Search results for More than human approach

Visual of Video Game-Playing Robot Acts More

Video Game-Playing Robot Acts More "Human" than Humans

Computer-controlled players in video games can usually be spotted for their repetitive, illogical or unemotional behavior. Unlike humans, non-player characters (NPCs) don't get …

Visual of Transgenic Jell-O, more human than ever!

Transgenic Jell-O, more human than ever!

The American Chemical Society has announced a new method of producing gelatin that sounds like good news for cannibals and the canni-curious. Researchers are able to create …

Visual of Robotization Makes Work More Human

Robotization Makes Work More Human

Imagine being 16 and studying for a job that soon won't exist. What kind of future is that? New occupations will come thanks to robotization.

Visual of 'Team Human' is a manifesto for humankind

'Team Human' is a manifesto for humankind

' Team Human ' is a manifesto—a fiery distillation of media theorist Douglas Rushkoff’s most urgent thoughts on civilization and human nature. In one hundred lean and incisive …

Visual of This year's electronic waste weighs more than the Great Wall of China

This year's electronic waste weighs more than the Great Wall of China

It’s widely known that the world has a plastics problem. What’s less widely known is that we have a similar problem with another kind of waste: electronics

Visual of Humane Technology #4: Resonate with human senses

Humane Technology #4: Resonate with human senses

Principle number four: Humane technology should resonate with the human senses, rather than numbing them. If you're an office worker or a video game fanatic , you may spend most …

Visual of Humans Caused Mass Extinctions Before There Were Even Humans

Humans Caused Mass Extinctions Before There Were Even Humans

Humans and other hominids have a reputation for bringing about mass extinctions. Homo erectus  has been blamed for the disappearance of many African carnivores, our ancestors …

Visual of A More Interesting, More Depressing Theory of Easter Island's Downfall

A More Interesting, More Depressing Theory of Easter Island's Downfall

A new theory claims it wasn't human deforestation that caused the ecological collapse of Easter Island, but something smaller and squeakier.

Visual of Explore your relationship with AI in this exhibition

Explore your relationship with AI in this exhibition

What makes us human? And why do we sometimes fear artificial intelligence? And what about technological singularity - the moment in time when artificial intelligence outperforms …

Visual of More than Fake Nature: The Surprising Sociology of Museum Taxidermy

More than Fake Nature: The Surprising Sociology of Museum Taxidermy

The greatest taxidermy in the world reveals a great deal about our changing notions of nature.

Visual of To Be Human Is To Be Transhuman

To Be Human Is To Be Transhuman

Buckle up for a new video from our favorite performance philosopher Jason Silva: To Be Human Is To Be Transhuman.

Visual of More leg = more money

More leg = more money

The Stock market skirt Nancy Paterson made a blue taffeta & black velvet party dress that represents the real-time stock market situation by lowering or raising its hemline. …

Visual of Why does a Salad Cost More Than a Big Mac?

Why does a Salad Cost More Than a Big Mac?

Remarkable infographic by pcrm.org . Via NY Times , via Consumerist.com .

Visual of Letter to Humanity

Letter to Humanity

NNN director Koert van Mensvoort writes a letter to humanity.

Visual of Talking Nonhuman Nonsense

Talking Nonhuman Nonsense

Nonhuman Nonsense is a research-driven design and art studio existing somewhere between utopia and dystopia. They wonder upon our relationship with the non-human, embracing …

Visual of NASA's 'Human Computers' helped land the first human on the moon

NASA's 'Human Computers' helped land the first human on the moon

Nowadays mechanical intelligence is often chosen over that of our own human capabilities. But there was a time where our computers were still not always a match against our own …

Visual of Humane Technology #6: Improve the Human Condition

Humane Technology #6: Improve the Human Condition

And now for the sixth and final principle: Humane technology improves the human condition and helps people realize the dreams they have of themselves. No matter what your …

Visual of Why superhuman technologies will affect us all

Why superhuman technologies will affect us all

When you look through a super-telescope, you can still see the planet Earth. Once called the blue planet, she now looks red and parched. We had no choice but to abandon her… On a …

Visual of Humane Technology #2: Revive Human Intuitions

Humane Technology #2: Revive Human Intuitions

Our second principle: Humane technology revives human intuitions, in particular those we might have forgotten about. 'Conventional' technology aims to overcome our hominid …

Visual of We Are more Bacteria than Human

We Are more Bacteria than Human

Our bodies are microbiomes, suffering from our habit of cleanliness.

Visual of Why human enhancement requires technological citizenship

Why human enhancement requires technological citizenship

New technologies – from artificial intelligence to synthetic biology – are set to alter the world, the human condition, and our very being in ways that are hard to imagine. The …

Visual of Humane Technology #3: Take Human Values as a Cornerstone

Humane Technology #3: Take Human Values as a Cornerstone

The third principle of humane technology: It should take human values as a cornerstone of its development. Technology doesn't have to be expensive or electronic to be humane. …

Visual of Can technology be humane?

Can technology be humane?

We must be mindful about how we engage with technology: what we use it for, why, and whether it helps us or hinders us. Sometimes our tech seems to be flowing in inhumane …

Visual of On inhumane technology

On inhumane technology

Stick-on shoes, wakeup lights, bionic limbs: these are examples of humane technology. But what exactly does this mean? It can best be explained in contrast with its opposite. …

Visual of Six principles of humane technology

Six principles of humane technology

We must be mindful about how we engage with technology: what we use it for, why, and whether it helps or hinders us. Sometimes our tech seems to be flowing in inhumane directions, …

Visual of Human-animal hybrids are coming and could be used to grow organs for transplant

Human-animal hybrids are coming and could be used to grow organs for transplant

Around the world thousands of people are on organ donor waiting lists. While some of those people will receive the organ transplants they need in time, the sad reality is that …

Visual of A path to humane technology

A path to humane technology

In 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …

Visual of Next Generation: Towards the Plastic Human with Max Ahluwalia

Next Generation: Towards the Plastic Human with Max Ahluwalia

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Discussing non-human centered design with Kelvin Godee and Simon Wijrdeman

Discussing non-human centered design with Kelvin Godee and Simon Wijrdeman

What if design began to put everything but the human first? The needs of the human not paramount to the design process, but instead the other entities that we cohabit planet earth …

Visual of The No(nhuman) Consent Form

The No(nhuman) Consent Form

There seems to be a green shift happening in Dutch Design, where the traditional vision is slowly sprouting into a newer, more refreshing one. The biodesigners are emerging from …

Visual of 'The Invention of Morel’ is a techno-lovestory from the future, written in 1940

'The Invention of Morel’ is a techno-lovestory from the future, written in 1940

Octavio Paz says calls  The Invention of Morel , “ without exaggeration… a perfect novel. ” According to Borges, “ to classify  [it]  as perfect is neither an …

Visual of Humans could recolonize Earth after mass extinctions with ectogenesis

Humans could recolonize Earth after mass extinctions with ectogenesis

Lately it seems that every movie, book and video game we see is about future apocalypses. Science articles are also painting a grim future for Earth and its inhabitants. If it’s …

Visual of Humans Are the Sex Organs of Technology

Humans Are the Sex Organs of Technology

Written by Kevin Kelly , published in The Technium .  I claim that technology has its own agenda. What is the evidence that technology as a whole, or the technium as I call it, is …

Visual of The Ecological Human

The Ecological Human

The nature of humanity in the twenty-first century is, according to sociologist Steve Fuller, a ‘bipolar disorder’ beset with dualisms of identification such as divine/animal, …

Visual of This machine makes human clouds

This machine makes human clouds

Humans have been changing the composition of the atmosphere for years, resulting in concerns such as air pollution and extreme climate events. According to Filips Stanislavskis , …

Visual of Fly like a Bird? Get Human Birdwings

Fly like a Bird? Get Human Birdwings

Dutch mechanical-engineer Jarnos Smeets dreams of flying like bird. Nothing new really, many people have had this dream for ages. Yet being an engineer and all, Jarnos is seriously propelling his dream towards a reality.

Visual of The Anthropocene Debate: Marking Humanity’s Impact

The Anthropocene Debate: Marking Humanity’s Impact

  Is human activity altering the planet on a scale comparable to major geological events of the past? Scientists are now considering whether to officially designate a new …

Visual of Neither Warfare nor Dumplings Are Innate to Human Nature

Neither Warfare nor Dumplings Are Innate to Human Nature

In Ngogo, Gombe and elsewhere in Africa, bands of male chimpanzees regularly make organized raids on neighboring troops and batter their enemies to death. These grim, warring …

Visual of Did Monogamy Make Us Human?

Did Monogamy Make Us Human?

Pair-bonding sets humans apart from our relatives. But where did it come from?

Visual of Meet Humanity beyond Race, it's Beautiful

Meet Humanity beyond Race, it's Beautiful

Meet Humanity beyond Race, it's Beautiful

Visual of Ectogenesis, Artificial Womb, Human Egg?

Ectogenesis, Artificial Womb, Human Egg?

The artificial womb is on the verge of becoming a reality, but how it will affect our culture is for us to decide.

Visual of This exhibition investigates how humanity will live tomorrow

This exhibition investigates how humanity will live tomorrow

Occupying the 52nd floor of Tokyo’s Mori Tower, Mori Art Museum is internationally renowned for its visionary approach and highly original curation of contemporary art. The …

Visual of Study finds humans still evolving and quickly

Study finds humans still evolving and quickly

By Karen Kaplan, Los Angeles Times , December 11, 2007 The pace of human evolution has been increasing at a stunning rate since our ancestors began spreading through Europe, Asia …

Visual of Animals Give Leadership Lesson to Humans

Animals Give Leadership Lesson to Humans

What are the characteristics of the perfect leader? The answer could be found looking at nature.

Visual of Longest Lived Human Embryo in a Lab

Longest Lived Human Embryo in a Lab

Scientists keeping a human embryo alive in lab for 13 days for the first time.

Visual of Knitting sweaters from human hair

Knitting sweaters from human hair

The textile industry is the second largest polluter in the world that leads to a chain reaction of nasty results: loss of biodiversity, water pollution and soil erosion are just a …

Visual of OUT NOW: Save the Humans! Book

OUT NOW: Save the Humans! Book

The SAVE THE HUMANS! book is now available on our web shop.

Visual of Humans to Blame for Global Warming

Humans to Blame for Global Warming

Global warming is "very likely" a human-caused problem that will last for centuries and require concerted international action to reduce its potentially devastating impacts, a …

Visual of Better Than Nature?

Better Than Nature?

At the turn of the millennium, miniaturized canines acquired the cherished status of living, designer handbag ornaments.  These teeny tiny photogenic doggies, which had been …

Visual of The Non-Human Noosphere

The Non-Human Noosphere

The definition of the noosphere as "the sphere of human thought on earth" is woefully anthropocentric. It ignores that fact that our fellow sentient organisms have noospheres of …

Visual of We Feel Empathy for Robots (Even if They Don't Look Human)

We Feel Empathy for Robots (Even if They Don't Look Human)

Human test subjects felt empathy for dinosaur robots being cuddled or abused.

Visual of Meat-Eating Made Us Humans

Meat-Eating Made Us Humans

Eating meat has made us who we are today: evolved, intelligent humans, able to use a verbal language.

Visual of 2016 - Human Embryo Lives 13 Days in Lab

2016 - Human Embryo Lives 13 Days in Lab

In 2016 a team of biologists has successfully kept a human embryo alive in the lab for 13 days, breaking the previous record of nine days.

Visual of The Search for the

The Search for the "Real" Thanksgiving

Thanksgiving is fake-for-real. While it's true that there was a minor harvest feast in 1621, held by English immigrants and Wampanoag Indians, the event was never celebrated …

Visual of Is the Human Body Redundant?

Is the Human Body Redundant?

The increasing ‘liveliness’ of machines and accessibility to the virtual world has raised questions about whether it is possible to uncouple the mind from the body in through a …

Visual of AI Defeats Human at Go

AI Defeats Human at Go

Go world champion Ke Jie has lost two games of 'Go' against Google's DeepMind AI system AlphaGo.

Visual of How technology keeps us connected, now more than ever

How technology keeps us connected, now more than ever

At this moment in time, many people are staying at home in order to flatten the curve . It is times like these that we realize how vital technology is to us and our societies. It …

Visual of Human Nature Forecast

Human Nature Forecast

Interview witth TEDx on how people are technological by nature, yet how we also need humane technology to remain human, or become even more human than we are today.

Visual of The Posthuman Farm

The Posthuman Farm

Wu Tzu-ning presents a posthuman reality from genetic engineering to digital afterlife.

Visual of The Birth of a Digital Nation in Estonia

The Birth of a Digital Nation in Estonia

Due to its digital citizenship program, something interesting is happening in Estonia. In July there were more new applications for e-citizenship than newborn babies. Are we …

Visual of The world’s plastic problem is bigger than the ocean

The world’s plastic problem is bigger than the ocean

As you read this, a strange object that looks like a 2,000-foot floating pool noodle is drifting slowly through the central north Pacific Ocean. This object is designed to solve …

Visual of Three exhibitions that explore the relationship between humans and the environment

Three exhibitions that explore the relationship between humans and the environment

As we go about our daily activities, we may lose sight of our connections with nonhuman life. Here are three exhibitions to encourage you to step outside of your everyday and …

Visual of Apes Like Cooked Food, and What that Means for Human Evolution

Apes Like Cooked Food, and What that Means for Human Evolution

Humans are the only species on earth that cooks its food. Not only do we cook our food, but we usually find the flavor of cooked foods preferable to the raw version. Compare the …

Visual of Incredibly Shrinking Humanity

Incredibly Shrinking Humanity

Arne Hendricks thinks we can solve the ecological crisis by shrinking every human on earth to 50cm tall: http://bit.ly/sxxNr1 #powershow

Visual of Your Data Is Worth More Than You Think

Your Data Is Worth More Than You Think

How valuable are your data?

Visual of Tiny houses: why more people are living in miniature

Tiny houses: why more people are living in miniature

Tiny houses have been heralded as a radical and creative way to address a lack of affordable housing, as well as reducing living costs and shrinking our carbon footprint. My PhD …

Visual of Save The Humans – Submit your Quote

Save The Humans – Submit your Quote

We call upon you, dear readers, to participate in a new publication from the Next Nature Network: SAVE THE HUMANS!.

Visual of There Are More People Flying in Airplanes right Now, than there were Alive on Earth in the Stone Age

There Are More People Flying in Airplanes right Now, than there were Alive on Earth in the Stone Age

Today there are on average there are some 8000 planes in the sky carrying at least half a million people. On average during the Stone Age there must have been less.

Visual of Letter to Humanity in 25 Languages, Plus One!

Letter to Humanity in 25 Languages, Plus One!

Read the Letter to Humanity in Morse Code.

Visual of Scientists want to create human-cow hybrid

Scientists want to create human-cow hybrid

Scientists in the UK applied for permission to create part-cow, part-human embryos for research aimed at treating diseases such as Parkinson's and Alzheimer's. The embryos created …

Visual of Humane Technology #5: Empower People

Humane Technology #5: Empower People

Principle number five: Humane technology doesn't outsource people, but instead empowers them. How healthy or humane is it to have an escalator to the gym? Humane technology should …

Visual of Save the Humans - Call for Quotes

Save the Humans - Call for Quotes

For our new book "Save the Human" we invite you to submit quotes that question the autonomy of mankind in the digital computer era and study the future of the independent creative spirit.

Visual of More People Are Too Fat Than Too Thin

More People Are Too Fat Than Too Thin

For the first time in history the world population counts more people who are too fat than too thin.

Visual of Save The Humans @ The Hoxton Hotel

Save The Humans @ The Hoxton Hotel

Next Thursday, February 11, the Hoxton Hotel in Amsterdam dedicates an evening to our newest publication: 'Save the Humans!'

Visual of Van Mensvoort Writes a Letter to Humanity

Van Mensvoort Writes a Letter to Humanity

On the occasion of the Earth Day, 22 April 2017, philosopher Koert van Mensvoort wrote his Letter to Humanity.

Visual of Humane Technology #1: Feels Natural

Humane Technology #1: Feels Natural

All too often, technology frustrates us. It forces our behavior into constrained pathways. Even more insidious, technology can knock us out of alignment with our values, goals or …

Visual of Watch Out Whales, Humans Want Your Krill

Watch Out Whales, Humans Want Your Krill

Krill, those tiny members of the ocean's planktonic community, have an importance disproportionate to their size. They are a vital food for whales, penguins and increasingly, …

Visual of Hurricane$ approaching

Hurricane$ approaching

Economy is ecology . At least, according to the biomimicmarketeers of the US Wachovia Bank who created this weather report like newspaper advertisement. Nowadays most people worry …

Visual of Internet Traffic is now 51% Non-Human

Internet Traffic is now 51% Non-Human

So you thought the Internet was made by and for people? Think again. A study by Incapsula , a provider of cloud-based security for web sites (mind you where this data comes from), …

Visual of Did Forks Really Give Modern Humans an Overbite?

Did Forks Really Give Modern Humans an Overbite?

The food writer Bee Wilson, author of Consider the Fork , has put forth a surprising theory about forks and teeth that has received widespread online coverage. According to …

Visual of Human Workers Get Increasingly Obsolete

Human Workers Get Increasingly Obsolete

Robots are coming to replace humans at work, are they a real threat to the world’s unemployed?

Visual of GM Pigs for Animal-to-Human Organ Transplant

GM Pigs for Animal-to-Human Organ Transplant

Scientists have been trying to develop GM pigs that could be used to solve the shortage of organs for transplant patients.

Visual of Human Cloning Now Possible in China

Human Cloning Now Possible in China

Is human cloning here? Chinese scientist is ready to clone people at his ‘replication factory’.

Visual of More Babies for Italy

More Babies for Italy

The Italian government just launched a campaign to raise awareness for falling birthrates and encourage family planning.

Visual of Q: How will a technology enter the human habitat?

Q: How will a technology enter the human habitat?

This question is an excerpt from the Pyramid of Technology toolkit In the late nineties, the Tamagotchi egg was released. A small egg-shaped device that contained a digital …

Visual of Better than the real thing

Better than the real thing

Written by Debbie Mollenhagen PART 1: FROM LINEAR TO CIRCULAR Designer living has become designing life. I often ask myself: did it taste like the real thing? But when I open my …

Visual of Hybrid Carp with human face

Hybrid Carp with human face

I never expected anthropomorphobia to be evoked by a fish! This hybrid species fish was born between a carp and a leather carp in the pond of a personal house in Chongju. Each of …

Visual of Humanthesizer

Humanthesizer

The human body as an instrument is a cool example of how culture and nature are merging. Calvin Harris used a giant human synthesizer to perform his single. The material used is …

Visual of Trading Humans for Trading Algorithms

Trading Humans for Trading Algorithms

The economic system and profit motive has been a driving force that steers and even dictates social change. Investors and stockbrokers have been a major influence to these social …

Visual of Jazz-Playing Robot Challenges Human-Computer Interactions

Jazz-Playing Robot Challenges Human-Computer Interactions

A musical robot able to improvise a jazz solo in response to an actual person performing jazz.

Visual of How Technology is Becoming More and More Sensitive

How Technology is Becoming More and More Sensitive

Over the past decade scientists have tried to get technology surfaces to be as sensitive as our skin, especially as our fingertips. Human tact is a very sophisticate interface …

Visual of 1537 - Homunculus: the Semi-Human

1537 - Homunculus: the Semi-Human

In 16th and 17th centuries, some medical theory believed that a miniature human body can be produced in a flask by an alchemist.

Visual of 2015: Artificial Placenta Approaches

2015: Artificial Placenta Approaches

In 2015, a group of scientists from the University of Michigan claimed to have made the world's first artificial placenta.

Visual of The Human Smart Home Assistant

The Human Smart Home Assistant

Artist Lauren McCarthy launched a project called LAUREN in which she embodies a eponymous human smart home assistant.

Visual of Next humans

Next humans

What will the human race look like in 1, 2, 3, 4 million years? Will it be one human race? Will there be a human race? Impressions of future scenario's must come from scientists, …

Visual of The Soft Touch of a Human Hand

The Soft Touch of a Human Hand

Nissan’s Engineers Are Creepily Trying To Replicate Human Skin

Visual of A Brief History of Humankind

A Brief History of Humankind

Historian Yuval Noah Harari takes us on a journey through the whole human history.

Visual of We Are Weaker Than Our Ancestors

We Are Weaker Than Our Ancestors

Human fitness has decreased so significantly that even the strongest of us would consider ancient men to have a supernatural force.

Visual of Musical Journey Through the Human Body

Musical Journey Through the Human Body

De Motu is an interactive music app that let you experience your body through music and influence the sound with your own body.

Visual of First human CRISPR trial in the US aims to cure inherited blindness

First human CRISPR trial in the US aims to cure inherited blindness

Gene editing is advancing at a faster pace than most of us can keep up with. One significant recent announcement was gene editing tool CRISPR’s application to non-genetic diseases …

Visual of A More Realistic Zoo

A More Realistic Zoo

Going to the zoo is a favorite summer past-time. Visitors to the Schönbrunn Zoo in Vienna will see lots of animals in recreated ‘natural’ habitats. Except this summer, along with …

Visual of The Human Printer

The Human Printer

For a while now printer ink is probably the most expensive liquid per litre on earth. Still we need our images so badly that we accept this fact. The Human Printer manages to make …

Visual of Dutch start Hunting again thanks to Supermarket Soccer Mascotte

Dutch start Hunting again thanks to Supermarket Soccer Mascotte

In Holland people go crazy for soccer, especially now that the national team has reached the World Cup final. We gather everything that's orange – our shirt color – as the …

Visual of The Human LED screen

The Human LED screen

All living creates produce light by default, so do humans . Now researchers from US, China, Korea and Singapore collaborated have collaborated in order to create ultra-thin …

Visual of Chrysler Looks to Human Lungs for a Better Gas Tank

Chrysler Looks to Human Lungs for a Better Gas Tank

Alveoli in human lungs serve as the inspiration for designing better, stronger ways of storing compressed natural gas.

Visual of Ghost Imaging: Taking Pictures of the Invisible Thanks to a New 3D Technique

Ghost Imaging: Taking Pictures of the Invisible Thanks to a New 3D Technique

British research group created anew scanning technique permits to obtain 3D images and detect wavelengths that our visual system is not able to see.

Visual of World's Worst Job? Being a Human Robot at Amazon's Fulfillment Center

World's Worst Job? Being a Human Robot at Amazon's Fulfillment Center

Workers are completely controlled by algorithms in Amazon's fulfillment center

Visual of Human-Shaped Power Lines

Human-Shaped Power Lines

Just a project for now, but a far more creative way to deal with unsightly public works than tree-shaped antennas.

Visual of Thanksgiving Getaway Gridlock

Thanksgiving Getaway Gridlock

In suburbia, we hope to get away from it all. Unfortunately, everyone else has the same idea. Happy Thanksgiving to our American readers!

Visual of Five ways AI could make your car as smart as a human passenger

Five ways AI could make your car as smart as a human passenger

Driving long distances without a passenger can be lonely. If you’ve ever done it, you might have wished for a companion to talk to – someone emotionally intelligent who can …

Visual of Biopresence - Human DNA Trees

Biopresence - Human DNA Trees

Imagine a graveyard without tombstones, instead there are growing trees that contain genetic material of the deceased people burried there. Biopresence creates Human DNA trees by …

Visual of Radio controlled human

Radio controlled human

Think of this sonic vibe-technology inside any MP3 player ;)

Visual of NOT (Natural) AND NOT (mechanical) = human

NOT (Natural) AND NOT (mechanical) = human

Eric Hoffer (1902-1983) You dehumanize a man as much by returning him to nature - by making him one with rocks, vegetation, and animals - as by turning him into a machine. Both …

Visual of Pencils made from cremated humans

Pencils made from cremated humans

Artist Nadine Jarvis fabricates pencils from carbon left over of cremated humans -- it's part of a larger "research project into post mortem." She notes that "240 pencils can be …

Visual of Human genome sequencing soon child play?

Human genome sequencing soon child play?

Starting next spring, a complete human-genome sequence can be ordered the Californian startup Complete Genomics for just $5,000, Techreview reports. Currently sequencing still …

Visual of Human garbage can

Human garbage can

Anthropomorphobic object of the week. Created by Sarah Hatch .

Visual of A More Realistic Mermaid

A More Realistic Mermaid

After being denied permission to reproduce the famed Little Mermaid statue from Copenhagen, the authorities of Vancouver decided to go for something more realistic.

Visual of Human Barbie

Human Barbie

Just when you thought the  Second Life  hype was long gone, meet Ukrainian body artist Valerie Lukyanova who aims to turn Second Life into First Life. They call her the Human …

Visual of Computer Algorithms Are Already Replacing Human Journalists

Computer Algorithms Are Already Replacing Human Journalists

Will writing software eventually replace journalists?

Visual of If Barbie Had Human Proportions

If Barbie Had Human Proportions

What does Barbie look like when she has the proportions of a normal 19-year-old?

Visual of All Humans Piled Together Are So Tiny

All Humans Piled Together Are So Tiny

All humans on Earth put together are not enough to fill the Grand Canyon. We are so small yet so present.

Visual of Web Access Is A Basic Human Right

Web Access Is A Basic Human Right

"It's time to recognize the Internet as a basic human right" its inventor Sir Tim Berners-Lee has said.

Visual of A Modest Future for Humanity

A Modest Future for Humanity

Three minutes in the mind of Juan Enriquez, director of Synthetic Genomics.

Visual of Hacking Human Cells to Use Solar Power

Hacking Human Cells to Use Solar Power

A new biotech startup seeks to hack our cells to use solar energy instead of carbon and oxygen.

Visual of Human-Like Robot Makes Freaky Joke About the Future of Mankind

Human-Like Robot Makes Freaky Joke About the Future of Mankind

To thread the uncanny valley is a conscious choice for many artists and enthusiasts, as a means to evoke, through their work, powerful emotions, thoughts and everything in between.

Visual of What if Humans Disappeared?

What if Humans Disappeared?

What could happen if humans would just disappear?

Visual of 20k human chip

20k human chip

AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …

Visual of Human animal hybrid

Human animal hybrid

This peculiar, half-human creature could be your cousin. No really; it is a sculpture by Patricia Piccinini entitled The Young Family , which, in turn, is part of a larger …

Visual of Human Nature as Pathology

Human Nature as Pathology

Modern society seems to have transformed human nature into a pathology. Our emotions are controlled by drugs. We are forced to operate within a narrow bandwith of what are …

Visual of More realistic airplane safety instructions

More realistic airplane safety instructions

Source: Fightclub .

Visual of Mapping the human desire to be touched

Mapping the human desire to be touched

Fleshmap touch investigates the collective perception of erogenous zones. Hundreds of people ranked how good it would feel to touch or be touched by a lover in different points of …

Visual of The Human Construction of Gay Animal Culture

The Human Construction of Gay Animal Culture

Much attention has recently been devoted to 'gay' animals. It's not the fact that many species have enthusiastic homosexual lives that should be surprising – there are convincing …

Visual of Black Wolves Have Dogs to Thank

Black Wolves Have Dogs to Thank

Black wolves should probably not exist. The same species as their gray relatives, these wolves have a genetic mutation that causes them to produces excess melanin, a pigment …

Visual of Human Augmentation™

Human Augmentation™

As a gamer, I come across many visions of possible futures. But this trailer from the upcoming video game Deus Ex: Human Revolution , the third part in the Deus Ex series shocked …

Visual of Would you care more if I was a Panda?

Would you care more if I was a Panda?

A smart campaign by Ogilvy Paris for WNF shows that also the ‘non-cute’ animals need our help. via Fubiz

Visual of #10: Enhance Human Experience, Don’t Replace it

#10: Enhance Human Experience, Don’t Replace it

Part 10 in the 11 part series Anthropomorphism and Design . The hidden danger with interactive products is that they will become so good at fulfilling our needs that they start to …

Visual of Beluga Whale makes Human-like Sounds

Beluga Whale makes Human-like Sounds

Researchers in the US have been shocked to discover a beluga whale whose vocalisations were remarkably close to human speech.

Visual of Book as Human-Computer Interface

Book as Human-Computer Interface

In combining the classic feeling of handling a book with the interactivity of the computer, Waldek W?grzyn of the Academy of Fine Arts in Katowice, Poland, has created a new human-computer interface.

Visual of One Generation in, Dolphins Still Transmit Human Tricks

One Generation in, Dolphins Still Transmit Human Tricks

Dolphins in Port Adelaide, Australia, have been observed performing a remarkable trick : tail-walking, a trait so rare it has only been seen in the wild one other time. More …

Visual of Maya YogHurt: Fermented Drink Made with Human Lactic Acid

Maya YogHurt: Fermented Drink Made with Human Lactic Acid

Artist Maja Smrekar modified yeast with her own DNA to produce human lactic acid.

Visual of The Human Hamster Wheel Desk

The Human Hamster Wheel Desk

The Human Hamster Wheel Desk is the latest result of workspace evolution. Office work has domesticated us!

Visual of A Map of Mars for Regular Humans

A Map of Mars for Regular Humans

If we'll ever get to go to Mars as tourists , we wouldn't get lost. Ordnance Survey , the official British mapping agency, recently released a new detailed map of the Red Planet. …

Visual of New AI Model Can Mimic Any Human Voice

New AI Model Can Mimic Any Human Voice

Lyrebird is an AI model capable of synthesizing anyone’s voice from just a one-minute audio sample.

Visual of Human Nature, designing the equilibrium with Koert van Mensvoort

Human Nature, designing the equilibrium with Koert van Mensvoort

Under the title Human Nature, designing the equilibrium, eleven designers will answer questions about a future in which Humankind and Nature enter into a new relationship. An …

Visual of Even Better than The Real Thing

Even Better than The Real Thing

Give it to me baby! Meet the teledildonics .

Visual of Human Tetris

Human Tetris

A tribute to the virtual world boomeranging back to the physical world by Mega64 . Or do you rather prefer the corny japanese gameshow version? Via Engadget ,

Visual of Human body farm

Human body farm

Why not use the human body to grow products for the medical industry? The designer Michael Burton envisions Future Farm where the body is used as a farm to cultivate clinical and …

Visual of Human Landscape

Human Landscape

Our peculiar image of the week was created by artist Levi van Veluw , who reinvents the classical fine art of landscape painting, by moving from the traditional 'oil on canvas' to …

Visual of Mirror Neurons – Simulation at the basis of Human Civilization

Mirror Neurons – Simulation at the basis of Human Civilization

Within our society, imitation and simulation are typically seen as inferior symbols of a distorted mediated culture – think of fake Rolexes, plastic Christmas trees, silicone …

Visual of Hi, a Real Human Interface

Hi, a Real Human Interface

By Multitouch Barcelona , via Trendbeheer .

Visual of People are better at growing Limbs than Lizards

People are better at growing Limbs than Lizards

Whereas lizards have the extraordinary ability to regenerate lost limbs – meaning that if the lizard loses a limb through conflict with a predator, it will grow back – people have …

Visual of Traditional Thanksgiving Meat

Traditional Thanksgiving Meat

Food technology in the overdrive: Pork molded in the shape of a piglet.

Visual of Who Needs Real Humans? Not H&M

Who Needs Real Humans? Not H&M

Clothing giant H&M no longer uses real humans in its online catalog. The company has admitted that it pastes real models' heads on computer-generated bodies. At least there's …

Visual of Rule #8: Use Human Ethics

Rule #8: Use Human Ethics

Part 8 of the 11 part series Anthropomorphism and Design .  Anthropomorphic products blur the boundaries between products and people. Ethical norms for people don’t usually apply …

Visual of Humans Need Not Apply

Humans Need Not Apply

Warning, this video on the impact of automation on human labor might cause you to re-plot you professional career.

Visual of What Is Next Nature? #10

What Is Next Nature? #10

Seeing more airplanes in the sky than birds

Visual of Human Artist Hatches Ten Chicken Eggs

Human Artist Hatches Ten Chicken Eggs

French performance artist hatches 10 hen's eggs in Palais de Tokyo.

Visual of Human LCD

Human LCD

New media technology from South Korea: a gigantic human display compiled from supporters cheering their soccer teams . One pixel per supporter. See also: Skyscreen , A4 e-paper .

Visual of 1 Whole human

1 Whole human

Peculiar product of the week. Found at.

Visual of A More Natural Typing Experience

A More Natural Typing Experience

Introducing the brand new, hand made, eco friendly, sweat absorbing, natural, healthy and most of all fashionable bamboo keyboard. It seems bamboo isn’t just for pandas anymore. …

Visual of Cake Made from Human Skin

Cake Made from Human Skin

Cake or death? Cake! The Slice cake is a (vegetarian) vision of the forms lab-grown meat may take in the future.

Visual of Does Handwriting Matter Anymore?

Does Handwriting Matter Anymore?

The personal touch of pen and ink VERSUS the efficiency and productivity of digital word processors.

Visual of Technology Made us Human

Technology Made us Human

Buckle up for a cinematic espresso shot from performance philosopher and NNN ambassador Jason Silva.

Visual of Human Furniture

Human Furniture

This unpractical yet not less pretty anthropomorphic furniture piece was created by photographer David Blazques . We are clueless on whether it is in permanent use, yet it serves …

Visual of I Want Wings!!!!!!!!!!!!!!

I Want Wings!!!!!!!!!!!!!!

Read Nicholas Carr's essay on the transhumanist dream of having wings.

Visual of The World Without Technology

The World Without Technology

I remember the smoke the most. That pungent smell permeating the camps of tribal people. Everything they touch is infused with the lingering perfume of smoke – their food, …

Visual of Hello, superorganism

Hello, superorganism

When I was a kid, my parents took me to the beach every summer. We’d swim in the ocean and play on our inflatable raft in the surf. When the tide was low, I’d build a sand castle …

Visual of The Playboy Interview

The Playboy Interview

In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …

Visual of Anthropomorphobia

Anthropomorphobia

Are you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …

Visual of Interview Mark Wigley:

Interview Mark Wigley: "We are living in an ecology of antenna"

With the invention of the radio antenna in the late 19th century, we became a different species: Introducing the human insect. A species, able to communicate across oceans using …

Visual of An Ecstatic Dialogue with Richard Doyle

An Ecstatic Dialogue with Richard Doyle

When techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …

Visual of Interview: Bruce Sterling on the Convergence of Humans and Machines

Interview: Bruce Sterling on the Convergence of Humans and Machines

We had the honor of hosting Bruce Sterling in our Next Nature Network headquarters to talk to him about the concept of the convergence of humans and machines.

Visual of The Coronation

The Coronation

For years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …

Visual of Curator Gène Bertrand on design for human needs

Curator Gène Bertrand on design for human needs

Nature has always been a source of inspiration for many artists and designers, yet the urgency to connect to nature is more pressing than ever. Environmental issues such as …

Visual of Lucas Foglia's photography explores the uneasy relationship between humans and nature

Lucas Foglia's photography explores the uneasy relationship between humans and nature

There’s no place on earth untouched by human activity: This was clear as Lucas Foglia whizzed across the vast, white expanse of Alaska's Juneau Ice Field last summer. He was …

Visual of Interview: Agi Haines, Speculative Artist Who Wants to Redesign the Human Body

Interview: Agi Haines, Speculative Artist Who Wants to Redesign the Human Body

Speculative designer Agi Haines' work focuses on (re)designing the human body, and speculates upon future scenarios.

Visual of Making an AI supermarket with Nonhuman Nonsense

Making an AI supermarket with Nonhuman Nonsense

What does the supermarket of the future look like? The Embassy of Food at Dutch Design week.

Visual of Reconnecting with wildlife through biodiverse meditations

Reconnecting with wildlife through biodiverse meditations

Sleep and dream like a koala, relax under biodiversity and feel the meditative effect of artificial wildlife.

Visual of Should we clone Neanderthals?

Should we clone Neanderthals?

If Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …

Visual of Next Generation: AI meets human creativity in Sofia Crespo's Neural Zoo

Next Generation: AI meets human creativity in Sofia Crespo's Neural Zoo

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here?  Get in touch …

Visual of Colonizing Mars: Not with humans, but plants

Colonizing Mars: Not with humans, but plants

The idea of colonizing Mars has become the big speculative future of humanity on Earth. But, artist Alexandra Daisy Ginsberg has radically different ideas to contribute to the …

Visual of Did Booze Make Us Modern?

Did Booze Make Us Modern?

A psychiatrist argues that beer gave us civilization - but do intoxicants play a deeper evolutionary role than that?

Visual of Interview: Floris Kaayk, the Visionary Creative Mind Behind Human Birdwings

Interview: Floris Kaayk, the Visionary Creative Mind Behind Human Birdwings

Floris Kayak discusses online hoaxes and the future of technology.

Visual of Bio-Printer Creates Living Body Parts

Bio-Printer Creates Living Body Parts

Bioprinter creates bespoke lab-grown body parts for transplant.

Visual of Next Generation: Demonstrating non-human narratives with Lindsey Bundel

Next Generation: Demonstrating non-human narratives with Lindsey Bundel

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Beijing's dust storm: part humans, part nature

Beijing's dust storm: part humans, part nature

The skies in Beijing turned orange recently, thanks to what was widely reported as a massive sandstorm . The problem, at least in terms of public health, is that it was not …

Visual of Enter the Symbiocene

Enter the Symbiocene

What if we would use the idea of symbiosis as the basis for the next period of Earth’s history?

Visual of The future infrastructure of the blockchain might be green and humane

The future infrastructure of the blockchain might be green and humane

The connection we share through the Internet has laid the foundation for a whole new digital infrastructure, in which blockchain technology is heralded by many believers for being …

Visual of People would rather give up sex and vacations than their smartphones

People would rather give up sex and vacations than their smartphones

Did you know that some Dutch people are so addicted to their devices that they'd rather give up sex, vacations, or even a finger than their phone?

Visual of This book explains why cooking food was essential to human evolution

This book explains why cooking food was essential to human evolution

A must-read to the Next Nature fan: Catching Fire: How Cooking Made Us Human (2009). Written by British primatologist Richard Wrangham, the author shares his hypothesis that …

Visual of Cooling buildings with ultra-white paint

Cooling buildings with ultra-white paint

From icy tundras to billowing clouds, the colour white crops up repeatedly in our planet’s palette. This colour provides a natural way for light from the sun to reflect back from …

Visual of A Stroll Through the Bubbles of Chemicals and Men

A Stroll Through the Bubbles of Chemicals and Men

A stunning pre-history of the anthropocene

Visual of Technology: Intrusive or Supportive?

Technology: Intrusive or Supportive?

Is the use of personal devices becoming a replacement for the spectrum of emotions that make us all humans?

Visual of Browse the Catalog For The Post-Human

Browse the Catalog For The Post-Human

Augment your physiology. Enhance your prospects. From neuro-electronics, to robotic-prosthetics and mind-altering pharmaceuticals.

Visual of Earth is so strongly impacted by its human inhabitants that it's now a “hybrid planet”

Earth is so strongly impacted by its human inhabitants that it's now a “hybrid planet”

Humanity has for a long time considered itself the most important species on the planet. We are quite happy to share the world with other species, but we think we know who's in …

Visual of Cyborgnest: redefining human senses

Cyborgnest: redefining human senses

Nature provided humans with an extensive set of sensory modalities, allowing our brain to constantly gather sundry inputs from the outer world. These sensory inputs help us …

Visual of How China is enjoying blue skies — thanks to the coronavirus

How China is enjoying blue skies — thanks to the coronavirus

Surrounded by greyness and with the air around you having a dusty, burnt taste; for a long time this is what it has been like to live in many of the world’s highly polluted …

Visual of Making King's Day More Sustainable

Making King's Day More Sustainable

On King's Day the water board of Amsterdam wants to collect urine and use it as fertilizer.

Visual of Next Generation: VR creator Bas Jansen asks, is there a place for humans?

Next Generation: VR creator Bas Jansen asks, is there a place for humans?

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here?  Get in touch  and …

Visual of Ouroboros Steak: Producing meat using human cells

Ouroboros Steak: Producing meat using human cells

You are what you eat; a quite common message in the midst of our self-growth society. We have to eat well to become the best version of ourselves - more productive, healthier …

Visual of Can AI become addicted?

Can AI become addicted?

In 1953, a Harvard psychologist thought he discovered pleasure – accidentally – within the cranium of a rat. With an electrode inserted into a specific area of its brain, the rat …

Visual of Breaking Language Barriers

Breaking Language Barriers

We have witnessed significant progresses in the field of real-time translation, and this new wearable translator, called ili, sums up perfectly this essence.

Visual of Madrid's Future Is Greener than Ever

Madrid's Future Is Greener than Ever

Madrid's new plans to fight rising temperatures and high pollution rates investing on green urban areas.

Visual of An Edible Drone for Humanitarian Aid

An Edible Drone for Humanitarian Aid

Nigel Gifford is developing a drone that will be relatively inexpensive, disposable and edible.

Visual of Pyramid of Technology: How technology becomes nature in seven steps

Pyramid of Technology: How technology becomes nature in seven steps

How technology becomes nature in seven steps

Visual of Better than the real thing

Better than the real thing

Take a bite from this pear and I'll spare you all the default connotations with the apple of eden. Source photo by Pablo Montanez . See also Modernistic Watermelon , Ferrari …

Visual of Controlling Human Odour

Controlling Human Odour

The ultimate personal hygiene product, feces odor tablets, is another Japanese innovation sold by the Takano Yori Beauty Clinic . These pills promise to make your excrement …

Visual of Solving Crimes Thanks to Amazon Echo

Solving Crimes Thanks to Amazon Echo

Amazon's Echo smart speaker may have witnessed a murder. But will it talk?

Visual of Watch: BBC reports on world's first artificial womb for humans

Watch: BBC reports on world's first artificial womb for humans

Now that the team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …

Visual of Human Swarms

Human Swarms

A video showing a small intersection in India. It's hypnotic .

Visual of 'Fiji Water' Is Purer than Tap Water, No?

'Fiji Water' Is Purer than Tap Water, No?

Researchers tested 'Fiji Water' against ordinary tap water. What they found is kind of shocking.

Visual of Simulacra and Simulations

Simulacra and Simulations

The simulacrum is never that which conceals the truth--it is the truth which conceals that there is none. The simulacrum is true. -Ecclesiastes If we were able to take as the …

Visual of Nurturing Architecture

Nurturing Architecture

The way we currently build is not sustainable. We will have to develop a sustainable living environment that matches our human needs, intuitions and potential.

Visual of Time Between Emergence and Design

Time Between Emergence and Design

Previously, experiences of time emerged from nature as given – offering seasons, the rhythm of humans, plants and animals. Nowadays, people integrate nature-time, body-time, inner-time, clock-time, and global 24/7 systems-time. Human beings, in past, current and next natures, have to deal with emergence and design of time in order to survive.

Visual of Next Generation: Exploring the vegetal cyborg with Marie Declerfayt

Next Generation: Exploring the vegetal cyborg with Marie Declerfayt

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here?  Get in touch  and …

Visual of Interview: Curator Ilari Laamanen on Momentum9, the Nordic Biennial

Interview: Curator Ilari Laamanen on Momentum9, the Nordic Biennial

We recently spoke to Ilari Laamanen, to peel the outcrops of Momemtum9, and unveil the overlapping themes to the next nature philosophy.

Visual of Why I'm turning my son into a cyborg

Why I'm turning my son into a cyborg

Imagine if everyone spoke a language that you don’t understand. It’s not a foreign language–it’s been spoken around you since the day you were born–but where as everyone else …

Visual of Ecology – A New Opium for the Masses

Ecology – A New Opium for the Masses

Marxist philosopher Slavoj Žižek discusses the 'naturalization' of capitalism and how ecology became a new field of capitalist investment. He also argues that the ultimate …

Visual of Next Generation: Shaping intimacy through objects with Pleun van Dijk

Next Generation: Shaping intimacy through objects with Pleun van Dijk

Pleun van Dijk is a speculative artist/designer who investigates the intimate relationship between human and technology.

Visual of Billionaire space race: the ultimate symbol of capitalism's obsession with growth

Billionaire space race: the ultimate symbol of capitalism's obsession with growth

Mars ain’t the kind of place to raise your kids, laments the Rocket Man in Elton John’s timeless classic. In fact, it’s cold as hell. But that doesn’t seem to worry a new …

Visual of Next Nature Interview

Next Nature Interview

For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …

Visual of The Golden Quarter

The Golden Quarter

Some of our greatest cultural and technological achievements took place between 1945 and 1971. Why has progress stalled?

Visual of Microbiocene: A microbiological archeology of the future

Microbiocene: A microbiological archeology of the future

In configuring our next nature, artists and scientists explore new languages that move beyond the Anthropocene - the era of human beings. These semantics would bridge the gap …

Visual of Yes, Naturally

Yes, Naturally

The introductory essay from the Yes, Naturally book - available in our store!

Visual of An introduction to Biomimicry

An introduction to Biomimicry

The first time I explained biomimicry to a stranger was not in a talk or a workshop but in a big-box bookstore just after Biomimicry: Innovation Inspired by Nature had come out. I …

Visual of There’s Plenty of Room at the Bottom

There’s Plenty of Room at the Bottom

So you’re triggered by our call for products and now you’re considering to send in one, two or maybe three of your brilliant products for the Nano Supermarket? Good. Or – and this …

Visual of From Eco-Apartheid to Earth Democracy

From Eco-Apartheid to Earth Democracy

Do humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.

Visual of Next Generation: Experiencing neo-robophilia with Hye Hyun Song

Next Generation: Experiencing neo-robophilia with Hye Hyun Song

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture

Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture

Rachel Armstrong discusses living buildings, Venice's foundations, millennial nature and how to improve our future.

Visual of The Anthropocene Explosion

The Anthropocene Explosion

We have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.

Visual of Intimate Technology: the Battle for Our Body and Behaviour

Intimate Technology: the Battle for Our Body and Behaviour

Technology is nestling itself within us and between us, has knowledge about us and can act just like us.

Visual of Next Generation: Writing a design manifesto with Pleun Wilting

Next Generation: Writing a design manifesto with Pleun Wilting

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Towards a global society as a superorganism

Towards a global society as a superorganism

Today we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …

Visual of Love your monsters

Love your monsters

Why we must care for our technologies as we do our children.

Visual of Next Nature and the Curse of Oil

Next Nature and the Curse of Oil

The next step is to embrace and celebrate how cultural artifacts are escaping control, becoming autonomous, and forming the “next nature”.

Visual of Real Nature is not Green

Real Nature is not Green

At the edge of the woods along the motorway near the Dutch town of Bloemendaal, there stands a mobile telephone mast disguised as a pine tree. This mast is not nature: at best, it …

Visual of ‘Optimism is our duty’: A conversation with Koert van Mensvoort

‘Optimism is our duty’: A conversation with Koert van Mensvoort

We live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …

Visual of Growth is not the problem, but the solution

Growth is not the problem, but the solution

If we want to bring down global CO2 emissions to zero, we will need technological innovation and massive infrastructure projects.

Visual of Next Generation: Sensing the critical zone with Menno Brouwer

Next Generation: Sensing the critical zone with Menno Brouwer

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of Exploring Next Nature (2004)

Exploring Next Nature (2004)

The first essay ever written on Next Nature, published in Next Nature Pocket and in Entry Paradise, New Design Worlds . ( download pdf ) (German version: Erkundungen im Nächste …

Visual of Moon Gallery: the first museum in space

Moon Gallery: the first museum in space

The Moon Gallery aims to set up the first permanent museum on the Moon. Soon launching to the International Space Station, full of ideas worth sending to the Moon. The gallery is …

Visual of Inverting the energy paradigm with Charles Eisenstein

Inverting the energy paradigm with Charles Eisenstein

Energy policy blah blah blah, life cycle analysis blah blah blah, energy return on energy invested, peak oil, carbon footprint, renewables, hydro, nuclear, blah blah blah blah …

Visual of Interview: Mike Thompson and Susana Cámara Leret, Designers Exploring Alternative Ways of Thinking & Doing

Interview: Mike Thompson and Susana Cámara Leret, Designers Exploring Alternative Ways of Thinking & Doing

Interview with Mike Thompson and Susana Cámara Leret.

Visual of How can Big History help us think about the future?

How can Big History help us think about the future?

'Big History' is a multidisciplinary study that seeks to put the human story into the context of a 13.8 billion-year story from the Big Bang to now.

Visual of It could be time to start thinking about a cybernetic Bill of Rights

It could be time to start thinking about a cybernetic Bill of Rights

Like it or loathe it, the robot revolution is now well underway and the futures described by writers such as Isaac Asimov , Frederik Pohl and Philip K. Dick are fast turning from …

Visual of Breaking Point?

Breaking Point?

John Zerzan, published in Green Anarchy issue #24 - Spring/Summer 2007 The rapidly mounting toll of modern life is worse than we could have imagined. A metamorphosis rushes …

Visual of A Society of Simulations

A Society of Simulations

An interviewer once asked Pablo Picasso why he paints such strange pictures instead of painting things the way they are. Picasso asks the man what he means. The man then takes out …

Visual of Next Nature Introduction

Next Nature Introduction

This project - the Next Nature Network - is about Nature's brand image. One might surmise that "Nature," being 100 percent all-natural, can't have any brand image.  The facts …

Visual of Next Generation: Get to know Valerie Daude

Next Generation: Get to know Valerie Daude

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of On the prehistoric origins of modern sexuality

On the prehistoric origins of modern sexuality

Let’s talk about the most controversial of "m words"—monogamy. And let’s have this conversation with in mind its prehistoric origins. Our modern picture of prehistoric societies …

Visual of Next What?

Next What?

In this essay, anti-civilization, anarchist philosopher John Zerzan critiques the concept of 'next nature.' He argues that rather than freeing us, our self-domestication through …

Visual of Interview: Pauline Van Dongen, Designer Merging Fashion and Technology

Interview: Pauline Van Dongen, Designer Merging Fashion and Technology

Dutch fashion designer specialized in wearable technology, Pauline van Dongen researches the human body in relation to its surroundings.

Visual of Getting rid of that bit of unspoiled green

Getting rid of that bit of unspoiled green

There it is. A hefty hen, with its head up high and its beak out. And a gigantic VR headset over its beady little eyes. What does this battery hen see? ‘An experience of a free …

Visual of Next Generation: Pei-Ying Lin is cooking with viruses

Next Generation: Pei-Ying Lin is cooking with viruses

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here?  Get in touch  and plot your …

Visual of Moral Shortcomings in the Technology Debate

Moral Shortcomings in the Technology Debate

Digital and genetic techniques increasingly influence life. Our belief in progress through technology stands in the way of a moral debate on this development. By Rinie van Est We …

Visual of What’s the Point If We Can’t Have Fun?

What’s the Point If We Can’t Have Fun?

Since Darwin we tend to look at the biological world exclusively in economical terms. The idea that monkey's, frogs, or even ants do more than simply propagate, doesn't find much acceptance among scientists. And yet, even crayfishes at times seem to displace objects just for fun.

Visual of Could Biomimicry Help us Solve the Refugee Crisis?

Could Biomimicry Help us Solve the Refugee Crisis?

From nutrients within an organism, to organisms within collectives, to populations within a territory and so on - nature offers models on how to deal with highly complex systems.

Visual of The Enlightenment Is Dead, Long Live the Entanglement

The Enlightenment Is Dead, Long Live the Entanglement

We humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.

Visual of Faustian Bargains and Pineapple Shampoo

Faustian Bargains and Pineapple Shampoo

Since the early days of the net, the electronic pastoral has lent itself to all sorts of dubious agendas pushed by science, the military and even libertarian tendencies. In the …

Visual of Totem Animals for the Anthropocene

Totem Animals for the Anthropocene

Invasive species become the animal symbols for a man-made world.

Visual of But will lab-grown meat be kosher?

But will lab-grown meat be kosher?

Read Benjamin Aldes Wurgaft's essay on judaism in relation to the production of laboratory-grown meat.

Visual of Interview: Leanne Wijnsma, Designer for the Instinct Who Uses Smell as Medium

Interview: Leanne Wijnsma, Designer for the Instinct Who Uses Smell as Medium

Dutch experience designer Leanne Wijnsma designs for the human instinct and puts the sense of smell back to where it belongs, as modern hazards have shifted to the digital realm.

Visual of Next Nature reading list

Next Nature reading list

Ten books that continue to inspire the next nature philosophy—gathered for you to read this summer.

Visual of Are we living in a superorganism?

Are we living in a superorganism?

The coverstory of Next Nature Magazine investigates how the rise of virtual influencers on social media reveals a superorganism.

Visual of The Carnery - A Cultured Future with In Vitro Meat

The Carnery - A Cultured Future with In Vitro Meat

In vitro meat has the capacity to transform meat production as we know it, introducing an entirely new way of thinking about and interacting with food.

Visual of Interview: Liam Young on Speculative Architecture and Engineering the Future

Interview: Liam Young on Speculative Architecture and Engineering the Future

Interview with Liam Young on his work in speculative architecture, the future, and our role in nature as humans.

Visual of Five must-see exhibitions before 2020

Five must-see exhibitions before 2020

A large-scale asian food market serving in vitro meat, a transatlantic expo on the future of nature and a travelling exhibition that explores our relationship with AI. These five …

Visual of Why physical distancing feels so unnatural to us

Why physical distancing feels so unnatural to us

For many people, the most distressing part of the coronavirus pandemic is the idea of social isolation. If we get ill, we quarantine ourselves for the protection of others. But …

Visual of The prehistoric importance of trading technology

The prehistoric importance of trading technology

Then, as now, one person could literally change the course of history, with nothing more than an idea.

Visual of Organs from genetically engineered pigs may help shorten the transplant wait list

Organs from genetically engineered pigs may help shorten the transplant wait list

Demand for life-saving organ transplantation is at an all-time high. In 2021, a record 41,000-plus organ transplants were performed in the U.S., with top numbers for kidney, liver …

Visual of The Uncanny Valley of the Pussycat Dolls

The Uncanny Valley of the Pussycat Dolls

Make no mistake, you're not looking at the latest Barbie line: These are the The Pussycat Dolls. Formerly an LA stripper show burlesque show, now upgraded to be pop music …

Visual of We Domesticated Ourselves

We Domesticated Ourselves

Our bodies are maps of our ancestor's social lives.  We evolved, physically and behaviorally, in incredibly complex social groups.  Such intense sociability may have favored the …

Visual of Can microbes communicate with alien species?

Can microbes communicate with alien species?

Are we alone in the universe? The famous Seti (Search for Extraterrestrial Intelligence) programme has been trying to answer this question since 1959. American astronomer Carl …

Visual of Embassy of Health: Designing a chronically healthy society

Embassy of Health: Designing a chronically healthy society

How will we stay healthy in the future? Can we utilize the power of design to move towards a more healthy society?

Visual of The GeneSprout Initiative: cultivating new plant breeding techniques

The GeneSprout Initiative: cultivating new plant breeding techniques

Some 10,000 years ago humans began to domesticate plants and animals. The birth of agriculture, one of the earliest technologies available.

Visual of Next Generation: Designing ecosystems of technology with Maike Gebker

Next Generation: Designing ecosystems of technology with Maike Gebker

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Face the future of intimacy with Kiiroo

Face the future of intimacy with Kiiroo

Meet the teledildonics, an ingenious species of bi-directionally controlled sextoys from the future, available today. These touch emulating vibrators find each other on social sex …

Visual of Seeking Symbiosis

Seeking Symbiosis

Visual artist Heleen Blanken explores the complex relationship between people, nature and technology.

Visual of Out of Control

Out of Control

The Made and the Born: Neo-Biological civillization, written by Kevin Kelly, excerpt from Out of Control : The New Biology of Machines, Social Systems and the Economic World, …

Visual of Razorius Gilletus – On the Origin of a Next Species

Razorius Gilletus – On the Origin of a Next Species

Is the evolution of the single bladed razor into an exorbitant five–bladed vibrating gizmo the outcome of human needs, or is there another force in play? Say hello to Razorius …

Visual of The Story of our Food

The Story of our Food

Every time we eat a piece of food, we take a bite out of the world. All these small bites tell a dozen stories. A carton of eggs presents the story of contented hens, a bottle of …

Visual of In Vitro Meat: Animal Liberation?

In Vitro Meat: Animal Liberation?

Many people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.

Visual of Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society

Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society

We recently talk to Nadine Bongaerts about the role and impact of synthetic biology, the gap between bio­sciences and society and the importance of communication to overcome the fear of new technologies.

Visual of Your Next Nature guide to Dutch Design Week 2018

Your Next Nature guide to Dutch Design Week 2018

Over time, our bodies, our food and our environment have become more and more subject to design. As designers, we hold the responsibility and have the unique chance to envision …

Visual of The 21th Century Paradigm

The 21th Century Paradigm

The history of art through the ages reveals a constancy that, by conscious or unconscious applications, provides us with an omnipresent correlation dealing with the …

Visual of Innovative Nostalgia

Innovative Nostalgia

We humans simply feel more comfortable with technological change when it comes in a familiar form that refers to an existing and accepted object, habit, value, tradition or intuition.

Visual of Nature through the Windshield

Nature through the Windshield

Volume magazine interviews Next Nature founder Koert van Mensvoort.

Visual of On the origin of the word processor

On the origin of the word processor

Writing is recognised as one of mankind’s foremost inventions and the mechanization of writing is one of these developments that typify what is commonly regarded as the work of …

Visual of Suzanne Lee wants to live in a sustainable material world. Built with biology, not oil

Suzanne Lee wants to live in a sustainable material world. Built with biology, not oil

Biotechnology is nearly as old as humanity itself. The food you eat and the pets you love? You can thank our ancestors for kickstarting the agricultural revolution, using …

Visual of How a museum encourages its visitors to examine their relationship with their environment

How a museum encourages its visitors to examine their relationship with their environment

Last month I had the opportunity to immerse myself in Tokyo’s newly opened digital art landscape, the Mori Digital Art Museum. The museum stands out for it enables virtual …

Visual of Welcome to the CRISPR baby world—here’s what you should know

Welcome to the CRISPR baby world—here’s what you should know

Last week, the gene editing world was hit by news the equivalent of a nuclear bomb. In a video on YouTube , Dr. Jiankui He at Southern University of Science and Technology in …

Visual of Driverless and electric, or car-free? How cities are cutting out cars, and why

Driverless and electric, or car-free? How cities are cutting out cars, and why

It’s common consensus in the tech industry that the days of cars as we know them—powered by gas, driven by humans, and individually owned by all who want and can afford one—are …

Visual of On the origin of the LED lamp

On the origin of the LED lamp

For thousands of years people used oil lamps and candles to illuminate their homes during the hours of darkness. Neither produced much light and both were inconvenient in use as …

Visual of Next Generation: Louise Silfversparre illustrates the remains of the Anthropocene

Next Generation: Louise Silfversparre illustrates the remains of the Anthropocene

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of In conversation with cyborg musician Kai Landre

In conversation with cyborg musician Kai Landre

What does the merge of bodies and technology mean for the human? For cyborg Kai Landre, cybernetic extensions become body parts and not technology. Kai began his transition to a …

Visual of The Biosphere Code Manifesto

The Biosphere Code Manifesto

During the event The Biosphere Code, Stockholm University researcher Victor Galaz and colleagues outlined a manifesto for algorithms in the environment.

Visual of Fellow Day: Next Senses

Fellow Day: Next Senses

On June 17th a NNN Fellow Day was organized to explore the future project: Next Senses.

Visual of In conversation with Jalila Essaïdi

In conversation with Jalila Essaïdi

What do in-vitro human skin, spider silk and cow manure have in common? They are all unlikely materials that can cloth, protect and inspire humans, as realized by award-winning …

Visual of Interview: Pirjo Kääriäinen on collaboration and the new ecological biomateriality

Interview: Pirjo Kääriäinen on collaboration and the new ecological biomateriality

Meet Pirjo Kääriäinen, professor of design driven fibre innovation at Aalto University, Finland. Kääriäinen founded CHEMARTS —a collaborative program at the university that brings …

Visual of POND: A symphony of lights and water

POND: A symphony of lights and water

Have you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …

Visual of How future fashion could help us cope with isolation

How future fashion could help us cope with isolation

Today we cannot meet, touch or hug our loved ones. And while we all like the feeling of the touch of another human being, physical contact does not just feel nice, it is crucial …

Visual of Check your Technoprivilege

Check your Technoprivilege

Technology is not neutral; the same tech might empower some and disempower others. It is time to check our Technoprivilege, argues author Hendrik-Jan Grievink.

Visual of Sonograms of planet earth

Sonograms of planet earth

Technology can help us to connect with our surroundings. Think about the microscope: it revealed ecosystems beyond our visual reach allowing us to look at the smallest inhabitants …

Visual of Entryparadise

Entryparadise

Written by Werner Lippert & Peter Wippermann, Curators of the Entryparadise exhibition (26/8 until 3/12, 2006, at Kohlenwäsche, Zollverein) Design is about to undergo a …

Visual of Back to the Tribe

Back to the Tribe

Traditionally, technology is seen as a force that diminishes our instincts and puts us at a distance of nature. Increasingly however, we realize technology can also energize and …

Visual of The AI Revolution Is On

The AI Revolution Is On

Steven Levy writes in Wired on the unexpected turn of the Artificial Intelligence revolution: rather than whole artificial minds, it consists of a rich bestiary of digital fauna, …

Visual of The NBIC Convergence: When Machines and Matter ‘Have Sex’

The NBIC Convergence: When Machines and Matter ‘Have Sex’

The Singularity , as popularized by Ray Kurtzweil, refers to a near term, theoretical time when machine intelligence greatly surpasses our own. At this point we will experience a …

Visual of Artifice Earth: Adam Rutherford on the Promises of Synthetic Biology

Artifice Earth: Adam Rutherford on the Promises of Synthetic Biology

An interview about the history and promises of synthetic biology, and the problem with the word "nature".

Visual of What Ant Colony Networks Can Tell Us About What’s Next for Digital Networks

What Ant Colony Networks Can Tell Us About What’s Next for Digital Networks

Ever notice how ant colonies so successfully explore and exploit resources in the world … to find food at 4th of July picnics, for example? You may find it annoying. But as an …

Visual of No Future for Traditional Meat

No Future for Traditional Meat

At Home in the Lab with Mark Post, Father of the In Vitro Hamburger. Interview from The In Vitro Meat Cookbook

Visual of Designer Govert Flint applies motion to everyday life

Designer Govert Flint applies motion to everyday life

Interview with Govert Flint, designer, architect and self-taught artist.

Visual of The future of the ECO Coin

The future of the ECO Coin

How can we design a cryptocurrency for the better of humanity and ecology? In this last chapter of the crypto deep dive series , we will dissect two kinds of blockchain …

Visual of I like my steak lab-grown, not-grass fed

I like my steak lab-grown, not-grass fed

Right now, somewhere in a laboratory in California, the Netherlands or Japan, a technician is taking a few thousand skeletal muscle cells from a living animal, and placing them in …

Visual of Next Generation: The speculative futures of Deborah Rhyner

Next Generation: The speculative futures of Deborah Rhyner

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of Nine creatives in biotech you need to know right now

Nine creatives in biotech you need to know right now

The field of biofabrication is still new to most people. As founder and CEO of Biofabricate, Suzanne Lee shared with us this exciting online event series Creatives in Biotech . If …

Visual of Next Generation: Designing ecological webs with Miriam Lellek

Next Generation: Designing ecological webs with Miriam Lellek

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Next Senses

Next Senses

Next Senses explores the unchartered territory of how we could experience the world with technology

Visual of Information Decoration: Our Environment as an Information Carrier

Information Decoration: Our Environment as an Information Carrier

Picture this: it's 40,000 years ago, and you are an early Homo sapiens. You are standing on the savanna. Look around you. What do you see? No billboards, no traffic signs, no …

Visual of Can Life Be a Technology?

Can Life Be a Technology?

In 2009 the Initiative for Science, Society and Policy coined the phrase ‘living technology’ [1] to draw attention to a group of emerging technologies that are useful because they …

Visual of Living Among Pests – Designing the Biosynthetic City

Living Among Pests – Designing the Biosynthetic City

Joyce Hwang discusses the challenges for designers, and gains for citizens, of living in a truly biosynthetic city.

Visual of Conversation with Dutch Philosopher Bas Haring: Robot, Colleague or Foe?

Conversation with Dutch Philosopher Bas Haring: Robot, Colleague or Foe?

We talked with Bas Haring to discuss the conception, image and will of the robot. Read our conversation with him and update your ideas about robots.

Visual of How AI and genomics will impact the future of making babies

How AI and genomics will impact the future of making babies

As if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …

Visual of People are less likely to turn a robot off if it asks them not to

People are less likely to turn a robot off if it asks them not to

A team of German researchers published  a study  earlier this week indicating people can be duped into leaving a robot turned on just because it “asks” them to. The …

Visual of What we can learn from 'The Social Dilemma'

What we can learn from 'The Social Dilemma'

Is social media ruining the world? Dramatic political polarization. Rising anxiety and depression. An uptick in teen suicide rates. Misinformation that spreads like wildfire. The …

Visual of Next Generation: Exploring cybernetic ecologies with Marie Walker-Smith

Next Generation: Exploring cybernetic ecologies with Marie Walker-Smith

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Little Green Cows

Little Green Cows

The world is alight with algae fever. In this age of deep ecological design aspirations, the range of speculative design projects based on algae technology is growing. Algae are …

Visual of Interview: Alexandra Daisy Ginsberg, Designer and Synthetic Biology Expert

Interview: Alexandra Daisy Ginsberg, Designer and Synthetic Biology Expert

An interview with Daisy Ginsberg, artist and synthetic biologist.

Visual of You Can Never Go Back To Nature

You Can Never Go Back To Nature

One of the arguments that environmentalists use against factory farming and burning fossil fuels is that these activities are "unnatural" or that they "go against nature." But …

Visual of Diseases Of The Future

Diseases Of The Future

Nowadays humans suffer from diseases that didn't exist in the past, a trend that will probably continue into the future. A wide range of new disorders, especially related to the …

Visual of ECO Coin Award Interviews: Shubhendu Sharma

ECO Coin Award Interviews: Shubhendu Sharma

We asked Shubhendu Sharm, our first ECO coin award nominee about his method, business and hopes for the future.

Visual of Adding a new dimension to marine restoration: 3D printing coral reefs

Adding a new dimension to marine restoration: 3D printing coral reefs

The local fishermen looked on skeptically. From the deck of a small motorboat, scuba divers grabbed odd chunks of ceramic – which could be described as rocky brains stuck on …

Visual of Aleph Farms wants to bring clean meat from the lab to the next farming industry

Aleph Farms wants to bring clean meat from the lab to the next farming industry

Growing meat artificially, instead of within an animal, may soon be an available reality. Meet one of the pioneering developers of this product of the future: Aleph Farms. With …

Visual of On the origin of the e-bike

On the origin of the e-bike

The oldest known serious candidate forerunner for the bicycle is the ‘running machine’ built by the German Baron Karl von Drais. His two-wheeled machine became known as the …

Visual of How AI is reshaping electronic music

How AI is reshaping electronic music

The idea that AI can compose electronic music may sound a little off to people. It raises essential questions about creativity as a product exclusive to humans: can an AI be …

Visual of Next Generation: Why Annie Larkins' egg project is essential for future food thinking

Next Generation: Why Annie Larkins' egg project is essential for future food thinking

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of What's solar geoeneering and why is it controversial?

What's solar geoeneering and why is it controversial?

A report from 2021 from the National Academies of Sciences, Engineering and Medicine tackles a controversial question : Is solar geoengineering – an approach designed to cool the …

Visual of Enter the memesphere

Enter the memesphere

Why memes might be the next tool to make sense of on our increasingly hybrid virtual and physical environment.

Visual of Virtual Money Is a Pleonasm

Virtual Money Is a Pleonasm

Have you heard the buzz on virtual money in online games? Some years ago the first virtual millionaire was announced, yet there have also been reports on people being practically …

Visual of Manko & Life [#8]

Manko & Life [#8]

Manko sighed. Nada: 'Did you like it?' Manko: 'I have to admit that if this is the starter, I'm not sure I'll survive the main course.' Everyone at the table laughed. Manko: 'Let …

Visual of The Technological Sublime

The Technological Sublime

The sublime is an aesthetic concept of 'the exalted,' of beauty that is grand and dangerous. Through 17th and 18th century European intellectual tradition, the sublime became …

Visual of Interview: Suzanne Lee, Fashion Innovator Who Grows Clothing in the Laboratory

Interview: Suzanne Lee, Fashion Innovator Who Grows Clothing in the Laboratory

We recently talked with Suzanne Lee about the textile industry and technology, growing leather in the lab, and the use of new alternative materials in the future of fashion.

Visual of Watch out for Bullied Robots

Watch out for Bullied Robots

Dystopian future scenarios filled with evil robots are everywhere. We are afraid of robots treating us badly, but what will happen if it'll be the other way around? According to …

Visual of Designer Dave Hakkens is putting plastic waste to better use

Designer Dave Hakkens is putting plastic waste to better use

We recently handed this year’s ECO Coin Award to Dutch designer Dave Hakkens, founder of the Precious Plastic movement. With his open sourced recycling machines, he provides people around the world the knowledge to start recycling plastic locally.

Visual of The Robots Are Coming!

The Robots Are Coming!

Robots are getting stronger and smarter every day. They are taking over our whole lives. How long will I have my job before a robot steals it?

Visual of Maurizio Montalti talks nature’s cycle of life

Maurizio Montalti talks nature’s cycle of life

As modern humans, we are out of balance with our natural environment. With use of technology, we try to prolong our human lifespan and create materials that live longer than we …

Visual of Why half of the world's beaches could disappear by 2100

Why half of the world's beaches could disappear by 2100

Up to half of the world’s sandy beaches are at risk of disappearing by the end of this century if no action is taken to limit greenhouse gas emissions. That’s according to a new …

Visual of Next Generation: The virtual infinity of Scarlett Yang

Next Generation: The virtual infinity of Scarlett Yang

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of ECO Currency – A Proposal to Balance Economical and Environmental Value

ECO Currency – A Proposal to Balance Economical and Environmental Value

Imagine we would have an alternative monetary currency for environmental value. Would the rain forest still be destroyed if there existed an ECO–currency to express its value and …

Visual of Can This Virtual World Save the Real One?

Can This Virtual World Save the Real One?

A Dutch artist designs a Utopian eco-socialist online society.

Visual of Seven Future Visions on In-Vitro Meat

Seven Future Visions on In-Vitro Meat

Before we can decide if we will ever be willing to eat in-vitro, we need to explore the food culture it will bring us.

Visual of Sophia: World's First Robot with a Citizenship

Sophia: World's First Robot with a Citizenship

Sophia the Humanoid, a human-like robot in appearance and mannerisms, was granted citizenship by Saudi Arabia and became the first robot with citizenship.

Visual of Next Generation: Elissa Brunato's bio iridescent sequin shimmers with nature

Next Generation: Elissa Brunato's bio iridescent sequin shimmers with nature

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here?  Get in touch …

Visual of Interview: Patricia Piccinini discusses her latest solo exhibition 'Embracing the Future'

Interview: Patricia Piccinini discusses her latest solo exhibition 'Embracing the Future'

Patricia Piccinini is an artist interested in the relationship between humans and non-humans, the natural and the artificial, science and storytelling. Working with silicone, …

Visual of Why we need to get better at predicting space weather

Why we need to get better at predicting space weather

The Sun is the most important source of energy for sustaining life on Earth, but it gives us a lot more than just light and heat. It also gives us solar storms.

Visual of Next Generation: Unlearning botanical narratives with Nina Škerjanc

Next Generation: Unlearning botanical narratives with Nina Škerjanc

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of How to design your future family

How to design your future family

Imagine a place called Reprodutopia. How would such a place look like?

Visual of The World is not a Desktop

The World is not a Desktop

Mark Weiser (originally written for ACM Interactions ). What is the metaphor for the computer of the future? The intelligent agent? The television (multimedia)? The 3-D graphics …

Visual of Bacteria

Bacteria "R" Us

There is a domain of creatures that diffusively encircles an entire planet. There are so many of them that they occupy every conceivable ecological niche. Yet, despite their …

Visual of Nature is Dead, Long live Nature

Nature is Dead, Long live Nature

Like we did to old nature before, we must now cultivate our technological environment.

Visual of Why Meat Grown in Labs is the Next Logical Step for Food Production

Why Meat Grown in Labs is the Next Logical Step for Food Production

Lab grown meat is part of the trajectory that agricultural technology is already following.

Visual of How animal filters unmask the estranged relation to our wild self

How animal filters unmask the estranged relation to our wild self

Would you like a dog snout, cat eyes or fluffy bunny ears? The choice is yours. Virtual selfie filters have become a widespread phenomenon on social media platforms such as …

Visual of 3D-printing food waste into tasty products

3D-printing food waste into tasty products

Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …

Visual of Beyond Biomimicry: A New Urgency

Beyond Biomimicry: A New Urgency

Designers face an unprecedented urgency to alter their methods and reprioritize their goals to address the accelerating degradation of the environment. This new …

Visual of Interview Matilde Boelhouwer: Making urban environments flower again

Interview Matilde Boelhouwer: Making urban environments flower again

Matilde Boelhouwer is a designer whose work speculates between art, design, science, biology and food. Matilde shapes this obligation into a studio which mainly focuses on the …

Visual of Jurassic World scientists still haven’t learned

Jurassic World scientists still haven’t learned

Just because you can doesn’t mean you should – real-world genetic engineers can learn from the cautionary tale. “ Jurassic World: Dominion ” is hyperbolic Hollywood entertainment …

Visual of Sónar Lisboa: a festival for body and brain

Sónar Lisboa: a festival for body and brain

Sometimes a festival can be so much more. Tapping into arts, design, and electronic and experimental music festival, Sónar Lisboa (8-10 April) is one for the body and for the …

Visual of The information age is starting to transform fishing worldwide

The information age is starting to transform fishing worldwide

People in the world’s developed nations live in a post-industrial era, working mainly in service or knowledge industries. Manufacturers increasingly rely on sensors, robots, …

Visual of How to design your (home)office

How to design your (home)office

Designer Govert Flint proposes a new office concept, entirely based on movement and play.

Visual of Douglas Coupland: A radical pessimist's guide to the next 10 years

Douglas Coupland: A radical pessimist's guide to the next 10 years

Douglas Coupland is a writer and artist based in Vancouver. For the canadian newspaper Globe and Mail, he wrote The ‘radical pessimist's guide to the next 10 years’ a dystopian …

Visual of Self–Repairing Architecture

Self–Repairing Architecture

All buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …

Visual of Next Nature Services

Next Nature Services

Intentionality separates culture from nature. A dog is intentional, a fox is not; a park is intentional, a forest is not. Since trash, ruined buildings, and automated computer …

Visual of The Cat Parasite that Sells Motorcycles

The Cat Parasite that Sells Motorcycles

The protozoa Toxoplasma gondii makes an unobtrusive home in nearly every warm-blooded species, but it's prolific life is limited: Toxo can only reproduce in cat stomachs. The …

Visual of The Sound of the Blue Canary

The Sound of the Blue Canary

Blue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …

Visual of Interview: Arne Hendriks, Researcher and

Interview: Arne Hendriks, Researcher and "Father" of The Incredible Shrinking Man

Hendriks’s activity explores the positive transformative power of creative impulses and the importance of fundamental free scientific research.

Visual of Brexit: the Cultural Climate Warms Up

Brexit: the Cultural Climate Warms Up

On the aftermath of such a historic day for Britain and the EU, it's easy to get swayed into the polarities of political discourse, particularly on social media and the Internet, where things heat up and move fast. The results of the referendum have just come out, and the Internet is already burning with tension. This is called "climate change" - just not the one you are used to hear about.

Visual of Happy Earth Day!

Happy Earth Day!

Today we celebrate Earth day, here is why.

Visual of Heart Repair with Spinach Leaves

Heart Repair with Spinach Leaves

Scientists developed a procedure to repair your heart with a spinach leaf.

Visual of The Idea for Lab-Grown Meat Was Born in a Prisoner-of-War Camp

The Idea for Lab-Grown Meat Was Born in a Prisoner-of-War Camp

The phone call was as unexpected as the American accent at the other end of the line. And when she hung up a few moments later, Ira van Eelen had to stop to catch her breath. More …

Visual of Recharge! Sun for Your Brain Cells

Recharge! Sun for Your Brain Cells

A gadget called HumanCharger promises "the sun in your pocket" to give you energy, by beaming light through your ears.

Visual of Virtual Baby Acts and Looks Impossibly Real

Virtual Baby Acts and Looks Impossibly Real

A rosy-cheeked kid learns her first words, cries when her babysitter leaves, smiles when she’s happy, but she’s not real. BabyX is an AI research-in-progress by a company named Soul Machines.

Visual of Virtual Networking, the Future Social Media

Virtual Networking, the Future Social Media

Virtual reality is already becoming a part of the conversation surrounding social media. Will it become the next popular social network?

Visual of A happy birth day to Louise Brown

A happy birth day to Louise Brown

Dear Louise Brown, On behalf of the future I would like to congratulate you on your birthday. It has been 40 years that you where born into this world on July 25th 1978, …

Visual of In Conversation with Marleen Hartjes: Introducing a digital door to the museum

In Conversation with Marleen Hartjes: Introducing a digital door to the museum

Don’t be surprised when you catch a human face on a screen strolling through the Van Abbe museum for contemporary art in Eindhoven, as these are Europe’s very first robotic …

Visual of Interview: Huub Ehlhardt on the evolution of products

Interview: Huub Ehlhardt on the evolution of products

"To understand why a product is the way it is today, you need to learn about its evolutionary background." Meet Huub Ehlhardt, an engineer with a PhD in product design . Huub …

Visual of In conversation with Teresa van Dongen, biodesigner exploring natural forms of artificial light

In conversation with Teresa van Dongen, biodesigner exploring natural forms of artificial light

There was a time when flipping the switch, and seeing a glass bulb light up, was magical to anyone in the world. Today, the presence of a light switch in a room, is something …

Visual of The next sexual revolution is going to be all about technology

The next sexual revolution is going to be all about technology

Sex is one of the most powerful, fundamental human drives. It’s caused wars, and built and destroyed kingdoms. It occupies a significant percentage of most people’s thoughts. As …

Visual of How biotechnology could shape the future of product design

How biotechnology could shape the future of product design

Humans have been manipulating living things for thousands of years. Examples of early biotechnologies include domesticating plants and animals and then selectively breeding them …

Visual of These are the 'meltwater lakes' of Antartica

These are the 'meltwater lakes' of Antartica

During the Antarctic summer, thousands of mesmerising blue lakes form around the edges of the continent’s ice sheet, as warmer temperatures cause snow and ice to melt and collect …

Visual of How climate fiction novels allow us to imagine possible futures

How climate fiction novels allow us to imagine possible futures

Every day brings fresh and ever more alarming news about the state of the global environment. To speak of mere “climate change” is inadequate now, for we are in a “ climate …

Visual of Want to build an organization that lasts? Create a superorganism

Want to build an organization that lasts? Create a superorganism

For the past 25 years, I’ve studied everything from baboon cooperation in Ethiopia and orca whale innovation in the Bering Sea, to the Argentine ant invasion in my kitchen, and my …

Visual of How my chatbot fell in love with me

How my chatbot fell in love with me

The virus is forcing all of us to sit at home. While we are allowed to have social contact—albeit at an appropriate distance, intimate contact is hard to find. How to cope with …

Visual of Blind woman sees with new implant and plays video game sent straight to her brain

Blind woman sees with new implant and plays video game sent straight to her brain

It’s been over a decade since artificial retinas first began helping the blind see. But for many people, whose blindness originates beyond the retina, the technology falls short. …

Visual of Track freshness and reduce food waste with Rui Xu

Track freshness and reduce food waste with Rui Xu

Imagine this: you wake up on a lazy Sunday morning, trudging your way to the fridge only to be welcomed with the smell of something rotting. Did the meat expire sooner than …

Visual of In conversation with cyborg choreographer Moon Ribas

In conversation with cyborg choreographer Moon Ribas

If we could extend our senses in order to perceive the planet in a deeper way, would our understanding and our behavior towards it be different? We caught up with cyborg …

Visual of Max Liboiron:

Max Liboiron: "Pollution is Colonialism"

We now live in a world where plastics are becoming a part of our marine ecosystems. As a result, we strive hard to clean the plastics from our oceans. Dr. Max Liboiron ( Michif …

Visual of How technology will help us adapt to climate change

How technology will help us adapt to climate change

Climate change will transform how we live, but these tech and policy experts see reason for optimism

Visual of Next Generation: Wandering through the post wilderness with Melissa Schwarz

Next Generation: Wandering through the post wilderness with Melissa Schwarz

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Urban Dolls

Urban Dolls

The idea of altering your body for aesthetic purposes is still somewhat frowned upon today. But more than because the very idea of improving yourself, this is about its …

Visual of Further Incredibly Shrinking Man

Further Incredibly Shrinking Man

Artist Arne Hendriks gave a lustrous talk on the possibilities of downsizing humanity to better fit the earth.

Visual of Structuring biomimicry, improving building's resiliency

Structuring biomimicry, improving building's resiliency

The same way Einstein assumes the speed of light to be a constant of reference for his Theory of Relativity, the philosophy of biomimicry assumes Nature as a constant of reference …

Visual of Robot’s Best Friend

Robot’s Best Friend

From chef, to nurse, and also lover. Get ready, a new generation of robots is going to invade our lives!

Visual of Robots Taking Government Jobs

Robots Taking Government Jobs

Meet Amelia, the first robot to work along with human coworkers in a council job.

Visual of Our Relationship with Tech Is Growing Stronger

Our Relationship with Tech Is Growing Stronger

It's getting difficult to discern what's technology and what's not.With wearable technology becoming more and more integrated into society, our lives become infused with more technology.

Visual of This artwork lets trees tell the story of climate change

This artwork lets trees tell the story of climate change

In our ongoing battle against climate change, it's hard to transcend from our human position and ‘think’ like nature. Given, nature doesn't think the way humans do, but it does …

Visual of Here’s how the Dutch are embracing blockchain in the polder

Here’s how the Dutch are embracing blockchain in the polder

Smiling broadly and rattling with enthusiasm, the 33-year-old Rylana Doesburg shows off a QR-code on her phone: an angular pattern of black and white squares. “Thanks to this …

Visual of Three scenarios for the future of farming

Three scenarios for the future of farming

Agriculture may be one of the oldest of our technologies. Over time it has developed, changed, revolutionized, industrialized - or simply put, it has evolved . Today’s farms are …

Visual of Why in the future, we will all wear one piece of garment

Why in the future, we will all wear one piece of garment

It's not an easy task to define the practice of designer Jasna Rok . Fashtech pioneer? Radical innovator? Visionary designer? ‘All of the above’ seems only appropriate. In fact, …

Visual of Should lab-grown meat be labelled as meat when it's available for sale?

Should lab-grown meat be labelled as meat when it's available for sale?

Australian regulators will soon be faced with a challenge: can animal flesh produced in a lab be called meat? Amid reports that lab-grown meat could be on sale this year, the US …

Visual of Your next doctor might just be a robot

Your next doctor might just be a robot

Conventional wisdom says that you can’t replace the human touch in terms of medical care, but in our rapidly changing technological environment, it appears that this perception …

Visual of The social animals that are inspiring new behaviors for robot swarms

The social animals that are inspiring new behaviors for robot swarms

From flocks of birds to fish schools in the sea, or towering termite mounds , many social groups in nature exist together to survive and thrive. This cooperative behaviour can be …

Visual of What is a species?

What is a species?

A koala bear isn’t actually a bear, it’s a marsupial. Whales aren’t fish, they’re mammals . Tomatoes aren’t vegetables, they’re fruit . Almost nothing is actually a nut . Peanuts, …

Visual of A guide to parenting with AI Barbie

A guide to parenting with AI Barbie

The rise of artificial intelligence has brought us more advanced toys. If AI Barbie and her talking robotic friends are going to raise our kids, what would their parenting style …

Visual of How to design your Self

How to design your Self

Who are you, who do you want to be, and what do you need to do to get there? We are constantly pushed to lead the perfect life. The media present us with a picture of an existence …

Visual of Why your pets can't spread the coronavirus

Why your pets can't spread the coronavirus

A Pomeranian dog in Hong Kong grabbed the international media’s attention this week after scientists found traces of coronavirus in the canine. Following confirmation that the …

Visual of Next Generation: Building Aquatecture with Shaakira Jassat

Next Generation: Building Aquatecture with Shaakira Jassat

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of The Institute of Digital Fashion explore what's next in the industry

The Institute of Digital Fashion explore what's next in the industry

Trading animal skins for pixels, our digital selves call for a digital wardrobe. The Institute of Digital Fashion , led by CommuneEast founder Leanne Elliott Young and Digi-Gxl …

Visual of The next generation of Xenobots are here

The next generation of Xenobots are here

In 2020, scientists made global headlines by creating “ xenobots ” – tiny “ programmable ” living things made of several thousand frog stem cells. These pioneer xenobots could …

Visual of A new mythology of technology

A new mythology of technology

In conversation with architect Julia Watson, a leading expert on Indigenous technologies and author of 'Lo-TEK, Design by Radical Indigenism'.

Visual of Interview with a cyborg

Interview with a cyborg

Erich Berger has a 96 year old grandmother who is a cyborg. She features dentures, hearing aids, glasses, pace maker, a metal implant on the pinkie toe, and more. Quotes from the …

Visual of Five strategies of Biomimicmarketing

Five strategies of Biomimicmarketing

Green electricity, Organic Shampoo, Jaguar convertibles, Red Bull, Bio Beef, Alligator gardening tools, Camel cigarettes and Puma sneakers. Once you develop an eye for it, it is …

Visual of The Earth on Loan

The Earth on Loan

Christian Schwägerl is a correspondent for Der Spiegel and the author of Menschenzeit (The Age of Man). He will be presenting his views on the Anthropocene at the  Next Nature …

Visual of Customizing the Brain with Psychoactives

Customizing the Brain with Psychoactives

It’s long been a desire of the human species to have complete control over our own thoughts. We’ve all had these moments where we curse our brain. Asking questions like: “Why …

Visual of Did a Robot Grow your Vegetable?

Did a Robot Grow your Vegetable?

The world’s largest indoor farm  is not the only firm developing vertical agriculture. Japanese company  Spread plans to grow more than ten million heads of lettuce a year by …

Visual of Designed to Survive Our Roads

Designed to Survive Our Roads

A road safety campaign in the Australian state of Victoria exposed an educational, yet confronting picture to raise awareness to the vulnerable human body on the road.

Visual of Drones in Agriculture

Drones in Agriculture

Here's a look at how drones can and will impact the agriculture and farming industry.

Visual of ECO Coin Award Interviews: Sandra Rey

ECO Coin Award Interviews: Sandra Rey

We asked Sandra Rey, our third ECO Coin Award nominee, about her company Glowee and her hopes for illuminating the future in a more sustainable way.

Visual of Custom-grown bones, and other wild advances in regenerative medicine

Custom-grown bones, and other wild advances in regenerative medicine

The human body has always been an incredible machine, from the grand feats of strength and athleticism it can accomplish down to the fine details of each vein, nerve, and cell. …

Visual of The return of direct democracy: Introducing a digital agora to the crypto-world

The return of direct democracy: Introducing a digital agora to the crypto-world

In Ancient Greece the people were part of a direct-democracy, this means that they would directly vote for policies and laws. Nowadays, it seems as though this horizontal approach …

Visual of Next hospitals: How virtual reality is shaping the future of medicine

Next hospitals: How virtual reality is shaping the future of medicine

And it’s already showing incredible results. VR transports us to faraway worlds without even asking us to leave our chairs. Yet we usually hear about it in the context of video …

Visual of Next Generation: Unleashing nature’s untapped potential with Amelie Unger

Next Generation: Unleashing nature’s untapped potential with Amelie Unger

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of Why some plastic packaging is necessary to prevent food waste

Why some plastic packaging is necessary to prevent food waste

There has been a surge in awareness of the damage that plastic pollution does to our planet in recent years. It has spurred a number of campaigns to remove single-use plastics …

Visual of The religion named Artificial Intelligence

The religion named Artificial Intelligence

Would you pray to a Robot deity? A group of Japanese buddhists is already doing so. Meet Mindar , the robot divinity shaped after the buddhist Goddess of Mercy, also known as …

Visual of A vegan meat revolution is coming to global fast food chains

A vegan meat revolution is coming to global fast food chains

A few years ago, convincing meat-free “meat” was nothing more than a distant dream for most consumers. Meat substitutes in supermarkets lacked variety and quality. Plant-based …

Visual of Next Generation: Sheng-Wen Lo hears ultrasound waves like pets do

Next Generation: Sheng-Wen Lo hears ultrasound waves like pets do

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here?  Get in touch …

Visual of A button that tells your boss you're unhappy

A button that tells your boss you're unhappy

With gyms closed and millions cooped up and restless at home, it’s little wonder that “healthtech” is now being billed as the next big battleground over which the likes of …

Visual of It's been fifty years since we took the first full photo of Earth from space

It's been fifty years since we took the first full photo of Earth from space

The image of the whole Earth as seen from space has become a symbol of the environmental movement. Time for an update?

Visual of Explore (the future of) Nature at IDFA Festival

Explore (the future of) Nature at IDFA Festival

Humans often claim to be at the top of the food chain, but is that really the case? We are experiencing – now more than ever – our own fragility: an increase in natural disasters, …

Visual of When will the first baby be born in space?

When will the first baby be born in space?

When the first baby is born off-Earth, it will be a milestone as momentous as humanity’s first steps out of Africa . Such a birth would mark the beginning of a multi–planet …

Visual of The sense of privacy

The sense of privacy

Humans’ natural sense of privacy helps them regulate the boundaries of public and private, but fail when trying to identify privacy risks in the online world.

Visual of The Museum of Edible Earth

The Museum of Edible Earth

We spoke with the Museum of Edible Earth, a travelling museum dedicated to the prosperous amount of soil samples.

Visual of Friending, Ancient or Otherwise

Friending, Ancient or Otherwise

By ALEX WRIGHT, Published in NY Times December 2, 2007 The growing popularity of social networking sites like Facebook , MySpace and Second Life has thrust many of us into a new …

Visual of Supermarket – Our Next Savanna

Supermarket – Our Next Savanna

We are living in the future and we find it boring. The best place to gather evidence for this claim is the supermarket. To begin with, try and have a fresh look at the word:  …

Visual of Plastic Planet

Plastic Planet

We tend to think of plastic as a cheap, inferior and ugly material used to make children’s toys, garden furniture and throwaway bottles. But as an experiment, imagine for a moment …

Visual of The Monsters We Deserve

The Monsters We Deserve

Recently, a video clip has been circulating the web that  purportedly shows a rabbit born earless due to the radiation at Fukushima. BoingBoing has a convincing take-down of the …

Visual of Bonobos (And Maybe Baboons) Domesticated Themselves

Bonobos (And Maybe Baboons) Domesticated Themselves

While evidence indicates that humans  domesticated themselves , we're not the only primates capable of self-domestication. Bonobos and baboons have shown they are just as capable …

Visual of End of Life Care Machine

End of Life Care Machine

Designer, artist and engineer  Dan Chen has developed the ' End of Life Care Machine ', a machine designed to guide and comfort dying patients with a carefully scripted message. …

Visual of The

The "Actroid" Lives in the Uncanny Valley

The Actroid robot holds clues for climbing out of the uncanny valley.

Visual of Meet Yangyang, Actroid From China

Meet Yangyang, Actroid From China

The humanoid robot Yangyang can function autonomously, talking and gesturing while interacting with people.

Visual of Artificial Senses for Navigation

Artificial Senses for Navigation

A team of cyborgs and digital enthusiasts developed a wearable technology for the body that perceives a human sixth sense.

Visual of Bringing the Camera Back to Our Eyes

Bringing the Camera Back to Our Eyes

The new Spectacles by Snap Inc. allow you to actually "make memories" (as their slogan claims) while capturing them.

Visual of Solar Energy: the Hottest New Currency

Solar Energy: the Hottest New Currency

Energy-backed money could help transition humanity to a more sustainable world, both environmentally and economically.

Visual of Artificial Light Threatens Pollination

Artificial Light Threatens Pollination

A recent study demonstrated how artificial light is a serious threat to plant pollination. It puts plant reproduction in danger, as well as the whole ecosystem.

Visual of Digital Detox: Disconnect to Reconnect?

Digital Detox: Disconnect to Reconnect?

Do you feel information overloaded? Do you experience stress? Do you feel like you are addicted to your smartphone, laptop, or the Internet? Get yourself digital detoxed!

Visual of The Digital Mythology of... Super Mario

The Digital Mythology of... Super Mario

Mythology still surrounds us, we just relate to it differently. Games and movies have replaced pantheons and folk tales. Fairies and gnomes left the forests and the rivers and moved to virtual realities.

Visual of How this self-sustainable microhome may change the future of housing

How this self-sustainable microhome may change the future of housing

Looking for a self-sustainable mobile microhome? Ecocapsule got you covered. This cute-as-pie capsule pod allows you to live completely off the grid in a low-energy, mobile …

Visual of If you could have another sense, which sense would you choose?

If you could have another sense, which sense would you choose?

Color-blind artist Neil Harbisson designed a brain-implanted antenna that converts colors into sound. This enables him to hear colors he cannot see, and extends his vision to …

Visual of Next Generation: Biophilic design with Daniel Elkayam

Next Generation: Biophilic design with Daniel Elkayam

This story is part of Next Generation, a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of Four visions for the future of public transport

Four visions for the future of public transport

The way people get around is starting to change, and as a professor of transport strategy I do rather wonder if the modes of transport we use today will still be around by the …

Visual of Oded Ezer discusses the future of typography and the importance of dreaming

Oded Ezer discusses the future of typography and the importance of dreaming

Oded Ezer is a typographer from Israel who never fails to push boundaries, or rather, discard them altogether. Ezer is a rebellious force that swings between commercial and …

Visual of Next Nature book launch: here's what you missed

Next Nature book launch: here's what you missed

The new Next Nature book is here ! Next Nature fellows, ambassadors, members and newly interested people came together on the 4th of June to celebrate the book launch with a …

Visual of How a 6.000-year-old fruit fly gave us cheese

How a 6.000-year-old fruit fly gave us cheese

Historians often trace the dawn of human civilisation back 10,000 years, when Neolithic tribes first settled and began farming in the Fertile Crescent, which stretches through …

Visual of How public camera recordings domesticate us

How public camera recordings domesticate us

Facial recognition is increasingly being used in many countries around the world. In some cases the take up has been dramatic . As a result, people are being observed by cameras …

Visual of What will the virus teach us about life?

What will the virus teach us about life?

We live in turbulent times. Thanks to science and technology, we are able to perceive our environment down to the atomic level. We can read DNA, manipulate cells, cut and paste …

Visual of How plastic waste is hurting women in developing countries

How plastic waste is hurting women in developing countries

If we are to build a greener, fairer and more equal society in the wake of COVID-19, it’s time for rich countries to end their practice of dumping plastic waste in developing …

Visual of To save forests, researchers are hooking trees up to Twitter (again)

To save forests, researchers are hooking trees up to Twitter (again)

In July 2018, a century-old red oak went live on Twitter. The account @awitnesstree , tweeting from the Harvard Forest in Petersham, Massachusetts, introduces itself in its bio: …

Visual of Exploring assisted evolution with Prof.dr. John van der Oost

Exploring assisted evolution with Prof.dr. John van der Oost

Assisted evolution raises complex questions. The practice involves human intervention to increase the rate of natural evolutionary processes. A technique that inevitably …

Visual of The Petunia Carnage

The Petunia Carnage

To pay tribute to the destroyed orange petunias during the Petunia crisis, Klaus Pichler has composed an illustrative book.

Visual of Amsterdam Weekly on the Natural Revolution

Amsterdam Weekly on the Natural Revolution

The free cultural paper Amsterdam Weekly discusses the Natural Revolution of and includes tree tips for successful living in the next version of nature. Download PDF (148kb) . …

Visual of BVPS Next Nature in LA - Pictures!

BVPS Next Nature in LA - Pictures!

May 17th 2008. Biggest Visual Power Show: Next Nature in LA . More pictures below. We are all born in a world that has been designed already. BVPS intro video by Floris Kaayk. Big …

Visual of Bacteria that Turn CO2 into Energy

Bacteria that Turn CO2 into Energy

We’ve written earlier about man–made bacteria that eat waste & shit petrol . How about a genetically modified bacteria that can eat CO2 and excrete methane that could power …

Visual of Disaster Edens: The Anti-Tourist Attraction

Disaster Edens: The Anti-Tourist Attraction

Imagine your cruise to the Galapagos came with a ghoulish warning: "Your hair will fall out, your skin will blister, you'll probably get cancer and your children's children might …

Visual of Lions Relocate to the Suburbs

Lions Relocate to the Suburbs

As cities push to the edges of the wilderness, wild animals are increasingly com

Visual of Exploring the Offline World, if It Still Exists

Exploring the Offline World, if It Still Exists

The surprising results of a year offline in the "real" world.

Visual of Grossed Out by Lab-Grown Meat? Here's 7 Reasons Why You Shouldn't Be

Grossed Out by Lab-Grown Meat? Here's 7 Reasons Why You Shouldn't Be

In vitro meat is creepy, unnatural and downright disgusting – and so is every other kind of food we eat.

Visual of Interview: Jason Silva, Media Artist and Curator of Awe-Inspiring Ideas

Interview: Jason Silva, Media Artist and Curator of Awe-Inspiring Ideas

Media artist, filmmaker and wonderjunkie Jason Silva talks about technological evolution and why humans are gods with anuses.

Visual of Growing the Future of Meat

Growing the Future of Meat

Outside of the limits imposed by the edges of an animal’s body, the cells can reproduce and multiply until they exhaust the nutrients and space provided, filling petri dishes and vats to grow the future of meat.

Visual of Interview: Chloé Rutzerveld, Designer Who Wants to Grow Healthy 3D Printed Food

Interview: Chloé Rutzerveld, Designer Who Wants to Grow Healthy 3D Printed Food

Food and Concept designer, Chloé Rutzerveld, explains her 3D food printing project Edible Growth.

Visual of Should Intelligent Sex Robots be Banned?

Should Intelligent Sex Robots be Banned?

The Campaign Against Sex Robots, recently launched, is pushing towards banning the continuation of sex robots development.

Visual of Which Technologies will 2016 Bring?

Which Technologies will 2016 Bring?

The new year is right around the corner, let’s forget about long-term future for a while to check out what new tech trends will hit it big in 2016. At the end of every year, …

Visual of We Are What We Like

We Are What We Like

According to a study our PC, equipped with a list of things we "Like" on Facebook , knows us better than our friends.

Visual of A.I. Can Guess Exact Locations of Images

A.I. Can Guess Exact Locations of Images

Google's PlaNet will be soon able to tell you where a photograph was taken by simply looking at its contents.

Visual of Pigs Have a Heart for Us

Pigs Have a Heart for Us

Replacing your old heart with a new heart from an animal may seem extreme? Well, this future may arrive sooner than we think.

Visual of Racist Robots and Bloodthirsty Crowds

Racist Robots and Bloodthirsty Crowds

It took less than 24 hours for Twitter to corrupt an innocent AI bot and teach it morally repugnant things.

Visual of Untouched Nature Is Entirely Gone

Untouched Nature Is Entirely Gone

Researchers prove that pristine landscapes haven’t existed for thousands of years, therefore we should change or mindset before trying to save the planet.

Visual of Hire a Smart Robot

Hire a Smart Robot

What if your co-worker was a robot? Dutch startup Smart Robotics is a job agency for robots that allows you to hire a smart-robot.

Visual of Designer Anouk Wipprecht combines fashion with robotics

Designer Anouk Wipprecht combines fashion with robotics

We met Anouk Wipprecht and talked about smart fabrics and accessories that can listen to our body, therapeutic fashion and the future of dressmaking.

Visual of An afternoon with Josh Tetrick: The man who wants to bring in vitro meat to the market by 2018

An afternoon with Josh Tetrick: The man who wants to bring in vitro meat to the market by 2018

Meet Josh Tetrick, entrepreneur who wants to reinvent the food industry and plans to launch lab-grown meat on the market by the end of 2018.

Visual of The Economy of Ecology

The Economy of Ecology

What if we could redesign the system to work for humanity and the planet we call home? What would the economy of ecology look like?

Visual of MIT's new voiceless interface can read the words in your head

MIT's new voiceless interface can read the words in your head

The way we interact with the technology in our lives is getting progressively more seamless. If typing terms or addresses into your phone wasn’t easy enough, now you can just tell …

Visual of Robo Wunderkind is a modular robot even a five-year-old can program

Robo Wunderkind is a modular robot even a five-year-old can program

Meet the Robo Wunderkind, a new breed of smart toys that introduces children to the basics of coding and robotics in a playful way. Advanced technologies are increasingly embedded …

Visual of How to biofabricate leather; lessons from the lab

How to biofabricate leather; lessons from the lab

Leather is one of the oldest and most versatile materials in the world. It’s a supple, tough, relatively strong and durable material and it’s relatively impermeable, yet …

Visual of Discussing bio-based material experiences with Elvin Karana

Discussing bio-based material experiences with Elvin Karana

The world of design is in need of new materials that align with the urgency for sustainability. Issues such as climate change, plastic waste and harmful materials require us to …

Visual of There's a new urgency for speculative design. Here's why

There's a new urgency for speculative design. Here's why

Pink chickens, synthesized tiger penises and salads grown from bodily fluids - how could they shape our future? In a Next Nature collaboration with the Gogbot Festival, the …

Visual of Is in vitro meat good news for animals?

Is in vitro meat good news for animals?

The Singapore Food Agency has approved “chicken bites” containing meat made from real chicken cells that were grown outside of a chicken’s body. Alongside similar news from Israel …

Visual of Living robots made from frog stem cells may revolutionize medicine

Living robots made from frog stem cells may revolutionize medicine

At just a millimeter wide, Xenobots are “neither a traditional robot nor a known species of animal", they are "a new class of artifact: a living, programmable organism”, says …

Visual of Next Generation: Searching for Null Island with Deborah Mora

Next Generation: Searching for Null Island with Deborah Mora

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Technosphere outweighs the biosphere

Technosphere outweighs the biosphere

Our deficiencies have always driven us, even among our distant ancestors, back in the last Ice Age. Having neither the speed and strength to hunt large prey, nor sharp teeth and …

Visual of A message from volcanic rocks

A message from volcanic rocks

Although it’s seductive to think of human beings as the dominant species on earth, many others play important roles too. Bacteria, insects, algae colonies, rocks and the …

Visual of Coffee... without the beans

Coffee... without the beans

As with many of the products we consume, there’s a cost beyond what we pay at the store. Producing coffee has an environmental cost, too.

Visual of An artificial skin to breathe underwater

An artificial skin to breathe underwater

The human world often sees itself as separate from the rest of the natural world. Because we have deemed ourselves, ironically, as higher functioning beings over all others on …

Visual of Notes on the plastisphere

Notes on the plastisphere

Every piece of plastic that’s ever made, still exists. It results in a floating garbage dump in the ocean, full of life. While this (geo)design was never intentional, humans …

Visual of Screen mutations and reframing perspectives with Louisa Zahareas

Screen mutations and reframing perspectives with Louisa Zahareas

In the digital era of a globalized world, our screens have become a second set of eyes. Communication has advanced leaps and bounds, to a point where we cannot imagine a world …

Visual of Artist refuses photography prize after admitting his image was AI-generated

Artist refuses photography prize after admitting his image was AI-generated

A German artist refused a photography prize after admitting his image was AI-generated.

Visual of Dancing at the intersection of natural and virtual worlds

Dancing at the intersection of natural and virtual worlds

Exploring the intersection of technology and art, a team of creatives presents a virtual performance that pushes the limits of human expression.

Visual of Geodesign

Geodesign

We have identified eight key defining moments that tell the story of geodesign, from ancient insight to artificial intelligence.

Visual of Wild Wild Space

Wild Wild Space

When Earth goes south, cowboys go all the way up. The Space Rush of 2020s has something to do with settler colonialism.

Visual of Fake for Real

Fake for Real

Fakeness has long been associated with inferiority. Fake Rolexes that break in two weeks, plastic Christmas trees, leaky silicone breasts that cause cancer, imitation caviar. Even …

Visual of The Evolution of the Richer

The Evolution of the Richer

Are we on the verge of a future human evolution, one that isn’t, at least in it’s very core, “the survival of the fittest”, but rather “the evolution of the richer”? Think about …

Visual of Having Invented the Gods, Perhaps we can Turn into Them

Having Invented the Gods, Perhaps we can Turn into Them

My name is Jason Silva. I've spent the last 5 years hosting and producing a tv show on Al Gore's Emmy-winning Current TV network and I'm a fellow at the Hybrid Realities …

Visual of Next Nature Movie #4: Blade Runner

Next Nature Movie #4: Blade Runner

Look around you and try to find the most natural thing in the room you are in now. It is you. Now, you wouldn’t be so sure in the apocalyptic Los Angeles of 2019 depicted in Blade …

Visual of Technostalgia

Technostalgia

In Next Nature, not only old nature is being idealized. Because of the rapidness of new emerging technologies, we have a tendency to dwell on earlier prototypes. To recall …

Visual of A New Take on the Tree

A New Take on the Tree

Many people will have heard of the infamous swastika made up of larches that  revealed itself every autumn in a forest outside Berlin . The trees, which turned yellow at the end …

Visual of Nintendo Portables Are Breeding Grounds For Sexy Fun

Nintendo Portables Are Breeding Grounds For Sexy Fun

Sexuality and sensuality are phenomena which have been a nature for us as long as we humans exist. Not only humans experience these phenomena; also animals experience sexuality …

Visual of Post Natural Organisms of the EU

Post Natural Organisms of the EU

If you happen to be in the neighborhood you might want to drop by at the exhibition Post Natural Organisms of the European Union in Amsterdam. The small but delicate expo, curated …

Visual of Walter Benjamin on Film and the Senses

Walter Benjamin on Film and the Senses

During the late 1930’s the philosopher Walter Benjamin wrote its widely influential essay ‘The work of Art in the Age of Its Technical Reproducibility’. While describing a general …

Visual of Get Infrared Sight with a Vitamine Diet

Get Infrared Sight with a Vitamine Diet

Bio-hackers developed a protocol to augment human sight to see into the near infrared range.

Visual of Three Points in Support of In Vitro Meat

Three Points in Support of In Vitro Meat

The top three aspects why people should support cultured meat.

Visual of Anthropo-scene #9: Sense, Sensors, Sensitivity

Anthropo-scene #9: Sense, Sensors, Sensitivity

Technology helps us understand the unfolding of the Anthropocene.

Visual of The Risk of Technological Unemployment

The Risk of Technological Unemployment

Stephen Hawking gives his opinion on what technological unemployment, aka machines taking over our jobs, can represent for future human societies.

Visual of The World’s Largest Indoor Farm

The World’s Largest Indoor Farm

The world’s largest indoor farm in Japan is 100 times more productive than traditional agriculture.

Visual of Insects are helping us develop the future of hearing aids

Insects are helping us develop the future of hearing aids

The human ear is a miracle of mechanical evolution. It allows us to hear an astonishing range of sounds and to communicate and navigate in the world. It’s also easy to damage and …

Visual of New Diets for Cows Can Stop Gas Emissions

New Diets for Cows Can Stop Gas Emissions

Yearly 90 million metric tonnes of methane are burped and farted into the atmosphere by cattle with effects on climate change. Researchers are looking for ways to change the cow's diet, feeding it oregano, seaweed and super grass.

Visual of Will We Share .thought Files?

Will We Share .thought Files?

With the evolving technique called EEG, electroencephalography, we can measure brain activity and ultimately even read the brain.

Visual of AI & VR Impact on Architects and Engineers

AI & VR Impact on Architects and Engineers

Future workspace, human interaction and unique experiences: here’s how artificial intelligence and VR impact on architects and engineers.

Visual of ECO Coin Award Interviews: Ritsert Mans

ECO Coin Award Interviews: Ritsert Mans

We asked Ritsert Mans, our second ECO coin award nominee about his bike, the technology that fuels it and his hopes for the future.

Visual of In Conversation with Yoyo Yogasmana, Winner of the First ECO Coin Award

In Conversation with Yoyo Yogasmana, Winner of the First ECO Coin Award

Read our conversation with the ECO Coin Award Winner of 2015: Yoyo Yogasmana.

Visual of Next Nature Gift Guide 2017

Next Nature Gift Guide 2017

The gift giving season is once again upon us and to help out those who are struggling to find that perfect gift for that special someone we have brought together a collection of Next Nature inspired gifts.

Visual of Personhood Status for Robots

Personhood Status for Robots

An "electronic personhood" for robots has been discussed in the European Parliament recently, raising big questions about equality, citizenship, legal and ironically, human rights for artificial intelligent machines.

Visual of Technosphere Weighs 30 Trillion Tons

Technosphere Weighs 30 Trillion Tons

If humans would disappear from the face of the Earth today, we would still leave 30 trillion tons of mass in the geological record. Certainly, "we were here" is written all over.

Visual of The age of cyborgs has arrived

The age of cyborgs has arrived

How many cyborgs did you see during your morning commute today? I would guess at least five. Did they make you nervous? Probably not; you likely didn’t even realize they were …

Visual of Gamers are the new athletes: Sports in video games from Pong to VR

Gamers are the new athletes: Sports in video games from Pong to VR

Sports have always had an important place in human societies, providing entertainment, exercise, and a demonstration of the exceptional things the human body can achieve. But in a …

Visual of Interview: Jeremy Bailenson on his latest book

Interview: Jeremy Bailenson on his latest book "Experience on Demand"

Virtual reality has come a long way. Like most technological leaps, it’s had a huge push from the entertainment industry, but current applications span a wide range of social and …

Visual of Interview: Designer Shahar Livne is geomimicing the future of plastics

Interview: Designer Shahar Livne is geomimicing the future of plastics

We sat down with Shahar Livne, an Israeli-born designer who graduated from the Design Academy in Eindhoven to talk about her vision on the future of plastics.

Visual of Period emoji could smash the stigma surrounding menstruation

Period emoji could smash the stigma surrounding menstruation

Astonishingly, we’re still living in a world where most women feel uncomfortable talking about their periods and some don’t even have access to sanitary products. This is why …

Visual of Reimagining popular apps with the Pyramid of Technology

Reimagining popular apps with the Pyramid of Technology

Today, there's an app for everything. They help us satisfy our cravings, allow us to communicate at all times and make it easier to share special moments. But the dark, cold …

Visual of Sandra Rey wins ECO Coin Award

Sandra Rey wins ECO Coin Award

This year we are proud to announce that, with her ambitious work within the field of bioluminescence for Glowee, Sandra Rey is the ECO Coin Award 2017 winner.

Visual of Here’s what manufacturing enhanced with virtual reality will look like

Here’s what manufacturing enhanced with virtual reality will look like

Robots are coming for our jobs. Virtual reality is coming to make the jobs that remain easier to accomplish. All of the world’s manufacturing sectors are in the process of …

Visual of Why electric cars should be allowed to drive faster

Why electric cars should be allowed to drive faster

In response to the nitrogen crisis, the Dutch cabinet is planning to reduce the speed limit during the day to 100 kph. In itself a sensible decision. But it is strange that this …

Visual of Exploring body architecture with Lucy McRae

Exploring body architecture with Lucy McRae

As evolution goes on, the human body is evolving too. What does it mean to be human in times of advanced biotechnology and genetic engineering? Are our bodies ready for our …

Visual of Truly smart homes could help dementia patients live independently

Truly smart homes could help dementia patients live independently

You might already have what’s often called a “smart home”, with your lights or music connected to voice-controlled technology such as Alexa or Siri. But when researchers talk …

Visual of Electric cars might not yet be green, but we should buy them anyway

Electric cars might not yet be green, but we should buy them anyway

Transforming the way we travel is an essential part of tackling the climate crisis. The transport sector contributes about 20% of global carbon emissions . In the UK the figure is …

Visual of (IM)POSSIBLE BODIES: Responsiblity and care in our cyborg future

(IM)POSSIBLE BODIES: Responsiblity and care in our cyborg future

What does it mean to become a cyborg? Better yet, aren't we cyborgs already? What then, does it mean to have a body? Is a 'standard' desirable, what does that even mean, and what …

Visual of Next Generation: Hearing the first breath of Earth with Dora Lionstone

Next Generation: Hearing the first breath of Earth with Dora Lionstone

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of 5 expos (NL) you cannot miss this summer

5 expos (NL) you cannot miss this summer

Interior based on bacteria, spaces morphing perception and the merging of man, animal and machine. These five must see exhibitions in the Netherlands explore the intersection of …

Visual of Blocking the sun with dust

Blocking the sun with dust

In the past few years, scientists have hatched some pretty crazy-sounding schemes in the name of protecting Earth and its inhabitants. From building an underwater wall 120 …

Visual of Bio textiles: Meet three designers reimagining materials using biotechnology

Bio textiles: Meet three designers reimagining materials using biotechnology

The world needs interdisciplinary creators who are designing not just for humans, but for the rest of the living planet. To foster this thinking, Biodesign Challenge (BDC) pairs …

Visual of Fish-inspired soft robot takes a deep dive (literally)

Fish-inspired soft robot takes a deep dive (literally)

The deepest regions of the oceans still remain one of the least explored areas on Earth, despite their considerable scientific interest and the richness of lifeforms inhabiting …

Visual of Future cities: We need to reimagine the look of urban landscapes

Future cities: We need to reimagine the look of urban landscapes

In imagining future urban landsapes, we need to answer questions about what can be sustained and what cannot, where cities can be located and where they cannot.

Visual of Next Generation: Exploring blood, salt and iron as biomaterials with Hedwich Rooks

Next Generation: Exploring blood, salt and iron as biomaterials with Hedwich Rooks

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch: magazine@nextnature.net. …

Visual of Rights for cyborgs

Rights for cyborgs

Cyborgs - part human, part machine - are becoming more present in society, but their rights are not yet established.

Visual of Why Borghildur Indriðadóttir wishes to perform on the Moon

Why Borghildur Indriðadóttir wishes to perform on the Moon

What is the meaning of art on the moon? Artist on the Moon is the latest project from Icelandic visual artist Borghildur Indriðadóttir , who aims to perform for the stars and …

Visual of Next Generation: Designing a living menstrual cup with Lucrezia Alessandroni

Next Generation: Designing a living menstrual cup with Lucrezia Alessandroni

What if living objects could re-connect humans with their menstrual cycle and change the way we perceive it?

Visual of Furniture Futures

Furniture Futures

Wondering how next natural furniture may change your way of life? Will we feed our lamps? Grow chairs? Talk with our tables?

Visual of Cooking with mycelium

Cooking with mycelium

Researchers from the University of Colorado created a recipe book to cook with mycelium.

Visual of CrackBerry addicts are suing their Employers

CrackBerry addicts are suing their Employers

No self-respecting manager would be without a BlackBerry. But now these handheld gadgets, which provide workaholics with constant email updates, are being blamed for chronic …

Visual of Ars Electronica Festival goes Next Nature

Ars Electronica Festival goes Next Nature

This years edition of the Ars Electronica festival , which has been hangout for international experts from the arts and sciences for almost three decades, focuses on the nature …

Visual of Ars Electronica 2010: Artists Adressing NextNature

Ars Electronica 2010: Artists Adressing NextNature