Video Game-Playing Robot Acts More "Human" than Humans
Allison GuyComputer-controlled players in video games can usually be spotted for their repetitive, illogical or unemotional behavior. Unlike humans, non-player characters (NPCs) don't get …
Search results for More than human approach
Transgenic Jell-O, more human than ever!
Allison GuyThe American Chemical Society has announced a new method of producing gelatin that sounds like good news for cannibals and the canni-curious. Researchers are able to create …
Robotization Makes Work More Human
Koert van MensvoortImagine being 16 and studying for a job that soon won't exist. What kind of future is that? New occupations will come thanks to robotization.
'Team Human' is a manifesto for humankind
NextNature.net' Team Human ' is a manifesto—a fiery distillation of media theorist Douglas Rushkoff’s most urgent thoughts on civilization and human nature. In one hundred lean and incisive …
This year's electronic waste weighs more than the Great Wall of China
Vanessa Bates RamirezIt’s widely known that the world has a plastics problem. What’s less widely known is that we have a similar problem with another kind of waste: electronics
Humane Technology #4: Resonate with human senses
Allison GuyPrinciple number four: Humane technology should resonate with the human senses, rather than numbing them. If you're an office worker or a video game fanatic , you may spend most …
Humans Caused Mass Extinctions Before There Were Even Humans
Allison GuyHumans and other hominids have a reputation for bringing about mass extinctions. Homo erectus has been blamed for the disappearance of many African carnivores, our ancestors …
A More Interesting, More Depressing Theory of Easter Island's Downfall
Allison GuyA new theory claims it wasn't human deforestation that caused the ecological collapse of Easter Island, but something smaller and squeakier.
Explore your relationship with AI in this exhibition
NextNature.netWhat makes us human? And why do we sometimes fear artificial intelligence? And what about technological singularity - the moment in time when artificial intelligence outperforms …
More than Fake Nature: The Surprising Sociology of Museum Taxidermy
Allison GuyThe greatest taxidermy in the world reveals a great deal about our changing notions of nature.
To Be Human Is To Be Transhuman
Alessia AndreottiBuckle up for a new video from our favorite performance philosopher Jason Silva: To Be Human Is To Be Transhuman.
More leg = more money
Rolf CoppensThe Stock market skirt Nancy Paterson made a blue taffeta & black velvet party dress that represents the real-time stock market situation by lowering or raising its hemline. …
Why does a Salad Cost More Than a Big Mac?
Koert van MensvoortRemarkable infographic by pcrm.org . Via NY Times , via Consumerist.com .
Letter to Humanity
Koert van MensvoortNNN director Koert van Mensvoort writes a letter to humanity.
Talking Nonhuman Nonsense
Nonhuman Nonsense is a research-driven design and art studio existing somewhere between utopia and dystopia. They wonder upon our relationship with the non-human, embracing …
NASA's 'Human Computers' helped land the first human on the moon
Kelly van GemertNowadays mechanical intelligence is often chosen over that of our own human capabilities. But there was a time where our computers were still not always a match against our own …
Humane Technology #6: Improve the Human Condition
Allison GuyAnd now for the sixth and final principle: Humane technology improves the human condition and helps people realize the dreams they have of themselves. No matter what your …
Why superhuman technologies will affect us all
peter joostenWhen you look through a super-telescope, you can still see the planet Earth. Once called the blue planet, she now looks red and parched. We had no choice but to abandon her… On a …
Humane Technology #2: Revive Human Intuitions
Allison GuyOur second principle: Humane technology revives human intuitions, in particular those we might have forgotten about. 'Conventional' technology aims to overcome our hominid …
We Are more Bacteria than Human
Ingmar NieuweboerOur bodies are microbiomes, suffering from our habit of cleanliness.
Why human enhancement requires technological citizenship
Ira van Keulen and Rinie van EstNew technologies – from artificial intelligence to synthetic biology – are set to alter the world, the human condition, and our very being in ways that are hard to imagine. The …
Humane Technology #3: Take Human Values as a Cornerstone
Allison GuyThe third principle of humane technology: It should take human values as a cornerstone of its development. Technology doesn't have to be expensive or electronic to be humane. …
Can technology be humane?
NextNature.netWe must be mindful about how we engage with technology: what we use it for, why, and whether it helps us or hinders us. Sometimes our tech seems to be flowing in inhumane …
On inhumane technology
Jack CaulfieldStick-on shoes, wakeup lights, bionic limbs: these are examples of humane technology. But what exactly does this mean? It can best be explained in contrast with its opposite. …
Six principles of humane technology
Allison GuyWe must be mindful about how we engage with technology: what we use it for, why, and whether it helps or hinders us. Sometimes our tech seems to be flowing in inhumane directions, …
Human-animal hybrids are coming and could be used to grow organs for transplant
Mackenzie GrahamAround the world thousands of people are on organ donor waiting lists. While some of those people will receive the organ transplants they need in time, the sad reality is that …
A path to humane technology
Koert van MensvoortIn 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …
Next Generation: Towards the Plastic Human with Max Ahluwalia
NextNature.netThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Discussing non-human centered design with Kelvin Godee and Simon Wijrdeman
What if design began to put everything but the human first? The needs of the human not paramount to the design process, but instead the other entities that we cohabit planet earth …
The No(nhuman) Consent Form
Kelly van GemertThere seems to be a green shift happening in Dutch Design, where the traditional vision is slowly sprouting into a newer, more refreshing one. The biodesigners are emerging from …
'The Invention of Morel’ is a techno-lovestory from the future, written in 1940
NextNature.netOctavio Paz says calls The Invention of Morel , “ without exaggeration… a perfect novel. ” According to Borges, “ to classify [it] as perfect is neither an …
Humans could recolonize Earth after mass extinctions with ectogenesis
Matthew R. EdwardsLately it seems that every movie, book and video game we see is about future apocalypses. Science articles are also painting a grim future for Earth and its inhabitants. If it’s …
Humans Are the Sex Organs of Technology
Written by Kevin Kelly , published in The Technium . I claim that technology has its own agenda. What is the evidence that technology as a whole, or the technium as I call it, is …
The Ecological Human
Rachel ArmstrongThe nature of humanity in the twenty-first century is, according to sociologist Steve Fuller, a ‘bipolar disorder’ beset with dualisms of identification such as divine/animal, …
This machine makes human clouds
Kelly van GemertHumans have been changing the composition of the atmosphere for years, resulting in concerns such as air pollution and extreme climate events. According to Filips Stanislavskis , …
Fly like a Bird? Get Human Birdwings
Koert van MensvoortDutch mechanical-engineer Jarnos Smeets dreams of flying like bird. Nothing new really, many people have had this dream for ages. Yet being an engineer and all, Jarnos is seriously propelling his dream towards a reality.
The Anthropocene Debate: Marking Humanity’s Impact
Elizabeth KolbertIs human activity altering the planet on a scale comparable to major geological events of the past? Scientists are now considering whether to officially designate a new …
Neither Warfare nor Dumplings Are Innate to Human Nature
Allison GuyIn Ngogo, Gombe and elsewhere in Africa, bands of male chimpanzees regularly make organized raids on neighboring troops and batter their enemies to death. These grim, warring …
Did Monogamy Make Us Human?
Allison GuyPair-bonding sets humans apart from our relatives. But where did it come from?
Meet Humanity beyond Race, it's Beautiful
Koert van MensvoortMeet Humanity beyond Race, it's Beautiful
Ectogenesis, Artificial Womb, Human Egg?
Hendrik-Jan GrievinkThe artificial womb is on the verge of becoming a reality, but how it will affect our culture is for us to decide.
This exhibition investigates how humanity will live tomorrow
NextNature.netOccupying the 52nd floor of Tokyo’s Mori Tower, Mori Art Museum is internationally renowned for its visionary approach and highly original curation of contemporary art. The …
Study finds humans still evolving and quickly
Dr NaturalBy Karen Kaplan, Los Angeles Times , December 11, 2007 The pace of human evolution has been increasing at a stunning rate since our ancestors began spreading through Europe, Asia …
Animals Give Leadership Lesson to Humans
Margherita OlivoWhat are the characteristics of the perfect leader? The answer could be found looking at nature.
Longest Lived Human Embryo in a Lab
Elle Zhan WeiScientists keeping a human embryo alive in lab for 13 days for the first time.
Knitting sweaters from human hair
Kelly van GemertThe textile industry is the second largest polluter in the world that leads to a chain reaction of nasty results: loss of biodiversity, water pollution and soil erosion are just a …
OUT NOW: Save the Humans! Book
NextNature.netThe SAVE THE HUMANS! book is now available on our web shop.
Humans to Blame for Global Warming
Koert van MensvoortGlobal warming is "very likely" a human-caused problem that will last for centuries and require concerted international action to reduce its potentially devastating impacts, a …
Better Than Nature?
Rachel ArmstrongAt the turn of the millennium, miniaturized canines acquired the cherished status of living, designer handbag ornaments. These teeny tiny photogenic doggies, which had been …
The Non-Human Noosphere
Allison GuyThe definition of the noosphere as "the sphere of human thought on earth" is woefully anthropocentric. It ignores that fact that our fellow sentient organisms have noospheres of …
We Feel Empathy for Robots (Even if They Don't Look Human)
Stefan FinckenHuman test subjects felt empathy for dinosaur robots being cuddled or abused.
Meat-Eating Made Us Humans
Margherita OlivoEating meat has made us who we are today: evolved, intelligent humans, able to use a verbal language.
2016 - Human Embryo Lives 13 Days in Lab
Elle Zhan WeiIn 2016 a team of biologists has successfully kept a human embryo alive in the lab for 13 days, breaking the previous record of nine days.
The Search for the "Real" Thanksgiving
Allison GuyThanksgiving is fake-for-real. While it's true that there was a minor harvest feast in 1621, held by English immigrants and Wampanoag Indians, the event was never celebrated …
Is the Human Body Redundant?
Rachel ArmstrongThe increasing ‘liveliness’ of machines and accessibility to the virtual world has raised questions about whether it is possible to uncouple the mind from the body in through a …
AI Defeats Human at Go
Ruben BaartGo world champion Ke Jie has lost two games of 'Go' against Google's DeepMind AI system AlphaGo.
How technology keeps us connected, now more than ever
Britta de VriesAt this moment in time, many people are staying at home in order to flatten the curve . It is times like these that we realize how vital technology is to us and our societies. It …
Human Nature Forecast
Koert van MensvoortInterview witth TEDx on how people are technological by nature, yet how we also need humane technology to remain human, or become even more human than we are today.
The Posthuman Farm
Ruben BaartWu Tzu-ning presents a posthuman reality from genetic engineering to digital afterlife.
The Birth of a Digital Nation in Estonia
Daniel FragaDue to its digital citizenship program, something interesting is happening in Estonia. In July there were more new applications for e-citizenship than newborn babies. Are we …
The world’s plastic problem is bigger than the ocean
Christopher J. PrestonAs you read this, a strange object that looks like a 2,000-foot floating pool noodle is drifting slowly through the central north Pacific Ocean. This object is designed to solve …
Three exhibitions that explore the relationship between humans and the environment
Freya HutchingsAs we go about our daily activities, we may lose sight of our connections with nonhuman life. Here are three exhibitions to encourage you to step outside of your everyday and …
Apes Like Cooked Food, and What that Means for Human Evolution
Allison GuyHumans are the only species on earth that cooks its food. Not only do we cook our food, but we usually find the flavor of cooked foods preferable to the raw version. Compare the …
Incredibly Shrinking Humanity
Allison GuyArne Hendricks thinks we can solve the ecological crisis by shrinking every human on earth to 50cm tall: http://bit.ly/sxxNr1 #powershow
Tiny houses: why more people are living in miniature
Alice Elizabeth WilsonTiny houses have been heralded as a radical and creative way to address a lack of affordable housing, as well as reducing living costs and shrinking our carbon footprint. My PhD …
Save The Humans – Submit your Quote
NextNature.netWe call upon you, dear readers, to participate in a new publication from the Next Nature Network: SAVE THE HUMANS!.
There Are More People Flying in Airplanes right Now, than there were Alive on Earth in the Stone Age
Koert van MensvoortToday there are on average there are some 8000 planes in the sky carrying at least half a million people. On average during the Stone Age there must have been less.
Letter to Humanity in 25 Languages, Plus One!
NextNature.netRead the Letter to Humanity in Morse Code.
Scientists want to create human-cow hybrid
Koert van MensvoortScientists in the UK applied for permission to create part-cow, part-human embryos for research aimed at treating diseases such as Parkinson's and Alzheimer's. The embryos created …
Humane Technology #5: Empower People
Allison GuyPrinciple number five: Humane technology doesn't outsource people, but instead empowers them. How healthy or humane is it to have an escalator to the gym? Humane technology should …
Save the Humans - Call for Quotes
NextNature.netFor our new book "Save the Human" we invite you to submit quotes that question the autonomy of mankind in the digital computer era and study the future of the independent creative spirit.
More People Are Too Fat Than Too Thin
Ingmar NieuweboerFor the first time in history the world population counts more people who are too fat than too thin.
Save The Humans @ The Hoxton Hotel
Next Thursday, February 11, the Hoxton Hotel in Amsterdam dedicates an evening to our newest publication: 'Save the Humans!'
Van Mensvoort Writes a Letter to Humanity
NextNature.netOn the occasion of the Earth Day, 22 April 2017, philosopher Koert van Mensvoort wrote his Letter to Humanity.
Humane Technology #1: Feels Natural
Allison GuyAll too often, technology frustrates us. It forces our behavior into constrained pathways. Even more insidious, technology can knock us out of alignment with our values, goals or …
Watch Out Whales, Humans Want Your Krill
Allison GuyKrill, those tiny members of the ocean's planktonic community, have an importance disproportionate to their size. They are a vital food for whales, penguins and increasingly, …
Hurricane$ approaching
Koert van MensvoortEconomy is ecology . At least, according to the biomimicmarketeers of the US Wachovia Bank who created this weather report like newspaper advertisement. Nowadays most people worry …
Internet Traffic is now 51% Non-Human
Koert van MensvoortSo you thought the Internet was made by and for people? Think again. A study by Incapsula , a provider of cloud-based security for web sites (mind you where this data comes from), …
Did Forks Really Give Modern Humans an Overbite?
Allison GuyThe food writer Bee Wilson, author of Consider the Fork , has put forth a surprising theory about forks and teeth that has received widespread online coverage. According to …
Human Workers Get Increasingly Obsolete
Alessia AndreottiRobots are coming to replace humans at work, are they a real threat to the world’s unemployed?
GM Pigs for Animal-to-Human Organ Transplant
Alessia AndreottiScientists have been trying to develop GM pigs that could be used to solve the shortage of organs for transplant patients.
Human Cloning Now Possible in China
Daniel FragaIs human cloning here? Chinese scientist is ready to clone people at his ‘replication factory’.
More Babies for Italy
Ruben BaartThe Italian government just launched a campaign to raise awareness for falling birthrates and encourage family planning.
Q: How will a technology enter the human habitat?
Hendrik-Jan GrievinkThis question is an excerpt from the Pyramid of Technology toolkit In the late nineties, the Tamagotchi egg was released. A small egg-shaped device that contained a digital …
Better than the real thing
Written by Debbie Mollenhagen PART 1: FROM LINEAR TO CIRCULAR Designer living has become designing life. I often ask myself: did it taste like the real thing? But when I open my …
Hybrid Carp with human face
Koert van MensvoortI never expected anthropomorphobia to be evoked by a fish! This hybrid species fish was born between a carp and a leather carp in the pond of a personal house in Chongju. Each of …
Humanthesizer
Vincent KlerkxThe human body as an instrument is a cool example of how culture and nature are merging. Calvin Harris used a giant human synthesizer to perform his single. The material used is …
Trading Humans for Trading Algorithms
Stefan FinckenThe economic system and profit motive has been a driving force that steers and even dictates social change. Investors and stockbrokers have been a major influence to these social …
Jazz-Playing Robot Challenges Human-Computer Interactions
Margherita OlivoA musical robot able to improvise a jazz solo in response to an actual person performing jazz.
How Technology is Becoming More and More Sensitive
Margherita OlivoOver the past decade scientists have tried to get technology surfaces to be as sensitive as our skin, especially as our fingertips. Human tact is a very sophisticate interface …
1537 - Homunculus: the Semi-Human
Elle Zhan WeiIn 16th and 17th centuries, some medical theory believed that a miniature human body can be produced in a flask by an alchemist.
2015: Artificial Placenta Approaches
Elle Zhan WeiIn 2015, a group of scientists from the University of Michigan claimed to have made the world's first artificial placenta.
The Human Smart Home Assistant
Charlotte KuijpersArtist Lauren McCarthy launched a project called LAUREN in which she embodies a eponymous human smart home assistant.
Next humans
Arnoud van den HeuvelWhat will the human race look like in 1, 2, 3, 4 million years? Will it be one human race? Will there be a human race? Impressions of future scenario's must come from scientists, …
The Soft Touch of a Human Hand
Martin TetterooNissan’s Engineers Are Creepily Trying To Replicate Human Skin
A Brief History of Humankind
Koert van MensvoortHistorian Yuval Noah Harari takes us on a journey through the whole human history.
We Are Weaker Than Our Ancestors
Alessia AndreottiHuman fitness has decreased so significantly that even the strongest of us would consider ancient men to have a supernatural force.
Musical Journey Through the Human Body
Alessia AndreottiDe Motu is an interactive music app that let you experience your body through music and influence the sound with your own body.
First human CRISPR trial in the US aims to cure inherited blindness
Vanessa Bates RamirezGene editing is advancing at a faster pace than most of us can keep up with. One significant recent announcement was gene editing tool CRISPR’s application to non-genetic diseases …
A More Realistic Zoo
Koert van MensvoortGoing to the zoo is a favorite summer past-time. Visitors to the Schönbrunn Zoo in Vienna will see lots of animals in recreated ‘natural’ habitats. Except this summer, along with …
The Human Printer
Rolf CoppensFor a while now printer ink is probably the most expensive liquid per litre on earth. Still we need our images so badly that we accept this fact. The Human Printer manages to make …
Dutch start Hunting again thanks to Supermarket Soccer Mascotte
Teun CasteleinIn Holland people go crazy for soccer, especially now that the national team has reached the World Cup final. We gather everything that's orange – our shirt color – as the …
The Human LED screen
Marco van BeersAll living creates produce light by default, so do humans . Now researchers from US, China, Korea and Singapore collaborated have collaborated in order to create ultra-thin …
Chrysler Looks to Human Lungs for a Better Gas Tank
Jonathon MarkowskiAlveoli in human lungs serve as the inspiration for designing better, stronger ways of storing compressed natural gas.
Ghost Imaging: Taking Pictures of the Invisible Thanks to a New 3D Technique
Alessia AndreottiBritish research group created anew scanning technique permits to obtain 3D images and detect wavelengths that our visual system is not able to see.
World's Worst Job? Being a Human Robot at Amazon's Fulfillment Center
Hendrik-Jan GrievinkWorkers are completely controlled by algorithms in Amazon's fulfillment center
Human-Shaped Power Lines
Alessia AndreottiJust a project for now, but a far more creative way to deal with unsightly public works than tree-shaped antennas.
Thanksgiving Getaway Gridlock
Alessia AndreottiIn suburbia, we hope to get away from it all. Unfortunately, everyone else has the same idea. Happy Thanksgiving to our American readers!
Five ways AI could make your car as smart as a human passenger
Max EizaDriving long distances without a passenger can be lonely. If you’ve ever done it, you might have wished for a companion to talk to – someone emotionally intelligent who can …
Biopresence - Human DNA Trees
Koert van MensvoortImagine a graveyard without tombstones, instead there are growing trees that contain genetic material of the deceased people burried there. Biopresence creates Human DNA trees by …
Radio controlled human
Arnoud van den HeuvelThink of this sonic vibe-technology inside any MP3 player ;)
NOT (Natural) AND NOT (mechanical) = human
Hendrik-Jan GrievinkEric Hoffer (1902-1983) You dehumanize a man as much by returning him to nature - by making him one with rocks, vegetation, and animals - as by turning him into a machine. Both …
Pencils made from cremated humans
Dr NaturalArtist Nadine Jarvis fabricates pencils from carbon left over of cremated humans -- it's part of a larger "research project into post mortem." She notes that "240 pencils can be …
Human genome sequencing soon child play?
Koert van MensvoortStarting next spring, a complete human-genome sequence can be ordered the Californian startup Complete Genomics for just $5,000, Techreview reports. Currently sequencing still …
Human garbage can
Koert van MensvoortAnthropomorphobic object of the week. Created by Sarah Hatch .
A More Realistic Mermaid
Koert van MensvoortAfter being denied permission to reproduce the famed Little Mermaid statue from Copenhagen, the authorities of Vancouver decided to go for something more realistic.
Human Barbie
Koert van MensvoortJust when you thought the Second Life hype was long gone, meet Ukrainian body artist Valerie Lukyanova who aims to turn Second Life into First Life. They call her the Human …
Computer Algorithms Are Already Replacing Human Journalists
Allison GuyWill writing software eventually replace journalists?
If Barbie Had Human Proportions
Alessia AndreottiWhat does Barbie look like when she has the proportions of a normal 19-year-old?
All Humans Piled Together Are So Tiny
Francesca BarchiesiAll humans on Earth put together are not enough to fill the Grand Canyon. We are so small yet so present.
Web Access Is A Basic Human Right
Alessia Andreotti"It's time to recognize the Internet as a basic human right" its inventor Sir Tim Berners-Lee has said.
A Modest Future for Humanity
Koert van MensvoortThree minutes in the mind of Juan Enriquez, director of Synthetic Genomics.
Hacking Human Cells to Use Solar Power
Yunus Emre DuyarA new biotech startup seeks to hack our cells to use solar energy instead of carbon and oxygen.
Human-Like Robot Makes Freaky Joke About the Future of Mankind
Daniel FragaTo thread the uncanny valley is a conscious choice for many artists and enthusiasts, as a means to evoke, through their work, powerful emotions, thoughts and everything in between.
20k human chip
Arnoud van den HeuvelAAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …
Human animal hybrid
Koert van MensvoortThis peculiar, half-human creature could be your cousin. No really; it is a sculpture by Patricia Piccinini entitled The Young Family , which, in turn, is part of a larger …
Human Nature as Pathology
Koert van MensvoortModern society seems to have transformed human nature into a pathology. Our emotions are controlled by drugs. We are forced to operate within a narrow bandwith of what are …
Mapping the human desire to be touched
Dr NaturalFleshmap touch investigates the collective perception of erogenous zones. Hundreds of people ranked how good it would feel to touch or be touched by a lover in different points of …
The Human Construction of Gay Animal Culture
Allison GuyMuch attention has recently been devoted to 'gay' animals. It's not the fact that many species have enthusiastic homosexual lives that should be surprising – there are convincing …
Black Wolves Have Dogs to Thank
Allison GuyBlack wolves should probably not exist. The same species as their gray relatives, these wolves have a genetic mutation that causes them to produces excess melanin, a pigment …
Human Augmentation™
TimoAs a gamer, I come across many visions of possible futures. But this trailer from the upcoming video game Deus Ex: Human Revolution , the third part in the Deus Ex series shocked …
Would you care more if I was a Panda?
Erik SwaagstraA smart campaign by Ogilvy Paris for WNF shows that also the ‘non-cute’ animals need our help. via Fubiz
#10: Enhance Human Experience, Don’t Replace it
NextNature.netPart 10 in the 11 part series Anthropomorphism and Design . The hidden danger with interactive products is that they will become so good at fulfilling our needs that they start to …
Beluga Whale makes Human-like Sounds
SelbyResearchers in the US have been shocked to discover a beluga whale whose vocalisations were remarkably close to human speech.
Book as Human-Computer Interface
Stefan FinckenIn combining the classic feeling of handling a book with the interactivity of the computer, Waldek W?grzyn of the Academy of Fine Arts in Katowice, Poland, has created a new human-computer interface.
One Generation in, Dolphins Still Transmit Human Tricks
Allison GuyDolphins in Port Adelaide, Australia, have been observed performing a remarkable trick : tail-walking, a trait so rare it has only been seen in the wild one other time. More …
Maya YogHurt: Fermented Drink Made with Human Lactic Acid
Jiwon KimArtist Maja Smrekar modified yeast with her own DNA to produce human lactic acid.
The Human Hamster Wheel Desk
Alessia AndreottiThe Human Hamster Wheel Desk is the latest result of workspace evolution. Office work has domesticated us!
A Map of Mars for Regular Humans
Margherita OlivoIf we'll ever get to go to Mars as tourists , we wouldn't get lost. Ordnance Survey , the official British mapping agency, recently released a new detailed map of the Red Planet. …
New AI Model Can Mimic Any Human Voice
Elle Zhan WeiLyrebird is an AI model capable of synthesizing anyone’s voice from just a one-minute audio sample.
Human Nature, designing the equilibrium with Koert van Mensvoort
NextNature.netUnder the title Human Nature, designing the equilibrium, eleven designers will answer questions about a future in which Humankind and Nature enter into a new relationship. An …
Human Tetris
Dr NaturalA tribute to the virtual world boomeranging back to the physical world by Mega64 . Or do you rather prefer the corny japanese gameshow version? Via Engadget ,
Human body farm
ElinWhy not use the human body to grow products for the medical industry? The designer Michael Burton envisions Future Farm where the body is used as a farm to cultivate clinical and …
Human Landscape
Koert van MensvoortOur peculiar image of the week was created by artist Levi van Veluw , who reinvents the classical fine art of landscape painting, by moving from the traditional 'oil on canvas' to …
Mirror Neurons – Simulation at the basis of Human Civilization
Koert van MensvoortWithin our society, imitation and simulation are typically seen as inferior symbols of a distorted mediated culture – think of fake Rolexes, plastic Christmas trees, silicone …
People are better at growing Limbs than Lizards
Koert van MensvoortWhereas lizards have the extraordinary ability to regenerate lost limbs – meaning that if the lizard loses a limb through conflict with a predator, it will grow back – people have …
Traditional Thanksgiving Meat
Marco van BeersFood technology in the overdrive: Pork molded in the shape of a piglet.
Who Needs Real Humans? Not H&M
Allison GuyClothing giant H&M no longer uses real humans in its online catalog. The company has admitted that it pastes real models' heads on computer-generated bodies. At least there's …
Rule #8: Use Human Ethics
NextNature.netPart 8 of the 11 part series Anthropomorphism and Design . Anthropomorphic products blur the boundaries between products and people. Ethical norms for people don’t usually apply …
Humans Need Not Apply
Koert van MensvoortWarning, this video on the impact of automation on human labor might cause you to re-plot you professional career.
Human Artist Hatches Ten Chicken Eggs
Ruben BaartFrench performance artist hatches 10 hen's eggs in Palais de Tokyo.
Human LCD
Koert van MensvoortNew media technology from South Korea: a gigantic human display compiled from supporters cheering their soccer teams . One pixel per supporter. See also: Skyscreen , A4 e-paper .
A More Natural Typing Experience
Ruben DaasIntroducing the brand new, hand made, eco friendly, sweat absorbing, natural, healthy and most of all fashionable bamboo keyboard. It seems bamboo isn’t just for pandas anymore. …
Cake Made from Human Skin
Allison GuyCake or death? Cake! The Slice cake is a (vegetarian) vision of the forms lab-grown meat may take in the future.
Does Handwriting Matter Anymore?
Alessia AndreottiThe personal touch of pen and ink VERSUS the efficiency and productivity of digital word processors.
Technology Made us Human
Koert van MensvoortBuckle up for a cinematic espresso shot from performance philosopher and NNN ambassador Jason Silva.
Human Furniture
Koert van MensvoortThis unpractical yet not less pretty anthropomorphic furniture piece was created by photographer David Blazques . We are clueless on whether it is in permanent use, yet it serves …
I Want Wings!!!!!!!!!!!!!!
Nicholas CarrRead Nicholas Carr's essay on the transhumanist dream of having wings.
The World Without Technology
Kevin KellyI remember the smoke the most. That pungent smell permeating the camps of tribal people. Everything they touch is infused with the lingering perfume of smoke – their food, …
Hello, superorganism
Koert van MensvoortWhen I was a kid, my parents took me to the beach every summer. We’d swim in the ocean and play on our inflatable raft in the surf. When the tide was low, I’d build a sand castle …
The Playboy Interview
In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …
Anthropomorphobia
Koert van MensvoortAre you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …
Interview Mark Wigley: "We are living in an ecology of antenna"
Ruben BaartWith the invention of the radio antenna in the late 19th century, we became a different species: Introducing the human insect. A species, able to communicate across oceans using …
An Ecstatic Dialogue with Richard Doyle
Jason SilvaWhen techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …
Interview: Bruce Sterling on the Convergence of Humans and Machines
NextNature.netWe had the honor of hosting Bruce Sterling in our Next Nature Network headquarters to talk to him about the concept of the convergence of humans and machines.
The Coronation
Charles EisensteinFor years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …
Curator Gène Bertrand on design for human needs
Meike SchipperNature has always been a source of inspiration for many artists and designers, yet the urgency to connect to nature is more pressing than ever. Environmental issues such as …
Lucas Foglia's photography explores the uneasy relationship between humans and nature
Laura MalloneeThere’s no place on earth untouched by human activity: This was clear as Lucas Foglia whizzed across the vast, white expanse of Alaska's Juneau Ice Field last summer. He was …
Interview: Agi Haines, Speculative Artist Who Wants to Redesign the Human Body
Ruben BaartSpeculative designer Agi Haines' work focuses on (re)designing the human body, and speculates upon future scenarios.
Making an AI supermarket with Nonhuman Nonsense
What does the supermarket of the future look like? The Embassy of Food at Dutch Design week.
Reconnecting with wildlife through biodiverse meditations
NextNature.netSleep and dream like a koala, relax under biodiversity and feel the meditative effect of artificial wildlife.
Should we clone Neanderthals?
Zach ZorichIf Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …
Next Generation: AI meets human creativity in Sofia Crespo's Neural Zoo
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
Colonizing Mars: Not with humans, but plants
MaithriThe idea of colonizing Mars has become the big speculative future of humanity on Earth. But, artist Alexandra Daisy Ginsberg has radically different ideas to contribute to the …
Did Booze Make Us Modern?
Allison GuyA psychiatrist argues that beer gave us civilization - but do intoxicants play a deeper evolutionary role than that?
Interview: Floris Kaayk, the Visionary Creative Mind Behind Human Birdwings
Alessia AndreottiFloris Kayak discusses online hoaxes and the future of technology.
Bio-Printer Creates Living Body Parts
Margherita OlivoBioprinter creates bespoke lab-grown body parts for transplant.
Next Generation: Demonstrating non-human narratives with Lindsey Bundel
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Beijing's dust storm: part humans, part nature
NextNature.netThe skies in Beijing turned orange recently, thanks to what was widely reported as a massive sandstorm . The problem, at least in terms of public health, is that it was not …
Enter the Symbiocene
Glenn AlbrechtWhat if we would use the idea of symbiosis as the basis for the next period of Earth’s history?
The future infrastructure of the blockchain might be green and humane
Koen WeselThe connection we share through the Internet has laid the foundation for a whole new digital infrastructure, in which blockchain technology is heralded by many believers for being …
People would rather give up sex and vacations than their smartphones
Koert van MensvoortDid you know that some Dutch people are so addicted to their devices that they'd rather give up sex, vacations, or even a finger than their phone?
This book explains why cooking food was essential to human evolution
NextNature.netA must-read to the Next Nature fan: Catching Fire: How Cooking Made Us Human (2009). Written by British primatologist Richard Wrangham, the author shares his hypothesis that …
Cooling buildings with ultra-white paint
Andrew ParnellFrom icy tundras to billowing clouds, the colour white crops up repeatedly in our planet’s palette. This colour provides a natural way for light from the sun to reflect back from …
A Stroll Through the Bubbles of Chemicals and Men
Etienne TurpinA stunning pre-history of the anthropocene
Technology: Intrusive or Supportive?
Ioana TomiciIs the use of personal devices becoming a replacement for the spectrum of emotions that make us all humans?
Browse the Catalog For The Post-Human
Veronica FanzioAugment your physiology. Enhance your prospects. From neuro-electronics, to robotic-prosthetics and mind-altering pharmaceuticals.
Earth is so strongly impacted by its human inhabitants that it's now a “hybrid planet”
Jack CaulfieldHumanity has for a long time considered itself the most important species on the planet. We are quite happy to share the world with other species, but we think we know who's in …
Cyborgnest: redefining human senses
Liam BekaertNature provided humans with an extensive set of sensory modalities, allowing our brain to constantly gather sundry inputs from the outer world. These sensory inputs help us …
How China is enjoying blue skies — thanks to the coronavirus
Britta de VriesSurrounded by greyness and with the air around you having a dusty, burnt taste; for a long time this is what it has been like to live in many of the world’s highly polluted …
Making King's Day More Sustainable
Margherita OlivoOn King's Day the water board of Amsterdam wants to collect urine and use it as fertilizer.
Next Generation: VR creator Bas Jansen asks, is there a place for humans?
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
Ouroboros Steak: Producing meat using human cells
Nellie FriedrichYou are what you eat; a quite common message in the midst of our self-growth society. We have to eat well to become the best version of ourselves - more productive, healthier …
Can AI become addicted?
Thomas Moynihan, Anders SandbergIn 1953, a Harvard psychologist thought he discovered pleasure – accidentally – within the cranium of a rat. With an electrode inserted into a specific area of its brain, the rat …
Breaking Language Barriers
Margherita OlivoWe have witnessed significant progresses in the field of real-time translation, and this new wearable translator, called ili, sums up perfectly this essence.
Madrid's Future Is Greener than Ever
Margherita OlivoMadrid's new plans to fight rising temperatures and high pollution rates investing on green urban areas.
An Edible Drone for Humanitarian Aid
Ruben BaartNigel Gifford is developing a drone that will be relatively inexpensive, disposable and edible.
Pyramid of Technology: How technology becomes nature in seven steps
Koert van MensvoortHow technology becomes nature in seven steps
Better than the real thing
Koert van MensvoortTake a bite from this pear and I'll spare you all the default connotations with the apple of eden. Source photo by Pablo Montanez . See also Modernistic Watermelon , Ferrari …
Controlling Human Odour
Florian Conradi and Michelle ChristensenThe ultimate personal hygiene product, feces odor tablets, is another Japanese innovation sold by the Takano Yori Beauty Clinic . These pills promise to make your excrement …
Solving Crimes Thanks to Amazon Echo
Ruben BaartAmazon's Echo smart speaker may have witnessed a murder. But will it talk?
Watch: BBC reports on world's first artificial womb for humans
NextNature.netNow that the team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …
'Fiji Water' Is Purer than Tap Water, No?
Koert van MensvoortResearchers tested 'Fiji Water' against ordinary tap water. What they found is kind of shocking.
Simulacra and Simulations
The simulacrum is never that which conceals the truth--it is the truth which conceals that there is none. The simulacrum is true. -Ecclesiastes If we were able to take as the …
Nurturing Architecture
Ruben BaartThe way we currently build is not sustainable. We will have to develop a sustainable living environment that matches our human needs, intuitions and potential.
Time Between Emergence and Design
carolinenevejanPreviously, experiences of time emerged from nature as given – offering seasons, the rhythm of humans, plants and animals. Nowadays, people integrate nature-time, body-time, inner-time, clock-time, and global 24/7 systems-time. Human beings, in past, current and next natures, have to deal with emergence and design of time in order to survive.
Next Generation: Exploring the vegetal cyborg with Marie Declerfayt
NextNature.netThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
Interview: Curator Ilari Laamanen on Momentum9, the Nordic Biennial
Ruben BaartWe recently spoke to Ilari Laamanen, to peel the outcrops of Momemtum9, and unveil the overlapping themes to the next nature philosophy.
Why I'm turning my son into a cyborg
Vivienne MingImagine if everyone spoke a language that you don’t understand. It’s not a foreign language–it’s been spoken around you since the day you were born–but where as everyone else …
Ecology – A New Opium for the Masses
Marxist philosopher Slavoj Žižek discusses the 'naturalization' of capitalism and how ecology became a new field of capitalist investment. He also argues that the ultimate …
Next Generation: Shaping intimacy through objects with Pleun van Dijk
Pleun van Dijk is a speculative artist/designer who investigates the intimate relationship between human and technology.
Billionaire space race: the ultimate symbol of capitalism's obsession with growth
Tim JacksonMars ain’t the kind of place to raise your kids, laments the Rocket Man in Elton John’s timeless classic. In fact, it’s cold as hell. But that doesn’t seem to worry a new …
Next Nature Interview
For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …
The Golden Quarter
Michael HanlonSome of our greatest cultural and technological achievements took place between 1945 and 1971. Why has progress stalled?
Microbiocene: A microbiological archeology of the future
Linda ValentaIn configuring our next nature, artists and scientists explore new languages that move beyond the Anthropocene - the era of human beings. These semantics would bridge the gap …
Yes, Naturally
Ine GeversThe introductory essay from the Yes, Naturally book - available in our store!
An introduction to Biomimicry
Janine BenyusThe first time I explained biomimicry to a stranger was not in a talk or a workshop but in a big-box bookstore just after Biomimicry: Innovation Inspired by Nature had come out. I …
There’s Plenty of Room at the Bottom
Hendrik-Jan GrievinkSo you’re triggered by our call for products and now you’re considering to send in one, two or maybe three of your brilliant products for the Nano Supermarket? Good. Or – and this …
From Eco-Apartheid to Earth Democracy
Vandana ShivaDo humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.
Next Generation: Experiencing neo-robophilia with Hye Hyun Song
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture
Alessia AndreottiRachel Armstrong discusses living buildings, Venice's foundations, millennial nature and how to improve our future.
The Anthropocene Explosion
Koert van MensvoortWe have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.
Intimate Technology: the Battle for Our Body and Behaviour
Rinie van EstTechnology is nestling itself within us and between us, has knowledge about us and can act just like us.
Next Generation: Writing a design manifesto with Pleun Wilting
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Towards a global society as a superorganism
Ruben Baart and Britta de VriesToday we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …
Next Nature and the Curse of Oil
Tere VadénThe next step is to embrace and celebrate how cultural artifacts are escaping control, becoming autonomous, and forming the “next nature”.
Real Nature is not Green
Koert van MensvoortAt the edge of the woods along the motorway near the Dutch town of Bloemendaal, there stands a mobile telephone mast disguised as a pine tree. This mast is not nature: at best, it …
‘Optimism is our duty’: A conversation with Koert van Mensvoort
Ruben BaartWe live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …
Growth is not the problem, but the solution
NextNature.netIf we want to bring down global CO2 emissions to zero, we will need technological innovation and massive infrastructure projects.
Next Generation: Sensing the critical zone with Menno Brouwer
Next NatureThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Exploring Next Nature (2004)
Koert van MensvoortThe first essay ever written on Next Nature, published in Next Nature Pocket and in Entry Paradise, New Design Worlds . ( download pdf ) (German version: Erkundungen im Nächste …
Moon Gallery: the first museum in space
The Moon Gallery aims to set up the first permanent museum on the Moon. Soon launching to the International Space Station, full of ideas worth sending to the Moon. The gallery is …
Inverting the energy paradigm with Charles Eisenstein
Ruben BaartEnergy policy blah blah blah, life cycle analysis blah blah blah, energy return on energy invested, peak oil, carbon footprint, renewables, hydro, nuclear, blah blah blah blah …
Interview: Mike Thompson and Susana Cámara Leret, Designers Exploring Alternative Ways of Thinking & Doing
Ingmar NieuweboerInterview with Mike Thompson and Susana Cámara Leret.
How can Big History help us think about the future?
Noriko Wynn'Big History' is a multidisciplinary study that seeks to put the human story into the context of a 13.8 billion-year story from the Big Bang to now.
It could be time to start thinking about a cybernetic Bill of Rights
Mike RyderLike it or loathe it, the robot revolution is now well underway and the futures described by writers such as Isaac Asimov , Frederik Pohl and Philip K. Dick are fast turning from …
Breaking Point?
John Zerzan, published in Green Anarchy issue #24 - Spring/Summer 2007 The rapidly mounting toll of modern life is worse than we could have imagined. A metamorphosis rushes …
A Society of Simulations
Koert van MensvoortAn interviewer once asked Pablo Picasso why he paints such strange pictures instead of painting things the way they are. Picasso asks the man what he means. The man then takes out …
Next Nature Introduction
Bruce SterlingThis project - the Next Nature Network - is about Nature's brand image. One might surmise that "Nature," being 100 percent all-natural, can't have any brand image. The facts …
Next Generation: Get to know Valerie Daude
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
On the prehistoric origins of modern sexuality
Ruben BaartLet’s talk about the most controversial of "m words"—monogamy. And let’s have this conversation with in mind its prehistoric origins. Our modern picture of prehistoric societies …
Next What?
John ZerzanIn this essay, anti-civilization, anarchist philosopher John Zerzan critiques the concept of 'next nature.' He argues that rather than freeing us, our self-domestication through …
Interview: Pauline Van Dongen, Designer Merging Fashion and Technology
Margherita OlivoDutch fashion designer specialized in wearable technology, Pauline van Dongen researches the human body in relation to its surroundings.
Getting rid of that bit of unspoiled green
Sanne vander BeekThere it is. A hefty hen, with its head up high and its beak out. And a gigantic VR headset over its beady little eyes. What does this battery hen see? ‘An experience of a free …
Next Generation: Pei-Ying Lin is cooking with viruses
Britta de VriesThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and plot your …
Moral Shortcomings in the Technology Debate
Rinie van EstDigital and genetic techniques increasingly influence life. Our belief in progress through technology stands in the way of a moral debate on this development. By Rinie van Est We …
What’s the Point If We Can’t Have Fun?
David GraeberSince Darwin we tend to look at the biological world exclusively in economical terms. The idea that monkey's, frogs, or even ants do more than simply propagate, doesn't find much acceptance among scientists. And yet, even crayfishes at times seem to displace objects just for fun.
Could Biomimicry Help us Solve the Refugee Crisis?
Daniel FragaFrom nutrients within an organism, to organisms within collectives, to populations within a territory and so on - nature offers models on how to deal with highly complex systems.
The Enlightenment Is Dead, Long Live the Entanglement
Danny HillisWe humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.
Faustian Bargains and Pineapple Shampoo
Since the early days of the net, the electronic pastoral has lent itself to all sorts of dubious agendas pushed by science, the military and even libertarian tendencies. In the …
Totem Animals for the Anthropocene
Ted HeistmanInvasive species become the animal symbols for a man-made world.
But will lab-grown meat be kosher?
Benjamin Aldes WurgaftRead Benjamin Aldes Wurgaft's essay on judaism in relation to the production of laboratory-grown meat.
Interview: Leanne Wijnsma, Designer for the Instinct Who Uses Smell as Medium
Ruben BaartDutch experience designer Leanne Wijnsma designs for the human instinct and puts the sense of smell back to where it belongs, as modern hazards have shifted to the digital realm.
Next Nature reading list
NextNature.netTen books that continue to inspire the next nature philosophy—gathered for you to read this summer.
Are we living in a superorganism?
Ruben BaartThe coverstory of Next Nature Magazine investigates how the rise of virtual influencers on social media reveals a superorganism.
The Carnery - A Cultured Future with In Vitro Meat
NextNature.netIn vitro meat has the capacity to transform meat production as we know it, introducing an entirely new way of thinking about and interacting with food.
Interview: Liam Young on Speculative Architecture and Engineering the Future
NextNature.netInterview with Liam Young on his work in speculative architecture, the future, and our role in nature as humans.
Five must-see exhibitions before 2020
NextNature.netA large-scale asian food market serving in vitro meat, a transatlantic expo on the future of nature and a travelling exhibition that explores our relationship with AI. These five …
Why physical distancing feels so unnatural to us
Isabelle Catherine Winder and Vivien ShawFor many people, the most distressing part of the coronavirus pandemic is the idea of social isolation. If we get ill, we quarantine ourselves for the protection of others. But …
The prehistoric importance of trading technology
Nicholas R. LongrichThen, as now, one person could literally change the course of history, with nothing more than an idea.
Organs from genetically engineered pigs may help shorten the transplant wait list
David KaczorowskiDemand for life-saving organ transplantation is at an all-time high. In 2021, a record 41,000-plus organ transplants were performed in the U.S., with top numbers for kidney, liver …
The Uncanny Valley of the Pussycat Dolls
Koert van MensvoortMake no mistake, you're not looking at the latest Barbie line: These are the The Pussycat Dolls. Formerly an LA stripper show burlesque show, now upgraded to be pop music …
We Domesticated Ourselves
Allison GuyOur bodies are maps of our ancestor's social lives. We evolved, physically and behaviorally, in incredibly complex social groups. Such intense sociability may have favored the …
Can microbes communicate with alien species?
NextNature.netAre we alone in the universe? The famous Seti (Search for Extraterrestrial Intelligence) programme has been trying to answer this question since 1959. American astronomer Carl …
Embassy of Health: Designing a chronically healthy society
How will we stay healthy in the future? Can we utilize the power of design to move towards a more healthy society?
The GeneSprout Initiative: cultivating new plant breeding techniques
NextNature.netSome 10,000 years ago humans began to domesticate plants and animals. The birth of agriculture, one of the earliest technologies available.
Next Generation: Designing ecosystems of technology with Maike Gebker
NextNature.netThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Face the future of intimacy with Kiiroo
Ruben BaartMeet the teledildonics, an ingenious species of bi-directionally controlled sextoys from the future, available today. These touch emulating vibrators find each other on social sex …
Seeking Symbiosis
Ruben BaartVisual artist Heleen Blanken explores the complex relationship between people, nature and technology.
Out of Control
The Made and the Born: Neo-Biological civillization, written by Kevin Kelly, excerpt from Out of Control : The New Biology of Machines, Social Systems and the Economic World, …
Razorius Gilletus – On the Origin of a Next Species
Koert van MensvoortIs the evolution of the single bladed razor into an exorbitant five–bladed vibrating gizmo the outcome of human needs, or is there another force in play? Say hello to Razorius …
The Story of our Food
Maartje SomersEvery time we eat a piece of food, we take a bite out of the world. All these small bites tell a dozen stories. A carton of eggs presents the story of contented hens, a bottle of …
In Vitro Meat: Animal Liberation?
NextNature.netMany people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.
Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society
NextNature.netWe recently talk to Nadine Bongaerts about the role and impact of synthetic biology, the gap between biosciences and society and the importance of communication to overcome the fear of new technologies.
Your Next Nature guide to Dutch Design Week 2018
Meike SchipperOver time, our bodies, our food and our environment have become more and more subject to design. As designers, we hold the responsibility and have the unique chance to envision …
The 21th Century Paradigm
The history of art through the ages reveals a constancy that, by conscious or unconscious applications, provides us with an omnipresent correlation dealing with the …
Innovative Nostalgia
Koert van MensvoortWe humans simply feel more comfortable with technological change when it comes in a familiar form that refers to an existing and accepted object, habit, value, tradition or intuition.
Nature through the Windshield
Brendan CormierVolume magazine interviews Next Nature founder Koert van Mensvoort.
On the origin of the word processor
Huub EhlhardtWriting is recognised as one of mankind’s foremost inventions and the mechanization of writing is one of these developments that typify what is commonly regarded as the work of …
Suzanne Lee wants to live in a sustainable material world. Built with biology, not oil
Ruben BaartBiotechnology is nearly as old as humanity itself. The food you eat and the pets you love? You can thank our ancestors for kickstarting the agricultural revolution, using …
How a museum encourages its visitors to examine their relationship with their environment
Linda ValentaLast month I had the opportunity to immerse myself in Tokyo’s newly opened digital art landscape, the Mori Digital Art Museum. The museum stands out for it enables virtual …
Welcome to the CRISPR baby world—here’s what you should know
Vanessa Bates RamirezLast week, the gene editing world was hit by news the equivalent of a nuclear bomb. In a video on YouTube , Dr. Jiankui He at Southern University of Science and Technology in …
Driverless and electric, or car-free? How cities are cutting out cars, and why
Vanessa Bates RamirezIt’s common consensus in the tech industry that the days of cars as we know them—powered by gas, driven by humans, and individually owned by all who want and can afford one—are …
On the origin of the LED lamp
Huub EhlhardtFor thousands of years people used oil lamps and candles to illuminate their homes during the hours of darkness. Neither produced much light and both were inconvenient in use as …
Next Generation: Louise Silfversparre illustrates the remains of the Anthropocene
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
In conversation with cyborg musician Kai Landre
What does the merge of bodies and technology mean for the human? For cyborg Kai Landre, cybernetic extensions become body parts and not technology. Kai began his transition to a …
The Biosphere Code Manifesto
NextNature.netDuring the event The Biosphere Code, Stockholm University researcher Victor Galaz and colleagues outlined a manifesto for algorithms in the environment.
Fellow Day: Next Senses
Ingmar NieuweboerOn June 17th a NNN Fellow Day was organized to explore the future project: Next Senses.
In conversation with Jalila Essaïdi
Freya HutchingsWhat do in-vitro human skin, spider silk and cow manure have in common? They are all unlikely materials that can cloth, protect and inspire humans, as realized by award-winning …
Interview: Pirjo Kääriäinen on collaboration and the new ecological biomateriality
Freya HutchingsMeet Pirjo Kääriäinen, professor of design driven fibre innovation at Aalto University, Finland. Kääriäinen founded CHEMARTS —a collaborative program at the university that brings …
POND: A symphony of lights and water
Nellie FriedrichHave you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …
How future fashion could help us cope with isolation
Ruben BaartToday we cannot meet, touch or hug our loved ones. And while we all like the feeling of the touch of another human being, physical contact does not just feel nice, it is crucial …
Check your Technoprivilege
Hendrik-Jan GrievinkTechnology is not neutral; the same tech might empower some and disempower others. It is time to check our Technoprivilege, argues author Hendrik-Jan Grievink.
Sonograms of planet earth
Eleni Maragkou, Kelly van GemertTechnology can help us to connect with our surroundings. Think about the microscope: it revealed ecosystems beyond our visual reach allowing us to look at the smallest inhabitants …
Entryparadise
Written by Werner Lippert & Peter Wippermann, Curators of the Entryparadise exhibition (26/8 until 3/12, 2006, at Kohlenwäsche, Zollverein) Design is about to undergo a …
Back to the Tribe
Koert van MensvoortTraditionally, technology is seen as a force that diminishes our instincts and puts us at a distance of nature. Increasingly however, we realize technology can also energize and …
The AI Revolution Is On
Ruben DaasSteven Levy writes in Wired on the unexpected turn of the Artificial Intelligence revolution: rather than whole artificial minds, it consists of a rich bestiary of digital fauna, …
The NBIC Convergence: When Machines and Matter ‘Have Sex’
Rachel ArmstrongThe Singularity , as popularized by Ray Kurtzweil, refers to a near term, theoretical time when machine intelligence greatly surpasses our own. At this point we will experience a …
Artifice Earth: Adam Rutherford on the Promises of Synthetic Biology
NextNature.netAn interview about the history and promises of synthetic biology, and the problem with the word "nature".
What Ant Colony Networks Can Tell Us About What’s Next for Digital Networks
Deborah GordonEver notice how ant colonies so successfully explore and exploit resources in the world … to find food at 4th of July picnics, for example? You may find it annoying. But as an …
No Future for Traditional Meat
Alessia AndreottiAt Home in the Lab with Mark Post, Father of the In Vitro Hamburger. Interview from The In Vitro Meat Cookbook
Designer Govert Flint applies motion to everyday life
Ingmar NieuweboerInterview with Govert Flint, designer, architect and self-taught artist.
The future of the ECO Coin
Koen WeselHow can we design a cryptocurrency for the better of humanity and ecology? In this last chapter of the crypto deep dive series , we will dissect two kinds of blockchain …
I like my steak lab-grown, not-grass fed
Angus HerveyRight now, somewhere in a laboratory in California, the Netherlands or Japan, a technician is taking a few thousand skeletal muscle cells from a living animal, and placing them in …
Next Generation: The speculative futures of Deborah Rhyner
NextNature.netThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Nine creatives in biotech you need to know right now
NextNature.netThe field of biofabrication is still new to most people. As founder and CEO of Biofabricate, Suzanne Lee shared with us this exciting online event series Creatives in Biotech . If …
Next Generation: Designing ecological webs with Miriam Lellek
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Senses
Next Senses explores the unchartered territory of how we could experience the world with technology
Information Decoration: Our Environment as an Information Carrier
Koert van MensvoortPicture this: it's 40,000 years ago, and you are an early Homo sapiens. You are standing on the savanna. Look around you. What do you see? No billboards, no traffic signs, no …
Can Life Be a Technology?
Rachel ArmstrongIn 2009 the Initiative for Science, Society and Policy coined the phrase ‘living technology’ [1] to draw attention to a group of emerging technologies that are useful because they …
Living Among Pests – Designing the Biosynthetic City
Joyce HwangJoyce Hwang discusses the challenges for designers, and gains for citizens, of living in a truly biosynthetic city.
Conversation with Dutch Philosopher Bas Haring: Robot, Colleague or Foe?
Ruben BaartWe talked with Bas Haring to discuss the conception, image and will of the robot. Read our conversation with him and update your ideas about robots.
How AI and genomics will impact the future of making babies
Vanessa Bates RamirezAs if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …
People are less likely to turn a robot off if it asks them not to
Tristan GreeneA team of German researchers published a study earlier this week indicating people can be duped into leaving a robot turned on just because it “asks” them to. The …
What we can learn from 'The Social Dilemma'
Vanessa Bates RamirezIs social media ruining the world? Dramatic political polarization. Rising anxiety and depression. An uptick in teen suicide rates. Misinformation that spreads like wildfire. The …
Next Generation: Exploring cybernetic ecologies with Marie Walker-Smith
Liam BekaertThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Little Green Cows
Rachel ArmstrongThe world is alight with algae fever. In this age of deep ecological design aspirations, the range of speculative design projects based on algae technology is growing. Algae are …
Interview: Alexandra Daisy Ginsberg, Designer and Synthetic Biology Expert
Alessia AndreottiAn interview with Daisy Ginsberg, artist and synthetic biologist.
You Can Never Go Back To Nature
Annalee NewitzOne of the arguments that environmentalists use against factory farming and burning fossil fuels is that these activities are "unnatural" or that they "go against nature." But …
Diseases Of The Future
Alessia AndreottiNowadays humans suffer from diseases that didn't exist in the past, a trend that will probably continue into the future. A wide range of new disorders, especially related to the …
ECO Coin Award Interviews: Shubhendu Sharma
Jack CaulfieldWe asked Shubhendu Sharm, our first ECO coin award nominee about his method, business and hopes for the future.
Adding a new dimension to marine restoration: 3D printing coral reefs
David KlingesThe local fishermen looked on skeptically. From the deck of a small motorboat, scuba divers grabbed odd chunks of ceramic – which could be described as rocky brains stuck on …
Aleph Farms wants to bring clean meat from the lab to the next farming industry
Kelly van GemertGrowing meat artificially, instead of within an animal, may soon be an available reality. Meet one of the pioneering developers of this product of the future: Aleph Farms. With …
On the origin of the e-bike
Huub EhlhardtThe oldest known serious candidate forerunner for the bicycle is the ‘running machine’ built by the German Baron Karl von Drais. His two-wheeled machine became known as the …
How AI is reshaping electronic music
Linda ValentaThe idea that AI can compose electronic music may sound a little off to people. It raises essential questions about creativity as a product exclusive to humans: can an AI be …
Next Generation: Why Annie Larkins' egg project is essential for future food thinking
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
What's solar geoeneering and why is it controversial?
James W. HurrellA report from 2021 from the National Academies of Sciences, Engineering and Medicine tackles a controversial question : Is solar geoengineering – an approach designed to cool the …
Enter the memesphere
Laura van den BrinkWhy memes might be the next tool to make sense of on our increasingly hybrid virtual and physical environment.
Virtual Money Is a Pleonasm
Koert van MensvoortHave you heard the buzz on virtual money in online games? Some years ago the first virtual millionaire was announced, yet there have also been reports on people being practically …
![Visual of Manko & Life [#8]](https://nextnature.net/media/pages/magazine/story/2011/manko-life-8/f762250e48-1602632753/manco-8-868x486.jpg)
Manko & Life [#8]
Aston RevolaManko sighed. Nada: 'Did you like it?' Manko: 'I have to admit that if this is the starter, I'm not sure I'll survive the main course.' Everyone at the table laughed. Manko: 'Let …
The Technological Sublime
Jos de MulThe sublime is an aesthetic concept of 'the exalted,' of beauty that is grand and dangerous. Through 17th and 18th century European intellectual tradition, the sublime became …
Interview: Suzanne Lee, Fashion Innovator Who Grows Clothing in the Laboratory
Alessia AndreottiWe recently talked with Suzanne Lee about the textile industry and technology, growing leather in the lab, and the use of new alternative materials in the future of fashion.
Watch out for Bullied Robots
Alexandra BremersDystopian future scenarios filled with evil robots are everywhere. We are afraid of robots treating us badly, but what will happen if it'll be the other way around? According to …
Designer Dave Hakkens is putting plastic waste to better use
Ruben BaartWe recently handed this year’s ECO Coin Award to Dutch designer Dave Hakkens, founder of the Precious Plastic movement. With his open sourced recycling machines, he provides people around the world the knowledge to start recycling plastic locally.
The Robots Are Coming!
Koert van MensvoortRobots are getting stronger and smarter every day. They are taking over our whole lives. How long will I have my job before a robot steals it?
Maurizio Montalti talks nature’s cycle of life
Meike SchipperAs modern humans, we are out of balance with our natural environment. With use of technology, we try to prolong our human lifespan and create materials that live longer than we …
Why half of the world's beaches could disappear by 2100
Simon Boxall and Abiy S. KebedeUp to half of the world’s sandy beaches are at risk of disappearing by the end of this century if no action is taken to limit greenhouse gas emissions. That’s according to a new …
Next Generation: The virtual infinity of Scarlett Yang
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
ECO Currency – A Proposal to Balance Economical and Environmental Value
Koert van MensvoortImagine we would have an alternative monetary currency for environmental value. Would the rain forest still be destroyed if there existed an ECO–currency to express its value and …
Can This Virtual World Save the Real One?
Alessia AndreottiA Dutch artist designs a Utopian eco-socialist online society.
Seven Future Visions on In-Vitro Meat
Koert van MensvoortBefore we can decide if we will ever be willing to eat in-vitro, we need to explore the food culture it will bring us.
Sophia: World's First Robot with a Citizenship
Jack CaulfieldSophia the Humanoid, a human-like robot in appearance and mannerisms, was granted citizenship by Saudi Arabia and became the first robot with citizenship.
Next Generation: Elissa Brunato's bio iridescent sequin shimmers with nature
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
Interview: Patricia Piccinini discusses her latest solo exhibition 'Embracing the Future'
Freya HutchingsPatricia Piccinini is an artist interested in the relationship between humans and non-humans, the natural and the artificial, science and storytelling. Working with silicone, …
Why we need to get better at predicting space weather
NextNature.netThe Sun is the most important source of energy for sustaining life on Earth, but it gives us a lot more than just light and heat. It also gives us solar storms.
Next Generation: Unlearning botanical narratives with Nina Škerjanc
NextNature.netThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
How to design your future family
Ruben BaartImagine a place called Reprodutopia. How would such a place look like?
The World is not a Desktop
Mark Weiser (originally written for ACM Interactions ). What is the metaphor for the computer of the future? The intelligent agent? The television (multimedia)? The 3-D graphics …
Bacteria "R" Us
Rachel ArmstrongThere is a domain of creatures that diffusively encircles an entire planet. There are so many of them that they occupy every conceivable ecological niche. Yet, despite their …
Nature is Dead, Long live Nature
Koert van MensvoortLike we did to old nature before, we must now cultivate our technological environment.
Why Meat Grown in Labs is the Next Logical Step for Food Production
Avy RoyLab grown meat is part of the trajectory that agricultural technology is already following.
How animal filters unmask the estranged relation to our wild self
Meike SchipperWould you like a dog snout, cat eyes or fluffy bunny ears? The choice is yours. Virtual selfie filters have become a widespread phenomenon on social media platforms such as …
3D-printing food waste into tasty products
Meike SchipperGlobally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
Beyond Biomimicry: A New Urgency
William MyersDesigners face an unprecedented urgency to alter their methods and reprioritize their goals to address the accelerating degradation of the environment. This new …
Interview Matilde Boelhouwer: Making urban environments flower again
Matilde Boelhouwer is a designer whose work speculates between art, design, science, biology and food. Matilde shapes this obligation into a studio which mainly focuses on the …
Jurassic World scientists still haven’t learned
NextNature.netJust because you can doesn’t mean you should – real-world genetic engineers can learn from the cautionary tale. “ Jurassic World: Dominion ” is hyperbolic Hollywood entertainment …
Sónar Lisboa: a festival for body and brain
Ruben BaartSometimes a festival can be so much more. Tapping into arts, design, and electronic and experimental music festival, Sónar Lisboa (8-10 April) is one for the body and for the …
The information age is starting to transform fishing worldwide
NextNature.net, Ioana TomiciPeople in the world’s developed nations live in a post-industrial era, working mainly in service or knowledge industries. Manufacturers increasingly rely on sensors, robots, …
How to design your (home)office
Govert FlintDesigner Govert Flint proposes a new office concept, entirely based on movement and play.
Douglas Coupland: A radical pessimist's guide to the next 10 years
Hendrik-Jan GrievinkDouglas Coupland is a writer and artist based in Vancouver. For the canadian newspaper Globe and Mail, he wrote The ‘radical pessimist's guide to the next 10 years’ a dystopian …
Self–Repairing Architecture
Rachel ArmstrongAll buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …
Next Nature Services
Bas HaringIntentionality separates culture from nature. A dog is intentional, a fox is not; a park is intentional, a forest is not. Since trash, ruined buildings, and automated computer …
The Cat Parasite that Sells Motorcycles
Allison GuyThe protozoa Toxoplasma gondii makes an unobtrusive home in nearly every warm-blooded species, but it's prolific life is limited: Toxo can only reproduce in cat stomachs. The …
The Sound of the Blue Canary
Berry EggenBlue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …
Interview: Arne Hendriks, Researcher and "Father" of The Incredible Shrinking Man
Alessia AndreottiHendriks’s activity explores the positive transformative power of creative impulses and the importance of fundamental free scientific research.
Brexit: the Cultural Climate Warms Up
Daniel FragaOn the aftermath of such a historic day for Britain and the EU, it's easy to get swayed into the polarities of political discourse, particularly on social media and the Internet, where things heat up and move fast. The results of the referendum have just come out, and the Internet is already burning with tension. This is called "climate change" - just not the one you are used to hear about.
Heart Repair with Spinach Leaves
Julie ReindlScientists developed a procedure to repair your heart with a spinach leaf.
The Idea for Lab-Grown Meat Was Born in a Prisoner-of-War Camp
Chase PurdyThe phone call was as unexpected as the American accent at the other end of the line. And when she hung up a few moments later, Ira van Eelen had to stop to catch her breath. More …
Recharge! Sun for Your Brain Cells
Julie ReindlA gadget called HumanCharger promises "the sun in your pocket" to give you energy, by beaming light through your ears.
Virtual Baby Acts and Looks Impossibly Real
Charlotte KuijpersA rosy-cheeked kid learns her first words, cries when her babysitter leaves, smiles when she’s happy, but she’s not real. BabyX is an AI research-in-progress by a company named Soul Machines.
Virtual Networking, the Future Social Media
Megan Ray NicholsVirtual reality is already becoming a part of the conversation surrounding social media. Will it become the next popular social network?
A happy birth day to Louise Brown
Hendrik-Jan GrievinkDear Louise Brown, On behalf of the future I would like to congratulate you on your birthday. It has been 40 years that you where born into this world on July 25th 1978, …
In Conversation with Marleen Hartjes: Introducing a digital door to the museum
Kelly van GemertDon’t be surprised when you catch a human face on a screen strolling through the Van Abbe museum for contemporary art in Eindhoven, as these are Europe’s very first robotic …
Interview: Huub Ehlhardt on the evolution of products
Kelly van Gemert"To understand why a product is the way it is today, you need to learn about its evolutionary background." Meet Huub Ehlhardt, an engineer with a PhD in product design . Huub …
In conversation with Teresa van Dongen, biodesigner exploring natural forms of artificial light
Kelly van GemertThere was a time when flipping the switch, and seeing a glass bulb light up, was magical to anyone in the world. Today, the presence of a light switch in a room, is something …
The next sexual revolution is going to be all about technology
Peter DiamandisSex is one of the most powerful, fundamental human drives. It’s caused wars, and built and destroyed kingdoms. It occupies a significant percentage of most people’s thoughts. As …
How biotechnology could shape the future of product design
Ruben BaartHumans have been manipulating living things for thousands of years. Examples of early biotechnologies include domesticating plants and animals and then selectively breeding them …
These are the 'meltwater lakes' of Antartica
Jennifer ArthurDuring the Antarctic summer, thousands of mesmerising blue lakes form around the edges of the continent’s ice sheet, as warmer temperatures cause snow and ice to melt and collect …
How climate fiction novels allow us to imagine possible futures
Adeline Johns-PutraEvery day brings fresh and ever more alarming news about the state of the global environment. To speak of mere “climate change” is inadequate now, for we are in a “ climate …
Want to build an organization that lasts? Create a superorganism
Tamsin Woolley-BarkerFor the past 25 years, I’ve studied everything from baboon cooperation in Ethiopia and orca whale innovation in the Bering Sea, to the Argentine ant invasion in my kitchen, and my …
How my chatbot fell in love with me
Tim DaalderopThe virus is forcing all of us to sit at home. While we are allowed to have social contact—albeit at an appropriate distance, intimate contact is hard to find. How to cope with …
Blind woman sees with new implant and plays video game sent straight to her brain
NextNature.netIt’s been over a decade since artificial retinas first began helping the blind see. But for many people, whose blindness originates beyond the retina, the technology falls short. …
Track freshness and reduce food waste with Rui Xu
NextNature.netImagine this: you wake up on a lazy Sunday morning, trudging your way to the fridge only to be welcomed with the smell of something rotting. Did the meat expire sooner than …
In conversation with cyborg choreographer Moon Ribas
Ruben BaartIf we could extend our senses in order to perceive the planet in a deeper way, would our understanding and our behavior towards it be different? We caught up with cyborg …
Max Liboiron: "Pollution is Colonialism"
Ruben Baart, MaithriWe now live in a world where plastics are becoming a part of our marine ecosystems. As a result, we strive hard to clean the plastics from our oceans. Dr. Max Liboiron ( Michif …
How technology will help us adapt to climate change
NextNature.netClimate change will transform how we live, but these tech and policy experts see reason for optimism
Next Generation: Wandering through the post wilderness with Melissa Schwarz
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Urban Dolls
Hendrik-Jan GrievinkThe idea of altering your body for aesthetic purposes is still somewhat frowned upon today. But more than because the very idea of improving yourself, this is about its …
Further Incredibly Shrinking Man
Koert van MensvoortArtist Arne Hendriks gave a lustrous talk on the possibilities of downsizing humanity to better fit the earth.
Structuring biomimicry, improving building's resiliency
Wilfredo Mendez VazquezThe same way Einstein assumes the speed of light to be a constant of reference for his Theory of Relativity, the philosophy of biomimicry assumes Nature as a constant of reference …
Robot’s Best Friend
Alessia AndreottiFrom chef, to nurse, and also lover. Get ready, a new generation of robots is going to invade our lives!
Robots Taking Government Jobs
Ruben BaartMeet Amelia, the first robot to work along with human coworkers in a council job.
Our Relationship with Tech Is Growing Stronger
Megan Ray NicholsIt's getting difficult to discern what's technology and what's not.With wearable technology becoming more and more integrated into society, our lives become infused with more technology.
This artwork lets trees tell the story of climate change
Linda ValentaIn our ongoing battle against climate change, it's hard to transcend from our human position and ‘think’ like nature. Given, nature doesn't think the way humans do, but it does …
Here’s how the Dutch are embracing blockchain in the polder
Coen van de VenSmiling broadly and rattling with enthusiasm, the 33-year-old Rylana Doesburg shows off a QR-code on her phone: an angular pattern of black and white squares. “Thanks to this …
Three scenarios for the future of farming
Kelly van GemertAgriculture may be one of the oldest of our technologies. Over time it has developed, changed, revolutionized, industrialized - or simply put, it has evolved . Today’s farms are …
Why in the future, we will all wear one piece of garment
Ruben BaartIt's not an easy task to define the practice of designer Jasna Rok . Fashtech pioneer? Radical innovator? Visionary designer? ‘All of the above’ seems only appropriate. In fact, …
Should lab-grown meat be labelled as meat when it's available for sale?
Hope JohnsonAustralian regulators will soon be faced with a challenge: can animal flesh produced in a lab be called meat? Amid reports that lab-grown meat could be on sale this year, the US …
Your next doctor might just be a robot
Jack CaulfieldConventional wisdom says that you can’t replace the human touch in terms of medical care, but in our rapidly changing technological environment, it appears that this perception …
The social animals that are inspiring new behaviors for robot swarms
Edmund HuntFrom flocks of birds to fish schools in the sea, or towering termite mounds , many social groups in nature exist together to survive and thrive. This cooperative behaviour can be …
What is a species?
Henry TaylorA koala bear isn’t actually a bear, it’s a marsupial. Whales aren’t fish, they’re mammals . Tomatoes aren’t vegetables, they’re fruit . Almost nothing is actually a nut . Peanuts, …
A guide to parenting with AI Barbie
Siri BeerendsThe rise of artificial intelligence has brought us more advanced toys. If AI Barbie and her talking robotic friends are going to raise our kids, what would their parenting style …
How to design your Self
NextNature.netWho are you, who do you want to be, and what do you need to do to get there? We are constantly pushed to lead the perfect life. The media present us with a picture of an existence …
Why your pets can't spread the coronavirus
Sarah L CaddyA Pomeranian dog in Hong Kong grabbed the international media’s attention this week after scientists found traces of coronavirus in the canine. Following confirmation that the …
Next Generation: Building Aquatecture with Shaakira Jassat
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The Institute of Digital Fashion explore what's next in the industry
Trading animal skins for pixels, our digital selves call for a digital wardrobe. The Institute of Digital Fashion , led by CommuneEast founder Leanne Elliott Young and Digi-Gxl …
The next generation of Xenobots are here
Simon Coghlan, Kobi LeinsIn 2020, scientists made global headlines by creating “ xenobots ” – tiny “ programmable ” living things made of several thousand frog stem cells. These pioneer xenobots could …
A new mythology of technology
Ruben BaartIn conversation with architect Julia Watson, a leading expert on Indigenous technologies and author of 'Lo-TEK, Design by Radical Indigenism'.
Interview with a cyborg
Arnoud van den HeuvelErich Berger has a 96 year old grandmother who is a cyborg. She features dentures, hearing aids, glasses, pace maker, a metal implant on the pinkie toe, and more. Quotes from the …
Five strategies of Biomimicmarketing
Koert van MensvoortGreen electricity, Organic Shampoo, Jaguar convertibles, Red Bull, Bio Beef, Alligator gardening tools, Camel cigarettes and Puma sneakers. Once you develop an eye for it, it is …
The Earth on Loan
Allison GuyChristian Schwägerl is a correspondent for Der Spiegel and the author of Menschenzeit (The Age of Man). He will be presenting his views on the Anthropocene at the Next Nature …
Customizing the Brain with Psychoactives
Jan Willem van der LindenIt’s long been a desire of the human species to have complete control over our own thoughts. We’ve all had these moments where we curse our brain. Asking questions like: “Why …
Did a Robot Grow your Vegetable?
Alessia AndreottiThe world’s largest indoor farm is not the only firm developing vertical agriculture. Japanese company Spread plans to grow more than ten million heads of lettuce a year by …
Designed to Survive Our Roads
Ruben BaartA road safety campaign in the Australian state of Victoria exposed an educational, yet confronting picture to raise awareness to the vulnerable human body on the road.
Drones in Agriculture
Megan Ray NicholsHere's a look at how drones can and will impact the agriculture and farming industry.
ECO Coin Award Interviews: Sandra Rey
Jack CaulfieldWe asked Sandra Rey, our third ECO Coin Award nominee, about her company Glowee and her hopes for illuminating the future in a more sustainable way.
Custom-grown bones, and other wild advances in regenerative medicine
Vanessa Bates RamirezThe human body has always been an incredible machine, from the grand feats of strength and athleticism it can accomplish down to the fine details of each vein, nerve, and cell. …
The return of direct democracy: Introducing a digital agora to the crypto-world
Koen WeselIn Ancient Greece the people were part of a direct-democracy, this means that they would directly vote for policies and laws. Nowadays, it seems as though this horizontal approach …
Next hospitals: How virtual reality is shaping the future of medicine
Jack CaulfieldAnd it’s already showing incredible results. VR transports us to faraway worlds without even asking us to leave our chairs. Yet we usually hear about it in the context of video …
Next Generation: Unleashing nature’s untapped potential with Amelie Unger
Freya HutchingsThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Why some plastic packaging is necessary to prevent food waste
Manoj Dora and Eleni IacovidouThere has been a surge in awareness of the damage that plastic pollution does to our planet in recent years. It has spurred a number of campaigns to remove single-use plastics …
The religion named Artificial Intelligence
Linda ValentaWould you pray to a Robot deity? A group of Japanese buddhists is already doing so. Meet Mindar , the robot divinity shaped after the buddhist Goddess of Mercy, also known as …
A vegan meat revolution is coming to global fast food chains
Malte RodlA few years ago, convincing meat-free “meat” was nothing more than a distant dream for most consumers. Meat substitutes in supermarkets lacked variety and quality. Plant-based …
Next Generation: Sheng-Wen Lo hears ultrasound waves like pets do
Ruben BaartThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
A button that tells your boss you're unhappy
NextNature.netWith gyms closed and millions cooped up and restless at home, it’s little wonder that “healthtech” is now being billed as the next big battleground over which the likes of …
It's been fifty years since we took the first full photo of Earth from space
Robert PooleThe image of the whole Earth as seen from space has become a symbol of the environmental movement. Time for an update?
Explore (the future of) Nature at IDFA Festival
Kelly van GemertHumans often claim to be at the top of the food chain, but is that really the case? We are experiencing – now more than ever – our own fragility: an increase in natural disasters, …
When will the first baby be born in space?
Chris ImpeyWhen the first baby is born off-Earth, it will be a milestone as momentous as humanity’s first steps out of Africa . Such a birth would mark the beginning of a multi–planet …
The sense of privacy
NextNature.netHumans’ natural sense of privacy helps them regulate the boundaries of public and private, but fail when trying to identify privacy risks in the online world.
The Museum of Edible Earth
Ruben BaartWe spoke with the Museum of Edible Earth, a travelling museum dedicated to the prosperous amount of soil samples.
Friending, Ancient or Otherwise
By ALEX WRIGHT, Published in NY Times December 2, 2007 The growing popularity of social networking sites like Facebook , MySpace and Second Life has thrust many of us into a new …
Supermarket – Our Next Savanna
Koert van MensvoortWe are living in the future and we find it boring. The best place to gather evidence for this claim is the supermarket. To begin with, try and have a fresh look at the word: …
Plastic Planet
Koert van MensvoortWe tend to think of plastic as a cheap, inferior and ugly material used to make children’s toys, garden furniture and throwaway bottles. But as an experiment, imagine for a moment …
The Monsters We Deserve
Allison GuyRecently, a video clip has been circulating the web that purportedly shows a rabbit born earless due to the radiation at Fukushima. BoingBoing has a convincing take-down of the …
Bonobos (And Maybe Baboons) Domesticated Themselves
Allison GuyWhile evidence indicates that humans domesticated themselves , we're not the only primates capable of self-domestication. Bonobos and baboons have shown they are just as capable …
End of Life Care Machine
Marco van BeersDesigner, artist and engineer Dan Chen has developed the ' End of Life Care Machine ', a machine designed to guide and comfort dying patients with a carefully scripted message. …
The "Actroid" Lives in the Uncanny Valley
Allison GuyThe Actroid robot holds clues for climbing out of the uncanny valley.
Meet Yangyang, Actroid From China
Alessia AndreottiThe humanoid robot Yangyang can function autonomously, talking and gesturing while interacting with people.
Artificial Senses for Navigation
Ruben BaartA team of cyborgs and digital enthusiasts developed a wearable technology for the body that perceives a human sixth sense.
Bringing the Camera Back to Our Eyes
Monika KozubThe new Spectacles by Snap Inc. allow you to actually "make memories" (as their slogan claims) while capturing them.
Solar Energy: the Hottest New Currency
Lewis JustEnergy-backed money could help transition humanity to a more sustainable world, both environmentally and economically.
Artificial Light Threatens Pollination
Daniel FragaA recent study demonstrated how artificial light is a serious threat to plant pollination. It puts plant reproduction in danger, as well as the whole ecosystem.
Digital Detox: Disconnect to Reconnect?
Nadine RoestenburgDo you feel information overloaded? Do you experience stress? Do you feel like you are addicted to your smartphone, laptop, or the Internet? Get yourself digital detoxed!
The Digital Mythology of... Super Mario
Daniel FragaMythology still surrounds us, we just relate to it differently. Games and movies have replaced pantheons and folk tales. Fairies and gnomes left the forests and the rivers and moved to virtual realities.
How this self-sustainable microhome may change the future of housing
Belen MunozLooking for a self-sustainable mobile microhome? Ecocapsule got you covered. This cute-as-pie capsule pod allows you to live completely off the grid in a low-energy, mobile …
If you could have another sense, which sense would you choose?
Meike SchipperColor-blind artist Neil Harbisson designed a brain-implanted antenna that converts colors into sound. This enables him to hear colors he cannot see, and extends his vision to …
Next Generation: Biophilic design with Daniel Elkayam
Freya HutchingsThis story is part of Next Generation, a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Four visions for the future of public transport
Marcus EnochThe way people get around is starting to change, and as a professor of transport strategy I do rather wonder if the modes of transport we use today will still be around by the …
Oded Ezer discusses the future of typography and the importance of dreaming
Freya HutchingsOded Ezer is a typographer from Israel who never fails to push boundaries, or rather, discard them altogether. Ezer is a rebellious force that swings between commercial and …
Next Nature book launch: here's what you missed
The new Next Nature book is here ! Next Nature fellows, ambassadors, members and newly interested people came together on the 4th of June to celebrate the book launch with a …
How a 6.000-year-old fruit fly gave us cheese
John MorrisseyHistorians often trace the dawn of human civilisation back 10,000 years, when Neolithic tribes first settled and began farming in the Fertile Crescent, which stretches through …
How public camera recordings domesticate us
Janina SteinmetzFacial recognition is increasingly being used in many countries around the world. In some cases the take up has been dramatic . As a result, people are being observed by cameras …
What will the virus teach us about life?
Koert van MensvoortWe live in turbulent times. Thanks to science and technology, we are able to perceive our environment down to the atomic level. We can read DNA, manipulate cells, cut and paste …
How plastic waste is hurting women in developing countries
Kutoma WakunumaIf we are to build a greener, fairer and more equal society in the wake of COVID-19, it’s time for rich countries to end their practice of dumping plastic waste in developing …
To save forests, researchers are hooking trees up to Twitter (again)
NextNature.netIn July 2018, a century-old red oak went live on Twitter. The account @awitnesstree , tweeting from the Harvard Forest in Petersham, Massachusetts, introduces itself in its bio: …
Exploring assisted evolution with Prof.dr. John van der Oost
Marit BeerseAssisted evolution raises complex questions. The practice involves human intervention to increase the rate of natural evolutionary processes. A technique that inevitably …
The Petunia Carnage
Marit BeerseTo pay tribute to the destroyed orange petunias during the Petunia crisis, Klaus Pichler has composed an illustrative book.
Amsterdam Weekly on the Natural Revolution
The free cultural paper Amsterdam Weekly discusses the Natural Revolution of and includes tree tips for successful living in the next version of nature. Download PDF (148kb) . …
BVPS Next Nature in LA - Pictures!
May 17th 2008. Biggest Visual Power Show: Next Nature in LA . More pictures below. We are all born in a world that has been designed already. BVPS intro video by Floris Kaayk. Big …
Bacteria that Turn CO2 into Energy
Koert van MensvoortWe’ve written earlier about man–made bacteria that eat waste & shit petrol . How about a genetically modified bacteria that can eat CO2 and excrete methane that could power …
Disaster Edens: The Anti-Tourist Attraction
Allison GuyImagine your cruise to the Galapagos came with a ghoulish warning: "Your hair will fall out, your skin will blister, you'll probably get cancer and your children's children might …
Lions Relocate to the Suburbs
Allison GuyAs cities push to the edges of the wilderness, wild animals are increasingly com
Exploring the Offline World, if It Still Exists
Bram de VogelThe surprising results of a year offline in the "real" world.
Grossed Out by Lab-Grown Meat? Here's 7 Reasons Why You Shouldn't Be
Allison GuyIn vitro meat is creepy, unnatural and downright disgusting – and so is every other kind of food we eat.
Interview: Jason Silva, Media Artist and Curator of Awe-Inspiring Ideas
Alessia AndreottiMedia artist, filmmaker and wonderjunkie Jason Silva talks about technological evolution and why humans are gods with anuses.
Growing the Future of Meat
Christina AgapakisOutside of the limits imposed by the edges of an animal’s body, the cells can reproduce and multiply until they exhaust the nutrients and space provided, filling petri dishes and vats to grow the future of meat.
Interview: Chloé Rutzerveld, Designer Who Wants to Grow Healthy 3D Printed Food
Alessia AndreottiFood and Concept designer, Chloé Rutzerveld, explains her 3D food printing project Edible Growth.
Should Intelligent Sex Robots be Banned?
Daniel FragaThe Campaign Against Sex Robots, recently launched, is pushing towards banning the continuation of sex robots development.
Which Technologies will 2016 Bring?
Wei Lun WangThe new year is right around the corner, let’s forget about long-term future for a while to check out what new tech trends will hit it big in 2016. At the end of every year, …
We Are What We Like
Alessia AndreottiAccording to a study our PC, equipped with a list of things we "Like" on Facebook , knows us better than our friends.
A.I. Can Guess Exact Locations of Images
Margherita OlivoGoogle's PlaNet will be soon able to tell you where a photograph was taken by simply looking at its contents.
Pigs Have a Heart for Us
Elise MarcusReplacing your old heart with a new heart from an animal may seem extreme? Well, this future may arrive sooner than we think.
Racist Robots and Bloodthirsty Crowds
Daniel FragaIt took less than 24 hours for Twitter to corrupt an innocent AI bot and teach it morally repugnant things.
Untouched Nature Is Entirely Gone
Margherita OlivoResearchers prove that pristine landscapes haven’t existed for thousands of years, therefore we should change or mindset before trying to save the planet.
Hire a Smart Robot
Daniel FragaWhat if your co-worker was a robot? Dutch startup Smart Robotics is a job agency for robots that allows you to hire a smart-robot.
Designer Anouk Wipprecht combines fashion with robotics
Alessia AndreottiWe met Anouk Wipprecht and talked about smart fabrics and accessories that can listen to our body, therapeutic fashion and the future of dressmaking.
An afternoon with Josh Tetrick: The man who wants to bring in vitro meat to the market by 2018
Ruben BaartMeet Josh Tetrick, entrepreneur who wants to reinvent the food industry and plans to launch lab-grown meat on the market by the end of 2018.
The Economy of Ecology
Lewis JustWhat if we could redesign the system to work for humanity and the planet we call home? What would the economy of ecology look like?
MIT's new voiceless interface can read the words in your head
Vanessa Bates RamirezThe way we interact with the technology in our lives is getting progressively more seamless. If typing terms or addresses into your phone wasn’t easy enough, now you can just tell …
Robo Wunderkind is a modular robot even a five-year-old can program
Kelly van GemertMeet the Robo Wunderkind, a new breed of smart toys that introduces children to the basics of coding and robotics in a playful way. Advanced technologies are increasingly embedded …
How to biofabricate leather; lessons from the lab
Laura MuthLeather is one of the oldest and most versatile materials in the world. It’s a supple, tough, relatively strong and durable material and it’s relatively impermeable, yet …
Discussing bio-based material experiences with Elvin Karana
Meike SchipperThe world of design is in need of new materials that align with the urgency for sustainability. Issues such as climate change, plastic waste and harmful materials require us to …
There's a new urgency for speculative design. Here's why
Freya HutchingsPink chickens, synthesized tiger penises and salads grown from bodily fluids - how could they shape our future? In a Next Nature collaboration with the Gogbot Festival, the …
Is in vitro meat good news for animals?
NextNature.netThe Singapore Food Agency has approved “chicken bites” containing meat made from real chicken cells that were grown outside of a chicken’s body. Alongside similar news from Israel …
Living robots made from frog stem cells may revolutionize medicine
Freya HutchingsAt just a millimeter wide, Xenobots are “neither a traditional robot nor a known species of animal", they are "a new class of artifact: a living, programmable organism”, says …
Next Generation: Searching for Null Island with Deborah Mora
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Technosphere outweighs the biosphere
NextNature.netOur deficiencies have always driven us, even among our distant ancestors, back in the last Ice Age. Having neither the speed and strength to hunt large prey, nor sharp teeth and …
A message from volcanic rocks
Laura van den BrinkAlthough it’s seductive to think of human beings as the dominant species on earth, many others play important roles too. Bacteria, insects, algae colonies, rocks and the …
Coffee... without the beans
Vanessa Bates RamirezAs with many of the products we consume, there’s a cost beyond what we pay at the store. Producing coffee has an environmental cost, too.
An artificial skin to breathe underwater
Leanne VoshellThe human world often sees itself as separate from the rest of the natural world. Because we have deemed ourselves, ironically, as higher functioning beings over all others on …
Notes on the plastisphere
Shahar LivneEvery piece of plastic that’s ever made, still exists. It results in a floating garbage dump in the ocean, full of life. While this (geo)design was never intentional, humans …
Screen mutations and reframing perspectives with Louisa Zahareas
NextNature.netIn the digital era of a globalized world, our screens have become a second set of eyes. Communication has advanced leaps and bounds, to a point where we cannot imagine a world …
Artist refuses photography prize after admitting his image was AI-generated
Vanessa Bates RamirezA German artist refused a photography prize after admitting his image was AI-generated.
Dancing at the intersection of natural and virtual worlds
Eleni MaragkouExploring the intersection of technology and art, a team of creatives presents a virtual performance that pushes the limits of human expression.
Geodesign
Nellie FriedrichWe have identified eight key defining moments that tell the story of geodesign, from ancient insight to artificial intelligence.
Wild Wild Space
Veronica FanzioWhen Earth goes south, cowboys go all the way up. The Space Rush of 2020s has something to do with settler colonialism.
Fake for Real
Koert van MensvoortFakeness has long been associated with inferiority. Fake Rolexes that break in two weeks, plastic Christmas trees, leaky silicone breasts that cause cancer, imitation caviar. Even …
The Evolution of the Richer
Diogo CorreiaAre we on the verge of a future human evolution, one that isn’t, at least in it’s very core, “the survival of the fittest”, but rather “the evolution of the richer”? Think about …
Having Invented the Gods, Perhaps we can Turn into Them
Jason SilvaMy name is Jason Silva. I've spent the last 5 years hosting and producing a tv show on Al Gore's Emmy-winning Current TV network and I'm a fellow at the Hybrid Realities …
Next Nature Movie #4: Blade Runner
Koert van MensvoortLook around you and try to find the most natural thing in the room you are in now. It is you. Now, you wouldn’t be so sure in the apocalyptic Los Angeles of 2019 depicted in Blade …
Technostalgia
Ties van de WerffIn Next Nature, not only old nature is being idealized. Because of the rapidness of new emerging technologies, we have a tendency to dwell on earlier prototypes. To recall …
A New Take on the Tree
IzzyWoodsMany people will have heard of the infamous swastika made up of larches that revealed itself every autumn in a forest outside Berlin . The trees, which turned yellow at the end …
Nintendo Portables Are Breeding Grounds For Sexy Fun
Vincent KlerkxSexuality and sensuality are phenomena which have been a nature for us as long as we humans exist. Not only humans experience these phenomena; also animals experience sexuality …
Post Natural Organisms of the EU
Koert van MensvoortIf you happen to be in the neighborhood you might want to drop by at the exhibition Post Natural Organisms of the European Union in Amsterdam. The small but delicate expo, curated …
Walter Benjamin on Film and the Senses
During the late 1930’s the philosopher Walter Benjamin wrote its widely influential essay ‘The work of Art in the Age of Its Technical Reproducibility’. While describing a general …
Get Infrared Sight with a Vitamine Diet
Julia WeberBio-hackers developed a protocol to augment human sight to see into the near infrared range.
Three Points in Support of In Vitro Meat
Alessia AndreottiThe top three aspects why people should support cultured meat.
Anthropo-scene #9: Sense, Sensors, Sensitivity
ChristianTechnology helps us understand the unfolding of the Anthropocene.
The Risk of Technological Unemployment
Daniel FragaStephen Hawking gives his opinion on what technological unemployment, aka machines taking over our jobs, can represent for future human societies.
The World’s Largest Indoor Farm
Alessia AndreottiThe world’s largest indoor farm in Japan is 100 times more productive than traditional agriculture.
Insects are helping us develop the future of hearing aids
Rob MalkinThe human ear is a miracle of mechanical evolution. It allows us to hear an astonishing range of sounds and to communicate and navigate in the world. It’s also easy to damage and …
New Diets for Cows Can Stop Gas Emissions
Mathilde NakkenYearly 90 million metric tonnes of methane are burped and farted into the atmosphere by cattle with effects on climate change. Researchers are looking for ways to change the cow's diet, feeding it oregano, seaweed and super grass.
Will We Share .thought Files?
Mathilde NakkenWith the evolving technique called EEG, electroencephalography, we can measure brain activity and ultimately even read the brain.
AI & VR Impact on Architects and Engineers
Megan Ray NicholsFuture workspace, human interaction and unique experiences: here’s how artificial intelligence and VR impact on architects and engineers.
ECO Coin Award Interviews: Ritsert Mans
Jack CaulfieldWe asked Ritsert Mans, our second ECO coin award nominee about his bike, the technology that fuels it and his hopes for the future.
In Conversation with Yoyo Yogasmana, Winner of the First ECO Coin Award
Ruben BaartRead our conversation with the ECO Coin Award Winner of 2015: Yoyo Yogasmana.
Next Nature Gift Guide 2017
NextNature.netThe gift giving season is once again upon us and to help out those who are struggling to find that perfect gift for that special someone we have brought together a collection of Next Nature inspired gifts.
Personhood Status for Robots
Julie ReindlAn "electronic personhood" for robots has been discussed in the European Parliament recently, raising big questions about equality, citizenship, legal and ironically, human rights for artificial intelligent machines.
Technosphere Weighs 30 Trillion Tons
Koert van MensvoortIf humans would disappear from the face of the Earth today, we would still leave 30 trillion tons of mass in the geological record. Certainly, "we were here" is written all over.
The age of cyborgs has arrived
Vanessa Bates RamirezHow many cyborgs did you see during your morning commute today? I would guess at least five. Did they make you nervous? Probably not; you likely didn’t even realize they were …
Gamers are the new athletes: Sports in video games from Pong to VR
Jack CaulfieldSports have always had an important place in human societies, providing entertainment, exercise, and a demonstration of the exceptional things the human body can achieve. But in a …
Interview: Jeremy Bailenson on his latest book "Experience on Demand"
Katherine Oktober MatthewsVirtual reality has come a long way. Like most technological leaps, it’s had a huge push from the entertainment industry, but current applications span a wide range of social and …
Interview: Designer Shahar Livne is geomimicing the future of plastics
Kelly van GemertWe sat down with Shahar Livne, an Israeli-born designer who graduated from the Design Academy in Eindhoven to talk about her vision on the future of plastics.
Period emoji could smash the stigma surrounding menstruation
Cara CurtisAstonishingly, we’re still living in a world where most women feel uncomfortable talking about their periods and some don’t even have access to sanitary products. This is why …
Reimagining popular apps with the Pyramid of Technology
Alejandro AlvarezToday, there's an app for everything. They help us satisfy our cravings, allow us to communicate at all times and make it easier to share special moments. But the dark, cold …
Sandra Rey wins ECO Coin Award
NextNature.netThis year we are proud to announce that, with her ambitious work within the field of bioluminescence for Glowee, Sandra Rey is the ECO Coin Award 2017 winner.
Here’s what manufacturing enhanced with virtual reality will look like
Megan Ray NicholsRobots are coming for our jobs. Virtual reality is coming to make the jobs that remain easier to accomplish. All of the world’s manufacturing sectors are in the process of …
Why electric cars should be allowed to drive faster
Koert van MensvoortIn response to the nitrogen crisis, the Dutch cabinet is planning to reduce the speed limit during the day to 100 kph. In itself a sensible decision. But it is strange that this …
Exploring body architecture with Lucy McRae
Meike SchipperAs evolution goes on, the human body is evolving too. What does it mean to be human in times of advanced biotechnology and genetic engineering? Are our bodies ready for our …
Truly smart homes could help dementia patients live independently
Dorothy MonekossoYou might already have what’s often called a “smart home”, with your lights or music connected to voice-controlled technology such as Alexa or Siri. But when researchers talk …
Electric cars might not yet be green, but we should buy them anyway
Ranald BoydellTransforming the way we travel is an essential part of tackling the climate crisis. The transport sector contributes about 20% of global carbon emissions . In the UK the figure is …
(IM)POSSIBLE BODIES: Responsiblity and care in our cyborg future
NextNature.netWhat does it mean to become a cyborg? Better yet, aren't we cyborgs already? What then, does it mean to have a body? Is a 'standard' desirable, what does that even mean, and what …
Next Generation: Hearing the first breath of Earth with Dora Lionstone
NextNature.netThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
5 expos (NL) you cannot miss this summer
NextNature.netInterior based on bacteria, spaces morphing perception and the merging of man, animal and machine. These five must see exhibitions in the Netherlands explore the intersection of …
Blocking the sun with dust
Vanessa Bates RamirezIn the past few years, scientists have hatched some pretty crazy-sounding schemes in the name of protecting Earth and its inhabitants. From building an underwater wall 120 …
Bio textiles: Meet three designers reimagining materials using biotechnology
Alexandra KisielewskiThe world needs interdisciplinary creators who are designing not just for humans, but for the rest of the living planet. To foster this thinking, Biodesign Challenge (BDC) pairs …
Fish-inspired soft robot takes a deep dive (literally)
Dimitris TsakirisThe deepest regions of the oceans still remain one of the least explored areas on Earth, despite their considerable scientific interest and the richness of lifeforms inhabiting …
Future cities: We need to reimagine the look of urban landscapes
NextNature.netIn imagining future urban landsapes, we need to answer questions about what can be sustained and what cannot, where cities can be located and where they cannot.
Next Generation: Exploring blood, salt and iron as biomaterials with Hedwich Rooks
Kelly van GemertThis story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch: magazine@nextnature.net. …
Rights for cyborgs
Marit BeerseCyborgs - part human, part machine - are becoming more present in society, but their rights are not yet established.
Why Borghildur Indriðadóttir wishes to perform on the Moon
What is the meaning of art on the moon? Artist on the Moon is the latest project from Icelandic visual artist Borghildur Indriðadóttir , who aims to perform for the stars and …
Next Generation: Designing a living menstrual cup with Lucrezia Alessandroni
NextNature.netWhat if living objects could re-connect humans with their menstrual cycle and change the way we perceive it?
Furniture Futures
Nellie FriedrichWondering how next natural furniture may change your way of life? Will we feed our lamps? Grow chairs? Talk with our tables?
Cooking with mycelium
NextNature.netResearchers from the University of Colorado created a recipe book to cook with mycelium.
CrackBerry addicts are suing their Employers
Dr NaturalNo self-respecting manager would be without a BlackBerry. But now these handheld gadgets, which provide workaholics with constant email updates, are being blamed for chronic …
Ars Electronica Festival goes Next Nature
This years edition of the Ars Electronica festival , which has been hangout for international experts from the arts and sciences for almost three decades, focuses on the nature …
