you. Here’s the …
Always wanted to work in a Supermarket? Here is you chance. The Nano Supermarket seeks assistants. The Nano Supermarket assistant is part of a team, knows the products and knows …
Over the last few days the Next Nature website has been suffering symptoms of dementia due to a hardware failure at our very fancy and luxurious web hosting provider Media Temple …
If Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …
MyMicrobes , interestingly dubbed "Fecesbook" by ABC News , is the new social network for your gastrointestinal bacteria. For only $2,100 and a bit of poo you can become a member …
Recently, a video clip has been circulating the web that purportedly shows a rabbit born earless due to the radiation at Fukushima. BoingBoing has a convincing take-down of the …
I've noticed DNA spray notices springing up around Amsterdam. I assumed it was a fairly standard anti-theft device: A crime is committed, a little nozzle is activated by the …
The sublime is an aesthetic concept of 'the exalted,' of beauty that is grand and dangerous. Through 17th and 18th century European intellectual tradition, the sublime became …
How natural it is to travel with the train. The flat screens in the trains of Dutch Railways almost makes you believe that it is a yellow, blue spotted caterpillar in the long grass.
Twenty-first century society draws from a world that is less determined by objects and increasingly shaped by connectivity. The clear either/or distinctions that formerly informed …
Could you imagine yourself having QR-code freckles, or a chlorophyl skin? Dutch artist Marcia Nolte visualises these kind of speculative scenarios in a very non-spectacular yet …
Previously, experiences of time emerged from nature as given – offering seasons, the rhythm of humans, plants and animals. Nowadays, people integrate nature-time, body-time, inner-time, clock-time, and global 24/7 systems-time. Human beings, in past, current and next natures, have to deal with emergence and design of time in order to survive.
During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . To kick the series off, we’ll start with a spread about hypernature; the …
During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week the second one in this series: Google Nature. Imagine you are an …
During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week the thirs one in this series: Tomorrow’s Fossils. Ode to the car …
During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week a tool that encourages us to experience local specialties through …
During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week, after nation branding, the brand nation. Entering the store or …
During the coming weeks, we present a selection of our favorite pages from the Next Nature book . This week a page that is an homage to Marshall McLuhan, who is one of the most …
We call upon designers, technologists and artists to submit their speculative nanotech products for the next round of the NANO supermarket.
Like we did to old nature before, we must now cultivate our technological environment.
If you happen to be in the neighborhood you may want to attend the Next Nature lecture at the Island Design March on March 22 in the "most northerly capital in the world". If you …
In this essay, anti-civilization, anarchist philosopher John Zerzan critiques the concept of 'next nature.' He argues that rather than freeing us, our self-domestication through …
Besides children and pets , it turns out that pigs are also attracted to interactive interfaces. Pig Chase is a computer game in which pigs and people can play together. The aim …
In this particular piece of video art, loyal readers of nextnature.net might recognise the building as Zeche Zollverein in Germany, where we organized the Biggest Visual Power …
For almost three years, we worked on a sneaker company that we knew would go bankrupt on the day it was founded. This is our coming out...
You all probably know the ' Twitter implant ' from the Nano Supermarket . Scientist at the University of Princeton now created the first working prototype. The implant is actually …
Can you do it? Do finish your lunch before clicking the link – or you might vaporise. The video was made by Jason Silva for the ongoing TEDGlobal 2012 which has Radical Openness …
Often cockroaches aren’t people's best friends, but maybe in a few years you will be relieved when you see a cockroach. Researchers of the North Carolina State University …
During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week: The World Card Wood, the worlds' most prestgious and versatile …
A stunning pre-history of the anthropocene
Biohacker Tim Cannon inserted a chip into his arm to monitor his bodily data and transmit it to an Android device.
Do humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.
How can we anticipate what happens after the technological singularity?
British research group created anew scanning technique permits to obtain 3D images and detect wavelengths that our visual system is not able to see.
Putting the birds into the bird's eye view of Google Maps.
Science Gallery is calling synthetic biologists, bio-artists, bio-designers, amateur biotechnologists and bio-hackers to submit proposals for projects for their upcoming flagship exhibition GROW YOUR OWN.
From the earthquake in Haiti to Hurricane Sandy to the Boston Marathon bombings, Facebook, Twitter and other social media were used to spread information and help citizens and …
In the movie Fantastic Voyage, a submarine and its crew were shrunk and injected into the body of a sick man in an attempt to save his life. Despite the fictional nature of this …
Digestible Microchips are now approved by the US Food and Drug Administration.
A new wearable device provides runners with info on posture, rhythm and stride length.
The Sniffer – aka Google Nose – visualizes odors using a smell sensor, which is as good as a dog’s nose, and a glass in front of your eyes.
For NSA, spying on you isn't enough, they monitor your avatar too.
Designed by a dancer, a new wheelchair moves intuitively with the user's movements.
Human test subjects felt empathy for dinosaur robots being cuddled or abused.
An artist visualizes WiFi waves across landmarks in Washington, DC.
The introductory essay from the Yes, Naturally book - available in our store!
Next Nature Network will take part in the Deutsches Museum exhibit "Welcome to the Anthropocene: The Earth in Our Hands".
Electronic whiskers put sensitive catlike sensors on robots.
Many people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.
Food and Concept designer, Chloé Rutzerveld, explains her 3D food printing project Edible Growth.
Is there a possibility to clean up the oceans from plastic pollution?
US-scientists extended the DNA alphabet with two new created 'foreign' building-blocks.
People have complex relationships with their own (and other’s) bodies. In Traditional Chinese Medicine (TCM), it is believed that your feet are a map of your body and can provide …
The BionicKangaroo technologically reproducesthe unique way a kangaroo moves.
To attract a female, male bower birds build structures and adorn these with colorful plastic decoration.
"It's time to recognize the Internet as a basic human right" its inventor Sir Tim Berners-Lee has said.
A selection of nine enthralling and striking concepts of future way of transportation.
UnderSkin is a device that would be implanted beneath the skin on your hand and charge off your body’s energy.
Although there seems to be no effective drug in use to cure malaria, a scientist robot named Eve may have found a cure.
Computer can already beat us in many tasks. Complicated calculation, processing speed and chess, to name a few. However, generally speaking, you’re still likely to be more …
Will handwriting soon be history? Or will we always prefer a handwritten love letter from our beloved?
From nutrients within an organism, to organisms within collectives, to populations within a territory and so on - nature offers models on how to deal with highly complex systems.
Cars - autonomous, self driving, uncontrollable - are bound to become the animals of the future.
There is a new artificial skin technology that could give humans magnetoception in the future.
Kirsten Zirngibl's illustrations depict imaginary landscapes that are formed by microbots.
"However, while 3D printers are becoming increasingly accessible and capable of rivalling the quality of professional equipment, they are still inherently limited by a small print …
Interview with Liam Young on his work in speculative architecture, the future, and our role in nature as humans.
We recently talk to Nadine Bongaerts about the role and impact of synthetic biology, the gap between biosciences and society and the importance of communication to overcome the fear of new technologies.
Droog Foundation and Next Nature Network invites you to join the conversation about Intimate Technology: April 23, in Amsterdam.
Japan city has launched an online street view map to introduce the view of the city by a cat's perspective.
In the quest for competitive advantage, companies adopt wearable biometric technologies to monitor employees and improve business results.
An international team of scientists used nano-sized needles in order to promote production of new blood cells.
On may 21st, Next Nature Network art director Hendrik-Jan Grievink will host a workshop around the idea of Speculative Sensing: exploring the potential of senses found in nature …
Stewart is a tactile interface that mediates the communication between human and self-driving car.
The new year is right around the corner, let’s forget about long-term future for a while to check out what new tech trends will hit it big in 2016. At the end of every year, …
Over the past decade scientists have tried to get technology surfaces to be as sensitive as our skin, especially as our fingertips. Human tact is a very sophisticate interface …
Some of our greatest cultural and technological achievements took place between 1945 and 1971. Why has progress stalled?
How does an indigenous culture sustain, extend, and evolve nowadays? Probably, it mainly depends on the preferences of the tourism industry. Here is an example from the Mursi, one …
Nasa funded a program to turn astronauts’ poop into food.
Breaking the silence, vegetables in a Japanese supermarket start to talk to the customers.
According to a study our PC, equipped with a list of things we "Like" on Facebook , knows us better than our friends.
It is the era of smart toys, but they certainly raise difficult questions for parents.
Fitbit just released a new motivational feature that aims to trigger their users to go out and exercise more.
New study suggests that the real environmental problem is embodied in the things we buy.
Last week nearly 70 portraits of cats replaced all advertisements at the Clapham Common tube station in London.
Read Nicholas Carr's essay on the transhumanist dream of having wings.
Loneliness is a major social issue and can only be 'cured' with real world interaction.
A new Google Maps app is designed to get kids exploring the Himalayas without having to actually go outside.
Big data is reforming politics, but is it for the better?
Is the use of personal devices becoming a replacement for the spectrum of emotions that make us all humans?
With virtue signalling, the joys of moral superiority are just one click away!
Exploring the surface of Mars at least 15 years before a human being in flesh and blood will be able to, this is the new ambitious idea of the people at NASA.
Using biology as a model for innovation and progress, Alyssa Stark embodies the essence of Biomimicry.
Meet the firefighter drone, she is the best at extinguishing fires and keep every species safe!
In the port of Rotterdam you might be able to cross a floating Waste Shark: a robot able to collect up to 500 kilos of trash.
In their pursuit of mapping the physical world online, mapping services simultaneously shape our understanding of it too.
For the first time in history the world population counts more people who are too fat than too thin.
Pokémon Go is shaping social relationships amongst individuals.
McDonald’s provided their Happy Meals with a high-tech activity tracker toy.
Meet Amelia, the first robot to work along with human coworkers in a council job.
With the evolving technique called EEG, electroencephalography, we can measure brain activity and ultimately even read the brain.
Today, we all have superpowers. It may not seem like it because we are attached to our physical devices to use our powers, but with a Neural Lace that may soon change.
Researchers at University of Washington have introduced a new wireless communication method that allows small wearable devices to ‘talk’ to everyday devices.
Where most researchers are focusing on keeping bees alive, researchers of Harvard are developing a bee replacement; the Robobee. The Robobee is only the size of half a paperclip, with ultra thin wings flapping 120 times per second. The main goal is to build a mechanic pollinator.
Coop Italia has opened a flagship store in Milan to present their vision of what grocery shopping might hold for us in 2050.
Our bodies are microbiomes, suffering from our habit of cleanliness.
There is a new breakthrough coming from the operating room: an app, called MDLinking, that connects 8.5 million doctors world wide.
Our cities are made out of steel and concrete. What if we replace them with wood and bone?
A robot monk has been created in China, mixing spirituality with artificial intelligence.
Future workspace, human interaction and unique experiences: here’s how artificial intelligence and VR impact on architects and engineers.
A recent study demonstrated how artificial light is a serious threat to plant pollination. It puts plant reproduction in danger, as well as the whole ecosystem.
Bionic leaf fertilizes crops to make them weigh 150 percent more
With her project Future Food Formula, food designer Chloé Rutzerveld is looking for innovative methods to design vegetables.
Due to its digital citizenship program, something interesting is happening in Estonia. In July there were more new applications for e-citizenship than newborn babies. Are we …
Virtual reality experiment tries to help people frightened of death with outer-body experience.
Uber built a fake city called Almono to train self-driving cars. This town is full of fake houses, mannequins and chaotic intersections.
The complicated system of a female menstruation cycle was reproduced on a computer chip for the first time.
This week our virtual reality experience landed at the inaugural VR program of SXSW festival.
Our Next Nature Habitat VR experience has won the Sweden International Virtual Reality Award in the category Best 360 Video!
As a data waiter you are working at the Tinder restaurant. Upon arrival, visitors log in with their social media account. An intelligent algorithm matches the guests based on …
We recently spoke to Ilari Laamanen, to peel the outcrops of Momemtum9, and unveil the overlapping themes to the next nature philosophy.
NNN director Koert van Mensvoort writes a letter to humanity.
Sen is a space television network that provides visuals from other planets in order to prepare us for our multi-planetary life.
The Next Nature Academy offers the philosophy, the tools and the methods that will shift the way you think about nature and technology.
NNN organizes workshops using a physical Pyramid of Technology as conceptual tool.
Will cows still graze fields in an in vitro future? And what might we do with these animals when they naturally die?
Next Nature Network is curating the One Minutes series for September 2017.
Pic2Recipe is an artificial intelligence system able to recognize ingredients, identify a dish and suggest recipes from a single image.
A new feature rumored to be in the next iOS update called Theater Mode could dim smartphone usage in cinemas.
The Pyramid of Technology toolkit is a workshop-in-a-box that helps you better understand technology and catalyze innovative processes.
The Dutch province Gelderland-South uses two educational robots to increase kids' knowledge on such a technology.
It's getting difficult to discern what's technology and what's not.With wearable technology becoming more and more integrated into society, our lives become infused with more technology.
The first robotic officer will soon report for duty in Dubai.
This is post number one of our serie 'Robots at Work'. In this episode we present you five jobs for caretakers, the ones that work with their hearts.
Shazam for Plants app lets you catch around 400.000 plant species left on our planet through the lens of your smartphone.
The sun sustains our planetary system. Its energy fuels life. And in the future, the sun will also fuel our cars. That’s the premise of Dutch startup Lightyear, a startup specialized in solar powered electric cars.
Dutch commercial telecom provider Ben recently launched an advertising campaign to sell smartphone plans by promoting disconnection.
Smiling broadly and rattling with enthusiasm, the 33-year-old Rylana Doesburg shows off a QR-code on her phone: an angular pattern of black and white squares. “Thanks to this …
It’s been called China’s “pork miracle.” For centuries, pig-rearing in the country was predominantly a backyard occupation. (The etymology of the Chinese character for “home” …
We need to change the way we power our daily lives. Burning fossil fuels is the primary cause of climate change, yet this is still our main source of energy. Much of this energy …
Scientists developed an e-skin that lets the wearer manipulate virtual objects without touching them, by using magnetic fields.
Agriculture may be one of the oldest of our technologies. Over time it has developed, changed, revolutionized, industrialized - or simply put, it has evolved . Today’s farms are …
It's not an easy task to define the practice of designer Jasna Rok . Fashtech pioneer? Radical innovator? Visionary designer? ‘All of the above’ seems only appropriate. In fact, …
Five people suspected of illegal gold mining in Peru are in custody after indigenous community members used a system called ForestLink to alert authorities to the activity. …
Well, we finally made it. After a long, cold, dark winter, spring has officially started today. And guess what it's bringing with it? Nope, not spring flowers: Love flowers! …
The story of money: an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. The final episode: bits.
While many love to speculate about the sheer number of jobs that robots and artificial intelligence are going to replace in the near future, no one seems to be coming up with any …
The South Beach diet. The Atkins diet. Eating paleo. Cutting out gluten. Going vegan. The list of fad diets and health crazes goes on, yet health statistics in the US and around …
Images largely shape our experience of reality. Just consider how imagery of nature continues to rise in popularity: only a society no longer grounded in their natural landscape …
Robots are coming for our jobs. Virtual reality is coming to make the jobs that remain easier to accomplish. All of the world’s manufacturing sectors are in the process of …
Last week, the gene editing world was hit by news the equivalent of a nuclear bomb. In a video on YouTube , Dr. Jiankui He at Southern University of Science and Technology in …
With New Year’s resolutions in full swing, many people may have chosen to cut down on their tech use – or even give it up altogether. The growing popularity of such “digital …
The way people get around is starting to change, and as a professor of transport strategy I do rather wonder if the modes of transport we use today will still be around by the …
Emoji, Skype, Selfies - can these communication technologies close the generation gap? In part, yes! Young people are teaching senior citizens how to use technology, and it’s …
