Video Game-Playing Robot Acts More "Human" than Humans
Allison GuyComputer-controlled players in video games can usually be spotted for their repetitive, illogical or unemotional behavior. Unlike humans, non-player characters (NPCs) don't get …
Computer-controlled players in video games can usually be spotted for their repetitive, illogical or unemotional behavior. Unlike humans, non-player characters (NPCs) don't get …
The American Chemical Society has announced a new method of producing gelatin that sounds like good news for cannibals and the canni-curious. Researchers are able to create …
Imagine being 16 and studying for a job that soon won't exist. What kind of future is that? New occupations will come thanks to robotization.
' Team Human ' is a manifesto—a fiery distillation of media theorist Douglas Rushkoff’s most urgent thoughts on civilization and human nature. In one hundred lean and incisive …
It’s widely known that the world has a plastics problem. What’s less widely known is that we have a similar problem with another kind of waste: electronics
Principle number four: Humane technology should resonate with the human senses, rather than numbing them. If you're an office worker or a video game fanatic , you may spend most …
Humans and other hominids have a reputation for bringing about mass extinctions. Homo erectus has been blamed for the disappearance of many African carnivores, our ancestors …
A new theory claims it wasn't human deforestation that caused the ecological collapse of Easter Island, but something smaller and squeakier.
What makes us human? And why do we sometimes fear artificial intelligence? And what about technological singularity - the moment in time when artificial intelligence outperforms …
The greatest taxidermy in the world reveals a great deal about our changing notions of nature.
Buckle up for a new video from our favorite performance philosopher Jason Silva: To Be Human Is To Be Transhuman.
The Stock market skirt Nancy Paterson made a blue taffeta & black velvet party dress that represents the real-time stock market situation by lowering or raising its hemline. …
Remarkable infographic by pcrm.org . Via NY Times , via Consumerist.com .
NNN director Koert van Mensvoort writes a letter to humanity.
Nonhuman Nonsense is a research-driven design and art studio existing somewhere between utopia and dystopia. They wonder upon our relationship with the non-human, embracing …
Nowadays mechanical intelligence is often chosen over that of our own human capabilities. But there was a time where our computers were still not always a match against our own …
And now for the sixth and final principle: Humane technology improves the human condition and helps people realize the dreams they have of themselves. No matter what your …
When you look through a super-telescope, you can still see the planet Earth. Once called the blue planet, she now looks red and parched. We had no choice but to abandon her… On a …
Our second principle: Humane technology revives human intuitions, in particular those we might have forgotten about. 'Conventional' technology aims to overcome our hominid …
Our bodies are microbiomes, suffering from our habit of cleanliness.
New technologies – from artificial intelligence to synthetic biology – are set to alter the world, the human condition, and our very being in ways that are hard to imagine. The …
The third principle of humane technology: It should take human values as a cornerstone of its development. Technology doesn't have to be expensive or electronic to be humane. …
We must be mindful about how we engage with technology: what we use it for, why, and whether it helps us or hinders us. Sometimes our tech seems to be flowing in inhumane …
Stick-on shoes, wakeup lights, bionic limbs: these are examples of humane technology. But what exactly does this mean? It can best be explained in contrast with its opposite. …
We must be mindful about how we engage with technology: what we use it for, why, and whether it helps or hinders us. Sometimes our tech seems to be flowing in inhumane directions, …
Around the world thousands of people are on organ donor waiting lists. While some of those people will receive the organ transplants they need in time, the sad reality is that …
In 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
What if design began to put everything but the human first? The needs of the human not paramount to the design process, but instead the other entities that we cohabit planet earth …
There seems to be a green shift happening in Dutch Design, where the traditional vision is slowly sprouting into a newer, more refreshing one. The biodesigners are emerging from …
Octavio Paz says calls The Invention of Morel , “ without exaggeration… a perfect novel. ” According to Borges, “ to classify [it] as perfect is neither an …
Lately it seems that every movie, book and video game we see is about future apocalypses. Science articles are also painting a grim future for Earth and its inhabitants. If it’s …
Written by Kevin Kelly , published in The Technium . I claim that technology has its own agenda. What is the evidence that technology as a whole, or the technium as I call it, is …
The nature of humanity in the twenty-first century is, according to sociologist Steve Fuller, a ‘bipolar disorder’ beset with dualisms of identification such as divine/animal, …
Humans have been changing the composition of the atmosphere for years, resulting in concerns such as air pollution and extreme climate events. According to Filips Stanislavskis , …
Dutch mechanical-engineer Jarnos Smeets dreams of flying like bird. Nothing new really, many people have had this dream for ages. Yet being an engineer and all, Jarnos is seriously propelling his dream towards a reality.
Is human activity altering the planet on a scale comparable to major geological events of the past? Scientists are now considering whether to officially designate a new …
In Ngogo, Gombe and elsewhere in Africa, bands of male chimpanzees regularly make organized raids on neighboring troops and batter their enemies to death. These grim, warring …
Pair-bonding sets humans apart from our relatives. But where did it come from?
Meet Humanity beyond Race, it's Beautiful
The artificial womb is on the verge of becoming a reality, but how it will affect our culture is for us to decide.
Occupying the 52nd floor of Tokyo’s Mori Tower, Mori Art Museum is internationally renowned for its visionary approach and highly original curation of contemporary art. The …
By Karen Kaplan, Los Angeles Times , December 11, 2007 The pace of human evolution has been increasing at a stunning rate since our ancestors began spreading through Europe, Asia …
What are the characteristics of the perfect leader? The answer could be found looking at nature.
Scientists keeping a human embryo alive in lab for 13 days for the first time.
The textile industry is the second largest polluter in the world that leads to a chain reaction of nasty results: loss of biodiversity, water pollution and soil erosion are just a …
The SAVE THE HUMANS! book is now available on our web shop.
Global warming is "very likely" a human-caused problem that will last for centuries and require concerted international action to reduce its potentially devastating impacts, a …
At the turn of the millennium, miniaturized canines acquired the cherished status of living, designer handbag ornaments. These teeny tiny photogenic doggies, which had been …
The definition of the noosphere as "the sphere of human thought on earth" is woefully anthropocentric. It ignores that fact that our fellow sentient organisms have noospheres of …
Human test subjects felt empathy for dinosaur robots being cuddled or abused.
Eating meat has made us who we are today: evolved, intelligent humans, able to use a verbal language.
In 2016 a team of biologists has successfully kept a human embryo alive in the lab for 13 days, breaking the previous record of nine days.
Thanksgiving is fake-for-real. While it's true that there was a minor harvest feast in 1621, held by English immigrants and Wampanoag Indians, the event was never celebrated …
The increasing ‘liveliness’ of machines and accessibility to the virtual world has raised questions about whether it is possible to uncouple the mind from the body in through a …
Go world champion Ke Jie has lost two games of 'Go' against Google's DeepMind AI system AlphaGo.
At this moment in time, many people are staying at home in order to flatten the curve . It is times like these that we realize how vital technology is to us and our societies. It …
Interview witth TEDx on how people are technological by nature, yet how we also need humane technology to remain human, or become even more human than we are today.
Wu Tzu-ning presents a posthuman reality from genetic engineering to digital afterlife.
Due to its digital citizenship program, something interesting is happening in Estonia. In July there were more new applications for e-citizenship than newborn babies. Are we …
As you read this, a strange object that looks like a 2,000-foot floating pool noodle is drifting slowly through the central north Pacific Ocean. This object is designed to solve …
As we go about our daily activities, we may lose sight of our connections with nonhuman life. Here are three exhibitions to encourage you to step outside of your everyday and …
Humans are the only species on earth that cooks its food. Not only do we cook our food, but we usually find the flavor of cooked foods preferable to the raw version. Compare the …
Arne Hendricks thinks we can solve the ecological crisis by shrinking every human on earth to 50cm tall: http://bit.ly/sxxNr1 #powershow
Tiny houses have been heralded as a radical and creative way to address a lack of affordable housing, as well as reducing living costs and shrinking our carbon footprint. My PhD …
We call upon you, dear readers, to participate in a new publication from the Next Nature Network: SAVE THE HUMANS!.
Today there are on average there are some 8000 planes in the sky carrying at least half a million people. On average during the Stone Age there must have been less.
Read the Letter to Humanity in Morse Code.
Scientists in the UK applied for permission to create part-cow, part-human embryos for research aimed at treating diseases such as Parkinson's and Alzheimer's. The embryos created …
Principle number five: Humane technology doesn't outsource people, but instead empowers them. How healthy or humane is it to have an escalator to the gym? Humane technology should …
For our new book "Save the Human" we invite you to submit quotes that question the autonomy of mankind in the digital computer era and study the future of the independent creative spirit.
For the first time in history the world population counts more people who are too fat than too thin.
Next Thursday, February 11, the Hoxton Hotel in Amsterdam dedicates an evening to our newest publication: 'Save the Humans!'
On the occasion of the Earth Day, 22 April 2017, philosopher Koert van Mensvoort wrote his Letter to Humanity.
All too often, technology frustrates us. It forces our behavior into constrained pathways. Even more insidious, technology can knock us out of alignment with our values, goals or …
Krill, those tiny members of the ocean's planktonic community, have an importance disproportionate to their size. They are a vital food for whales, penguins and increasingly, …
Economy is ecology . At least, according to the biomimicmarketeers of the US Wachovia Bank who created this weather report like newspaper advertisement. Nowadays most people worry …
So you thought the Internet was made by and for people? Think again. A study by Incapsula , a provider of cloud-based security for web sites (mind you where this data comes from), …
The food writer Bee Wilson, author of Consider the Fork , has put forth a surprising theory about forks and teeth that has received widespread online coverage. According to …
Robots are coming to replace humans at work, are they a real threat to the world’s unemployed?
Scientists have been trying to develop GM pigs that could be used to solve the shortage of organs for transplant patients.
Is human cloning here? Chinese scientist is ready to clone people at his ‘replication factory’.
The Italian government just launched a campaign to raise awareness for falling birthrates and encourage family planning.
This question is an excerpt from the Pyramid of Technology toolkit In the late nineties, the Tamagotchi egg was released. A small egg-shaped device that contained a digital …
Written by Debbie Mollenhagen PART 1: FROM LINEAR TO CIRCULAR Designer living has become designing life. I often ask myself: did it taste like the real thing? But when I open my …
I never expected anthropomorphobia to be evoked by a fish! This hybrid species fish was born between a carp and a leather carp in the pond of a personal house in Chongju. Each of …
The human body as an instrument is a cool example of how culture and nature are merging. Calvin Harris used a giant human synthesizer to perform his single. The material used is …
The economic system and profit motive has been a driving force that steers and even dictates social change. Investors and stockbrokers have been a major influence to these social …
A musical robot able to improvise a jazz solo in response to an actual person performing jazz.
Over the past decade scientists have tried to get technology surfaces to be as sensitive as our skin, especially as our fingertips. Human tact is a very sophisticate interface …
In 16th and 17th centuries, some medical theory believed that a miniature human body can be produced in a flask by an alchemist.
In 2015, a group of scientists from the University of Michigan claimed to have made the world's first artificial placenta.
Artist Lauren McCarthy launched a project called LAUREN in which she embodies a eponymous human smart home assistant.
What will the human race look like in 1, 2, 3, 4 million years? Will it be one human race? Will there be a human race? Impressions of future scenario's must come from scientists, …
Nissan’s Engineers Are Creepily Trying To Replicate Human Skin
Historian Yuval Noah Harari takes us on a journey through the whole human history.
Human fitness has decreased so significantly that even the strongest of us would consider ancient men to have a supernatural force.
De Motu is an interactive music app that let you experience your body through music and influence the sound with your own body.
Gene editing is advancing at a faster pace than most of us can keep up with. One significant recent announcement was gene editing tool CRISPR’s application to non-genetic diseases …
Going to the zoo is a favorite summer past-time. Visitors to the Schönbrunn Zoo in Vienna will see lots of animals in recreated ‘natural’ habitats. Except this summer, along with …
For a while now printer ink is probably the most expensive liquid per litre on earth. Still we need our images so badly that we accept this fact. The Human Printer manages to make …
In Holland people go crazy for soccer, especially now that the national team has reached the World Cup final. We gather everything that's orange – our shirt color – as the …
All living creates produce light by default, so do humans . Now researchers from US, China, Korea and Singapore collaborated have collaborated in order to create ultra-thin …
Alveoli in human lungs serve as the inspiration for designing better, stronger ways of storing compressed natural gas.
British research group created anew scanning technique permits to obtain 3D images and detect wavelengths that our visual system is not able to see.
Workers are completely controlled by algorithms in Amazon's fulfillment center
Just a project for now, but a far more creative way to deal with unsightly public works than tree-shaped antennas.
In suburbia, we hope to get away from it all. Unfortunately, everyone else has the same idea. Happy Thanksgiving to our American readers!
Driving long distances without a passenger can be lonely. If you’ve ever done it, you might have wished for a companion to talk to – someone emotionally intelligent who can …
Imagine a graveyard without tombstones, instead there are growing trees that contain genetic material of the deceased people burried there. Biopresence creates Human DNA trees by …
Think of this sonic vibe-technology inside any MP3 player ;)
Eric Hoffer (1902-1983) You dehumanize a man as much by returning him to nature - by making him one with rocks, vegetation, and animals - as by turning him into a machine. Both …
Artist Nadine Jarvis fabricates pencils from carbon left over of cremated humans -- it's part of a larger "research project into post mortem." She notes that "240 pencils can be …
Starting next spring, a complete human-genome sequence can be ordered the Californian startup Complete Genomics for just $5,000, Techreview reports. Currently sequencing still …
Anthropomorphobic object of the week. Created by Sarah Hatch .
After being denied permission to reproduce the famed Little Mermaid statue from Copenhagen, the authorities of Vancouver decided to go for something more realistic.
Just when you thought the Second Life hype was long gone, meet Ukrainian body artist Valerie Lukyanova who aims to turn Second Life into First Life. They call her the Human …
Will writing software eventually replace journalists?
What does Barbie look like when she has the proportions of a normal 19-year-old?
All humans on Earth put together are not enough to fill the Grand Canyon. We are so small yet so present.
"It's time to recognize the Internet as a basic human right" its inventor Sir Tim Berners-Lee has said.
Three minutes in the mind of Juan Enriquez, director of Synthetic Genomics.
A new biotech startup seeks to hack our cells to use solar energy instead of carbon and oxygen.
To thread the uncanny valley is a conscious choice for many artists and enthusiasts, as a means to evoke, through their work, powerful emotions, thoughts and everything in between.
AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …
This peculiar, half-human creature could be your cousin. No really; it is a sculpture by Patricia Piccinini entitled The Young Family , which, in turn, is part of a larger …
Modern society seems to have transformed human nature into a pathology. Our emotions are controlled by drugs. We are forced to operate within a narrow bandwith of what are …
Fleshmap touch investigates the collective perception of erogenous zones. Hundreds of people ranked how good it would feel to touch or be touched by a lover in different points of …
Much attention has recently been devoted to 'gay' animals. It's not the fact that many species have enthusiastic homosexual lives that should be surprising – there are convincing …
Black wolves should probably not exist. The same species as their gray relatives, these wolves have a genetic mutation that causes them to produces excess melanin, a pigment …
As a gamer, I come across many visions of possible futures. But this trailer from the upcoming video game Deus Ex: Human Revolution , the third part in the Deus Ex series shocked …
A smart campaign by Ogilvy Paris for WNF shows that also the ‘non-cute’ animals need our help. via Fubiz
Part 10 in the 11 part series Anthropomorphism and Design . The hidden danger with interactive products is that they will become so good at fulfilling our needs that they start to …
Researchers in the US have been shocked to discover a beluga whale whose vocalisations were remarkably close to human speech.
In combining the classic feeling of handling a book with the interactivity of the computer, Waldek W?grzyn of the Academy of Fine Arts in Katowice, Poland, has created a new human-computer interface.
Dolphins in Port Adelaide, Australia, have been observed performing a remarkable trick : tail-walking, a trait so rare it has only been seen in the wild one other time. More …
Artist Maja Smrekar modified yeast with her own DNA to produce human lactic acid.
The Human Hamster Wheel Desk is the latest result of workspace evolution. Office work has domesticated us!
If we'll ever get to go to Mars as tourists , we wouldn't get lost. Ordnance Survey , the official British mapping agency, recently released a new detailed map of the Red Planet. …
Lyrebird is an AI model capable of synthesizing anyone’s voice from just a one-minute audio sample.
Under the title Human Nature, designing the equilibrium, eleven designers will answer questions about a future in which Humankind and Nature enter into a new relationship. An …
A tribute to the virtual world boomeranging back to the physical world by Mega64 . Or do you rather prefer the corny japanese gameshow version? Via Engadget ,
Why not use the human body to grow products for the medical industry? The designer Michael Burton envisions Future Farm where the body is used as a farm to cultivate clinical and …
Our peculiar image of the week was created by artist Levi van Veluw , who reinvents the classical fine art of landscape painting, by moving from the traditional 'oil on canvas' to …
Within our society, imitation and simulation are typically seen as inferior symbols of a distorted mediated culture – think of fake Rolexes, plastic Christmas trees, silicone …
Whereas lizards have the extraordinary ability to regenerate lost limbs – meaning that if the lizard loses a limb through conflict with a predator, it will grow back – people have …
Food technology in the overdrive: Pork molded in the shape of a piglet.
Clothing giant H&M no longer uses real humans in its online catalog. The company has admitted that it pastes real models' heads on computer-generated bodies. At least there's …
Part 8 of the 11 part series Anthropomorphism and Design . Anthropomorphic products blur the boundaries between products and people. Ethical norms for people don’t usually apply …
Warning, this video on the impact of automation on human labor might cause you to re-plot you professional career.
French performance artist hatches 10 hen's eggs in Palais de Tokyo.
New media technology from South Korea: a gigantic human display compiled from supporters cheering their soccer teams . One pixel per supporter. See also: Skyscreen , A4 e-paper .
Introducing the brand new, hand made, eco friendly, sweat absorbing, natural, healthy and most of all fashionable bamboo keyboard. It seems bamboo isn’t just for pandas anymore. …
Cake or death? Cake! The Slice cake is a (vegetarian) vision of the forms lab-grown meat may take in the future.
The personal touch of pen and ink VERSUS the efficiency and productivity of digital word processors.
Buckle up for a cinematic espresso shot from performance philosopher and NNN ambassador Jason Silva.
This unpractical yet not less pretty anthropomorphic furniture piece was created by photographer David Blazques . We are clueless on whether it is in permanent use, yet it serves …
Read Nicholas Carr's essay on the transhumanist dream of having wings.
I remember the smoke the most. That pungent smell permeating the camps of tribal people. Everything they touch is infused with the lingering perfume of smoke – their food, …
When I was a kid, my parents took me to the beach every summer. We’d swim in the ocean and play on our inflatable raft in the surf. When the tide was low, I’d build a sand castle …
In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …
Are you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …
With the invention of the radio antenna in the late 19th century, we became a different species: Introducing the human insect. A species, able to communicate across oceans using …
When techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …
We had the honor of hosting Bruce Sterling in our Next Nature Network headquarters to talk to him about the concept of the convergence of humans and machines.
For years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …
Nature has always been a source of inspiration for many artists and designers, yet the urgency to connect to nature is more pressing than ever. Environmental issues such as …
There’s no place on earth untouched by human activity: This was clear as Lucas Foglia whizzed across the vast, white expanse of Alaska's Juneau Ice Field last summer. He was …
Speculative designer Agi Haines' work focuses on (re)designing the human body, and speculates upon future scenarios.
What does the supermarket of the future look like? The Embassy of Food at Dutch Design week.
Sleep and dream like a koala, relax under biodiversity and feel the meditative effect of artificial wildlife.
If Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
The idea of colonizing Mars has become the big speculative future of humanity on Earth. But, artist Alexandra Daisy Ginsberg has radically different ideas to contribute to the …
A psychiatrist argues that beer gave us civilization - but do intoxicants play a deeper evolutionary role than that?
Floris Kayak discusses online hoaxes and the future of technology.
Bioprinter creates bespoke lab-grown body parts for transplant.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The skies in Beijing turned orange recently, thanks to what was widely reported as a massive sandstorm . The problem, at least in terms of public health, is that it was not …
What if we would use the idea of symbiosis as the basis for the next period of Earth’s history?
The connection we share through the Internet has laid the foundation for a whole new digital infrastructure, in which blockchain technology is heralded by many believers for being …
Did you know that some Dutch people are so addicted to their devices that they'd rather give up sex, vacations, or even a finger than their phone?
A must-read to the Next Nature fan: Catching Fire: How Cooking Made Us Human (2009). Written by British primatologist Richard Wrangham, the author shares his hypothesis that …
From icy tundras to billowing clouds, the colour white crops up repeatedly in our planet’s palette. This colour provides a natural way for light from the sun to reflect back from …
A stunning pre-history of the anthropocene
Is the use of personal devices becoming a replacement for the spectrum of emotions that make us all humans?
Augment your physiology. Enhance your prospects. From neuro-electronics, to robotic-prosthetics and mind-altering pharmaceuticals.
Humanity has for a long time considered itself the most important species on the planet. We are quite happy to share the world with other species, but we think we know who's in …
Nature provided humans with an extensive set of sensory modalities, allowing our brain to constantly gather sundry inputs from the outer world. These sensory inputs help us …
Surrounded by greyness and with the air around you having a dusty, burnt taste; for a long time this is what it has been like to live in many of the world’s highly polluted …
On King's Day the water board of Amsterdam wants to collect urine and use it as fertilizer.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
You are what you eat; a quite common message in the midst of our self-growth society. We have to eat well to become the best version of ourselves - more productive, healthier …
In 1953, a Harvard psychologist thought he discovered pleasure – accidentally – within the cranium of a rat. With an electrode inserted into a specific area of its brain, the rat …
We have witnessed significant progresses in the field of real-time translation, and this new wearable translator, called ili, sums up perfectly this essence.
Madrid's new plans to fight rising temperatures and high pollution rates investing on green urban areas.
Nigel Gifford is developing a drone that will be relatively inexpensive, disposable and edible.
How technology becomes nature in seven steps
Take a bite from this pear and I'll spare you all the default connotations with the apple of eden. Source photo by Pablo Montanez . See also Modernistic Watermelon , Ferrari …
The ultimate personal hygiene product, feces odor tablets, is another Japanese innovation sold by the Takano Yori Beauty Clinic . These pills promise to make your excrement …
Amazon's Echo smart speaker may have witnessed a murder. But will it talk?
Now that the team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …
Researchers tested 'Fiji Water' against ordinary tap water. What they found is kind of shocking.
The simulacrum is never that which conceals the truth--it is the truth which conceals that there is none. The simulacrum is true. -Ecclesiastes If we were able to take as the …
The way we currently build is not sustainable. We will have to develop a sustainable living environment that matches our human needs, intuitions and potential.
Previously, experiences of time emerged from nature as given – offering seasons, the rhythm of humans, plants and animals. Nowadays, people integrate nature-time, body-time, inner-time, clock-time, and global 24/7 systems-time. Human beings, in past, current and next natures, have to deal with emergence and design of time in order to survive.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
We recently spoke to Ilari Laamanen, to peel the outcrops of Momemtum9, and unveil the overlapping themes to the next nature philosophy.
Imagine if everyone spoke a language that you don’t understand. It’s not a foreign language–it’s been spoken around you since the day you were born–but where as everyone else …
Marxist philosopher Slavoj Žižek discusses the 'naturalization' of capitalism and how ecology became a new field of capitalist investment. He also argues that the ultimate …
Pleun van Dijk is a speculative artist/designer who investigates the intimate relationship between human and technology.
Mars ain’t the kind of place to raise your kids, laments the Rocket Man in Elton John’s timeless classic. In fact, it’s cold as hell. But that doesn’t seem to worry a new …
For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …
Some of our greatest cultural and technological achievements took place between 1945 and 1971. Why has progress stalled?
In configuring our next nature, artists and scientists explore new languages that move beyond the Anthropocene - the era of human beings. These semantics would bridge the gap …
The introductory essay from the Yes, Naturally book - available in our store!
The first time I explained biomimicry to a stranger was not in a talk or a workshop but in a big-box bookstore just after Biomimicry: Innovation Inspired by Nature had come out. I …
So you’re triggered by our call for products and now you’re considering to send in one, two or maybe three of your brilliant products for the Nano Supermarket? Good. Or – and this …
Do humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Rachel Armstrong discusses living buildings, Venice's foundations, millennial nature and how to improve our future.
We have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.
Technology is nestling itself within us and between us, has knowledge about us and can act just like us.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Today we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …
The next step is to embrace and celebrate how cultural artifacts are escaping control, becoming autonomous, and forming the “next nature”.
At the edge of the woods along the motorway near the Dutch town of Bloemendaal, there stands a mobile telephone mast disguised as a pine tree. This mast is not nature: at best, it …
We live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …
If we want to bring down global CO2 emissions to zero, we will need technological innovation and massive infrastructure projects.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
The first essay ever written on Next Nature, published in Next Nature Pocket and in Entry Paradise, New Design Worlds . ( download pdf ) (German version: Erkundungen im Nächste …
The Moon Gallery aims to set up the first permanent museum on the Moon. Soon launching to the International Space Station, full of ideas worth sending to the Moon. The gallery is …
Energy policy blah blah blah, life cycle analysis blah blah blah, energy return on energy invested, peak oil, carbon footprint, renewables, hydro, nuclear, blah blah blah blah …
Interview with Mike Thompson and Susana Cámara Leret.
'Big History' is a multidisciplinary study that seeks to put the human story into the context of a 13.8 billion-year story from the Big Bang to now.
Like it or loathe it, the robot revolution is now well underway and the futures described by writers such as Isaac Asimov , Frederik Pohl and Philip K. Dick are fast turning from …
John Zerzan, published in Green Anarchy issue #24 - Spring/Summer 2007 The rapidly mounting toll of modern life is worse than we could have imagined. A metamorphosis rushes …
An interviewer once asked Pablo Picasso why he paints such strange pictures instead of painting things the way they are. Picasso asks the man what he means. The man then takes out …
This project - the Next Nature Network - is about Nature's brand image. One might surmise that "Nature," being 100 percent all-natural, can't have any brand image. The facts …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Let’s talk about the most controversial of "m words"—monogamy. And let’s have this conversation with in mind its prehistoric origins. Our modern picture of prehistoric societies …
In this essay, anti-civilization, anarchist philosopher John Zerzan critiques the concept of 'next nature.' He argues that rather than freeing us, our self-domestication through …
Dutch fashion designer specialized in wearable technology, Pauline van Dongen researches the human body in relation to its surroundings.
There it is. A hefty hen, with its head up high and its beak out. And a gigantic VR headset over its beady little eyes. What does this battery hen see? ‘An experience of a free …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and plot your …
Digital and genetic techniques increasingly influence life. Our belief in progress through technology stands in the way of a moral debate on this development. By Rinie van Est We …
Since Darwin we tend to look at the biological world exclusively in economical terms. The idea that monkey's, frogs, or even ants do more than simply propagate, doesn't find much acceptance among scientists. And yet, even crayfishes at times seem to displace objects just for fun.
From nutrients within an organism, to organisms within collectives, to populations within a territory and so on - nature offers models on how to deal with highly complex systems.
We humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.
Since the early days of the net, the electronic pastoral has lent itself to all sorts of dubious agendas pushed by science, the military and even libertarian tendencies. In the …
Invasive species become the animal symbols for a man-made world.
Read Benjamin Aldes Wurgaft's essay on judaism in relation to the production of laboratory-grown meat.
Dutch experience designer Leanne Wijnsma designs for the human instinct and puts the sense of smell back to where it belongs, as modern hazards have shifted to the digital realm.
Ten books that continue to inspire the next nature philosophy—gathered for you to read this summer.
The coverstory of Next Nature Magazine investigates how the rise of virtual influencers on social media reveals a superorganism.
In vitro meat has the capacity to transform meat production as we know it, introducing an entirely new way of thinking about and interacting with food.
Interview with Liam Young on his work in speculative architecture, the future, and our role in nature as humans.
A large-scale asian food market serving in vitro meat, a transatlantic expo on the future of nature and a travelling exhibition that explores our relationship with AI. These five …
For many people, the most distressing part of the coronavirus pandemic is the idea of social isolation. If we get ill, we quarantine ourselves for the protection of others. But …
Then, as now, one person could literally change the course of history, with nothing more than an idea.
Demand for life-saving organ transplantation is at an all-time high. In 2021, a record 41,000-plus organ transplants were performed in the U.S., with top numbers for kidney, liver …
Make no mistake, you're not looking at the latest Barbie line: These are the The Pussycat Dolls. Formerly an LA stripper show burlesque show, now upgraded to be pop music …
Our bodies are maps of our ancestor's social lives. We evolved, physically and behaviorally, in incredibly complex social groups. Such intense sociability may have favored the …
Are we alone in the universe? The famous Seti (Search for Extraterrestrial Intelligence) programme has been trying to answer this question since 1959. American astronomer Carl …
How will we stay healthy in the future? Can we utilize the power of design to move towards a more healthy society?
Some 10,000 years ago humans began to domesticate plants and animals. The birth of agriculture, one of the earliest technologies available.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Meet the teledildonics, an ingenious species of bi-directionally controlled sextoys from the future, available today. These touch emulating vibrators find each other on social sex …
Visual artist Heleen Blanken explores the complex relationship between people, nature and technology.
The Made and the Born: Neo-Biological civillization, written by Kevin Kelly, excerpt from Out of Control : The New Biology of Machines, Social Systems and the Economic World, …
Is the evolution of the single bladed razor into an exorbitant five–bladed vibrating gizmo the outcome of human needs, or is there another force in play? Say hello to Razorius …
Every time we eat a piece of food, we take a bite out of the world. All these small bites tell a dozen stories. A carton of eggs presents the story of contented hens, a bottle of …
Many people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.
We recently talk to Nadine Bongaerts about the role and impact of synthetic biology, the gap between biosciences and society and the importance of communication to overcome the fear of new technologies.
Over time, our bodies, our food and our environment have become more and more subject to design. As designers, we hold the responsibility and have the unique chance to envision …
The history of art through the ages reveals a constancy that, by conscious or unconscious applications, provides us with an omnipresent correlation dealing with the …
We humans simply feel more comfortable with technological change when it comes in a familiar form that refers to an existing and accepted object, habit, value, tradition or intuition.
Volume magazine interviews Next Nature founder Koert van Mensvoort.
Writing is recognised as one of mankind’s foremost inventions and the mechanization of writing is one of these developments that typify what is commonly regarded as the work of …
Biotechnology is nearly as old as humanity itself. The food you eat and the pets you love? You can thank our ancestors for kickstarting the agricultural revolution, using …
Last month I had the opportunity to immerse myself in Tokyo’s newly opened digital art landscape, the Mori Digital Art Museum. The museum stands out for it enables virtual …
Last week, the gene editing world was hit by news the equivalent of a nuclear bomb. In a video on YouTube , Dr. Jiankui He at Southern University of Science and Technology in …
It’s common consensus in the tech industry that the days of cars as we know them—powered by gas, driven by humans, and individually owned by all who want and can afford one—are …
For thousands of years people used oil lamps and candles to illuminate their homes during the hours of darkness. Neither produced much light and both were inconvenient in use as …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
What does the merge of bodies and technology mean for the human? For cyborg Kai Landre, cybernetic extensions become body parts and not technology. Kai began his transition to a …
During the event The Biosphere Code, Stockholm University researcher Victor Galaz and colleagues outlined a manifesto for algorithms in the environment.
On June 17th a NNN Fellow Day was organized to explore the future project: Next Senses.
What do in-vitro human skin, spider silk and cow manure have in common? They are all unlikely materials that can cloth, protect and inspire humans, as realized by award-winning …
Meet Pirjo Kääriäinen, professor of design driven fibre innovation at Aalto University, Finland. Kääriäinen founded CHEMARTS —a collaborative program at the university that brings …
Have you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …
Today we cannot meet, touch or hug our loved ones. And while we all like the feeling of the touch of another human being, physical contact does not just feel nice, it is crucial …
Technology is not neutral; the same tech might empower some and disempower others. It is time to check our Technoprivilege, argues author Hendrik-Jan Grievink.
Technology can help us to connect with our surroundings. Think about the microscope: it revealed ecosystems beyond our visual reach allowing us to look at the smallest inhabitants …
Written by Werner Lippert & Peter Wippermann, Curators of the Entryparadise exhibition (26/8 until 3/12, 2006, at Kohlenwäsche, Zollverein) Design is about to undergo a …
Traditionally, technology is seen as a force that diminishes our instincts and puts us at a distance of nature. Increasingly however, we realize technology can also energize and …
Steven Levy writes in Wired on the unexpected turn of the Artificial Intelligence revolution: rather than whole artificial minds, it consists of a rich bestiary of digital fauna, …
The Singularity , as popularized by Ray Kurtzweil, refers to a near term, theoretical time when machine intelligence greatly surpasses our own. At this point we will experience a …
An interview about the history and promises of synthetic biology, and the problem with the word "nature".
Ever notice how ant colonies so successfully explore and exploit resources in the world … to find food at 4th of July picnics, for example? You may find it annoying. But as an …
At Home in the Lab with Mark Post, Father of the In Vitro Hamburger. Interview from The In Vitro Meat Cookbook
Interview with Govert Flint, designer, architect and self-taught artist.
How can we design a cryptocurrency for the better of humanity and ecology? In this last chapter of the crypto deep dive series , we will dissect two kinds of blockchain …
Right now, somewhere in a laboratory in California, the Netherlands or Japan, a technician is taking a few thousand skeletal muscle cells from a living animal, and placing them in …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
The field of biofabrication is still new to most people. As founder and CEO of Biofabricate, Suzanne Lee shared with us this exciting online event series Creatives in Biotech . If …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Next Senses explores the unchartered territory of how we could experience the world with technology
Picture this: it's 40,000 years ago, and you are an early Homo sapiens. You are standing on the savanna. Look around you. What do you see? No billboards, no traffic signs, no …
In 2009 the Initiative for Science, Society and Policy coined the phrase ‘living technology’ [1] to draw attention to a group of emerging technologies that are useful because they …
Joyce Hwang discusses the challenges for designers, and gains for citizens, of living in a truly biosynthetic city.
We talked with Bas Haring to discuss the conception, image and will of the robot. Read our conversation with him and update your ideas about robots.
As if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …
A team of German researchers published a study earlier this week indicating people can be duped into leaving a robot turned on just because it “asks” them to. The …
Is social media ruining the world? Dramatic political polarization. Rising anxiety and depression. An uptick in teen suicide rates. Misinformation that spreads like wildfire. The …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The world is alight with algae fever. In this age of deep ecological design aspirations, the range of speculative design projects based on algae technology is growing. Algae are …
An interview with Daisy Ginsberg, artist and synthetic biologist.
One of the arguments that environmentalists use against factory farming and burning fossil fuels is that these activities are "unnatural" or that they "go against nature." But …
Nowadays humans suffer from diseases that didn't exist in the past, a trend that will probably continue into the future. A wide range of new disorders, especially related to the …
We asked Shubhendu Sharm, our first ECO coin award nominee about his method, business and hopes for the future.
The local fishermen looked on skeptically. From the deck of a small motorboat, scuba divers grabbed odd chunks of ceramic – which could be described as rocky brains stuck on …
Growing meat artificially, instead of within an animal, may soon be an available reality. Meet one of the pioneering developers of this product of the future: Aleph Farms. With …
The oldest known serious candidate forerunner for the bicycle is the ‘running machine’ built by the German Baron Karl von Drais. His two-wheeled machine became known as the …
The idea that AI can compose electronic music may sound a little off to people. It raises essential questions about creativity as a product exclusive to humans: can an AI be …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
A report from 2021 from the National Academies of Sciences, Engineering and Medicine tackles a controversial question : Is solar geoengineering – an approach designed to cool the …
Why memes might be the next tool to make sense of on our increasingly hybrid virtual and physical environment.
Have you heard the buzz on virtual money in online games? Some years ago the first virtual millionaire was announced, yet there have also been reports on people being practically …
Manko sighed. Nada: 'Did you like it?' Manko: 'I have to admit that if this is the starter, I'm not sure I'll survive the main course.' Everyone at the table laughed. Manko: 'Let …
The sublime is an aesthetic concept of 'the exalted,' of beauty that is grand and dangerous. Through 17th and 18th century European intellectual tradition, the sublime became …
We recently talked with Suzanne Lee about the textile industry and technology, growing leather in the lab, and the use of new alternative materials in the future of fashion.
Dystopian future scenarios filled with evil robots are everywhere. We are afraid of robots treating us badly, but what will happen if it'll be the other way around? According to …
We recently handed this year’s ECO Coin Award to Dutch designer Dave Hakkens, founder of the Precious Plastic movement. With his open sourced recycling machines, he provides people around the world the knowledge to start recycling plastic locally.
Robots are getting stronger and smarter every day. They are taking over our whole lives. How long will I have my job before a robot steals it?
As modern humans, we are out of balance with our natural environment. With use of technology, we try to prolong our human lifespan and create materials that live longer than we …
Up to half of the world’s sandy beaches are at risk of disappearing by the end of this century if no action is taken to limit greenhouse gas emissions. That’s according to a new …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Imagine we would have an alternative monetary currency for environmental value. Would the rain forest still be destroyed if there existed an ECO–currency to express its value and …
A Dutch artist designs a Utopian eco-socialist online society.
Before we can decide if we will ever be willing to eat in-vitro, we need to explore the food culture it will bring us.
Sophia the Humanoid, a human-like robot in appearance and mannerisms, was granted citizenship by Saudi Arabia and became the first robot with citizenship.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
Patricia Piccinini is an artist interested in the relationship between humans and non-humans, the natural and the artificial, science and storytelling. Working with silicone, …
The Sun is the most important source of energy for sustaining life on Earth, but it gives us a lot more than just light and heat. It also gives us solar storms.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Imagine a place called Reprodutopia. How would such a place look like?
Mark Weiser (originally written for ACM Interactions ). What is the metaphor for the computer of the future? The intelligent agent? The television (multimedia)? The 3-D graphics …
There is a domain of creatures that diffusively encircles an entire planet. There are so many of them that they occupy every conceivable ecological niche. Yet, despite their …
Like we did to old nature before, we must now cultivate our technological environment.
Lab grown meat is part of the trajectory that agricultural technology is already following.
Would you like a dog snout, cat eyes or fluffy bunny ears? The choice is yours. Virtual selfie filters have become a widespread phenomenon on social media platforms such as …
Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
Designers face an unprecedented urgency to alter their methods and reprioritize their goals to address the accelerating degradation of the environment. This new …
Matilde Boelhouwer is a designer whose work speculates between art, design, science, biology and food. Matilde shapes this obligation into a studio which mainly focuses on the …
Just because you can doesn’t mean you should – real-world genetic engineers can learn from the cautionary tale. “ Jurassic World: Dominion ” is hyperbolic Hollywood entertainment …
Sometimes a festival can be so much more. Tapping into arts, design, and electronic and experimental music festival, Sónar Lisboa (8-10 April) is one for the body and for the …
People in the world’s developed nations live in a post-industrial era, working mainly in service or knowledge industries. Manufacturers increasingly rely on sensors, robots, …
Designer Govert Flint proposes a new office concept, entirely based on movement and play.
Douglas Coupland is a writer and artist based in Vancouver. For the canadian newspaper Globe and Mail, he wrote The ‘radical pessimist's guide to the next 10 years’ a dystopian …
All buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …
Intentionality separates culture from nature. A dog is intentional, a fox is not; a park is intentional, a forest is not. Since trash, ruined buildings, and automated computer …
The protozoa Toxoplasma gondii makes an unobtrusive home in nearly every warm-blooded species, but it's prolific life is limited: Toxo can only reproduce in cat stomachs. The …
Blue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …
Hendriks’s activity explores the positive transformative power of creative impulses and the importance of fundamental free scientific research.
On the aftermath of such a historic day for Britain and the EU, it's easy to get swayed into the polarities of political discourse, particularly on social media and the Internet, where things heat up and move fast. The results of the referendum have just come out, and the Internet is already burning with tension. This is called "climate change" - just not the one you are used to hear about.
Scientists developed a procedure to repair your heart with a spinach leaf.
The phone call was as unexpected as the American accent at the other end of the line. And when she hung up a few moments later, Ira van Eelen had to stop to catch her breath. More …
A gadget called HumanCharger promises "the sun in your pocket" to give you energy, by beaming light through your ears.
A rosy-cheeked kid learns her first words, cries when her babysitter leaves, smiles when she’s happy, but she’s not real. BabyX is an AI research-in-progress by a company named Soul Machines.
Virtual reality is already becoming a part of the conversation surrounding social media. Will it become the next popular social network?
Dear Louise Brown, On behalf of the future I would like to congratulate you on your birthday. It has been 40 years that you where born into this world on July 25th 1978, …
Don’t be surprised when you catch a human face on a screen strolling through the Van Abbe museum for contemporary art in Eindhoven, as these are Europe’s very first robotic …
"To understand why a product is the way it is today, you need to learn about its evolutionary background." Meet Huub Ehlhardt, an engineer with a PhD in product design . Huub …
There was a time when flipping the switch, and seeing a glass bulb light up, was magical to anyone in the world. Today, the presence of a light switch in a room, is something …
Sex is one of the most powerful, fundamental human drives. It’s caused wars, and built and destroyed kingdoms. It occupies a significant percentage of most people’s thoughts. As …
Humans have been manipulating living things for thousands of years. Examples of early biotechnologies include domesticating plants and animals and then selectively breeding them …
During the Antarctic summer, thousands of mesmerising blue lakes form around the edges of the continent’s ice sheet, as warmer temperatures cause snow and ice to melt and collect …
Every day brings fresh and ever more alarming news about the state of the global environment. To speak of mere “climate change” is inadequate now, for we are in a “ climate …
For the past 25 years, I’ve studied everything from baboon cooperation in Ethiopia and orca whale innovation in the Bering Sea, to the Argentine ant invasion in my kitchen, and my …
The virus is forcing all of us to sit at home. While we are allowed to have social contact—albeit at an appropriate distance, intimate contact is hard to find. How to cope with …
It’s been over a decade since artificial retinas first began helping the blind see. But for many people, whose blindness originates beyond the retina, the technology falls short. …
Imagine this: you wake up on a lazy Sunday morning, trudging your way to the fridge only to be welcomed with the smell of something rotting. Did the meat expire sooner than …
If we could extend our senses in order to perceive the planet in a deeper way, would our understanding and our behavior towards it be different? We caught up with cyborg …
We now live in a world where plastics are becoming a part of our marine ecosystems. As a result, we strive hard to clean the plastics from our oceans. Dr. Max Liboiron ( Michif …
Climate change will transform how we live, but these tech and policy experts see reason for optimism
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The idea of altering your body for aesthetic purposes is still somewhat frowned upon today. But more than because the very idea of improving yourself, this is about its …
Artist Arne Hendriks gave a lustrous talk on the possibilities of downsizing humanity to better fit the earth.
The same way Einstein assumes the speed of light to be a constant of reference for his Theory of Relativity, the philosophy of biomimicry assumes Nature as a constant of reference …
From chef, to nurse, and also lover. Get ready, a new generation of robots is going to invade our lives!
Meet Amelia, the first robot to work along with human coworkers in a council job.
It's getting difficult to discern what's technology and what's not.With wearable technology becoming more and more integrated into society, our lives become infused with more technology.
In our ongoing battle against climate change, it's hard to transcend from our human position and ‘think’ like nature. Given, nature doesn't think the way humans do, but it does …
Smiling broadly and rattling with enthusiasm, the 33-year-old Rylana Doesburg shows off a QR-code on her phone: an angular pattern of black and white squares. “Thanks to this …
Agriculture may be one of the oldest of our technologies. Over time it has developed, changed, revolutionized, industrialized - or simply put, it has evolved . Today’s farms are …
It's not an easy task to define the practice of designer Jasna Rok . Fashtech pioneer? Radical innovator? Visionary designer? ‘All of the above’ seems only appropriate. In fact, …
Australian regulators will soon be faced with a challenge: can animal flesh produced in a lab be called meat? Amid reports that lab-grown meat could be on sale this year, the US …
Conventional wisdom says that you can’t replace the human touch in terms of medical care, but in our rapidly changing technological environment, it appears that this perception …
From flocks of birds to fish schools in the sea, or towering termite mounds , many social groups in nature exist together to survive and thrive. This cooperative behaviour can be …
A koala bear isn’t actually a bear, it’s a marsupial. Whales aren’t fish, they’re mammals . Tomatoes aren’t vegetables, they’re fruit . Almost nothing is actually a nut . Peanuts, …
The rise of artificial intelligence has brought us more advanced toys. If AI Barbie and her talking robotic friends are going to raise our kids, what would their parenting style …
Who are you, who do you want to be, and what do you need to do to get there? We are constantly pushed to lead the perfect life. The media present us with a picture of an existence …
A Pomeranian dog in Hong Kong grabbed the international media’s attention this week after scientists found traces of coronavirus in the canine. Following confirmation that the …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Trading animal skins for pixels, our digital selves call for a digital wardrobe. The Institute of Digital Fashion , led by CommuneEast founder Leanne Elliott Young and Digi-Gxl …
In 2020, scientists made global headlines by creating “ xenobots ” – tiny “ programmable ” living things made of several thousand frog stem cells. These pioneer xenobots could …
In conversation with architect Julia Watson, a leading expert on Indigenous technologies and author of 'Lo-TEK, Design by Radical Indigenism'.
Erich Berger has a 96 year old grandmother who is a cyborg. She features dentures, hearing aids, glasses, pace maker, a metal implant on the pinkie toe, and more. Quotes from the …
Green electricity, Organic Shampoo, Jaguar convertibles, Red Bull, Bio Beef, Alligator gardening tools, Camel cigarettes and Puma sneakers. Once you develop an eye for it, it is …
Christian Schwägerl is a correspondent for Der Spiegel and the author of Menschenzeit (The Age of Man). He will be presenting his views on the Anthropocene at the Next Nature …
It’s long been a desire of the human species to have complete control over our own thoughts. We’ve all had these moments where we curse our brain. Asking questions like: “Why …
The world’s largest indoor farm is not the only firm developing vertical agriculture. Japanese company Spread plans to grow more than ten million heads of lettuce a year by …
A road safety campaign in the Australian state of Victoria exposed an educational, yet confronting picture to raise awareness to the vulnerable human body on the road.
Here's a look at how drones can and will impact the agriculture and farming industry.
We asked Sandra Rey, our third ECO Coin Award nominee, about her company Glowee and her hopes for illuminating the future in a more sustainable way.
The human body has always been an incredible machine, from the grand feats of strength and athleticism it can accomplish down to the fine details of each vein, nerve, and cell. …
In Ancient Greece the people were part of a direct-democracy, this means that they would directly vote for policies and laws. Nowadays, it seems as though this horizontal approach …
And it’s already showing incredible results. VR transports us to faraway worlds without even asking us to leave our chairs. Yet we usually hear about it in the context of video …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
There has been a surge in awareness of the damage that plastic pollution does to our planet in recent years. It has spurred a number of campaigns to remove single-use plastics …
Would you pray to a Robot deity? A group of Japanese buddhists is already doing so. Meet Mindar , the robot divinity shaped after the buddhist Goddess of Mercy, also known as …
A few years ago, convincing meat-free “meat” was nothing more than a distant dream for most consumers. Meat substitutes in supermarkets lacked variety and quality. Plant-based …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
With gyms closed and millions cooped up and restless at home, it’s little wonder that “healthtech” is now being billed as the next big battleground over which the likes of …
The image of the whole Earth as seen from space has become a symbol of the environmental movement. Time for an update?
Humans often claim to be at the top of the food chain, but is that really the case? We are experiencing – now more than ever – our own fragility: an increase in natural disasters, …
When the first baby is born off-Earth, it will be a milestone as momentous as humanity’s first steps out of Africa . Such a birth would mark the beginning of a multi–planet …
Humans’ natural sense of privacy helps them regulate the boundaries of public and private, but fail when trying to identify privacy risks in the online world.
We spoke with the Museum of Edible Earth, a travelling museum dedicated to the prosperous amount of soil samples.
By ALEX WRIGHT, Published in NY Times December 2, 2007 The growing popularity of social networking sites like Facebook , MySpace and Second Life has thrust many of us into a new …
We are living in the future and we find it boring. The best place to gather evidence for this claim is the supermarket. To begin with, try and have a fresh look at the word: …
We tend to think of plastic as a cheap, inferior and ugly material used to make children’s toys, garden furniture and throwaway bottles. But as an experiment, imagine for a moment …
Recently, a video clip has been circulating the web that purportedly shows a rabbit born earless due to the radiation at Fukushima. BoingBoing has a convincing take-down of the …
While evidence indicates that humans domesticated themselves , we're not the only primates capable of self-domestication. Bonobos and baboons have shown they are just as capable …
Designer, artist and engineer Dan Chen has developed the ' End of Life Care Machine ', a machine designed to guide and comfort dying patients with a carefully scripted message. …
The Actroid robot holds clues for climbing out of the uncanny valley.
The humanoid robot Yangyang can function autonomously, talking and gesturing while interacting with people.
A team of cyborgs and digital enthusiasts developed a wearable technology for the body that perceives a human sixth sense.
The new Spectacles by Snap Inc. allow you to actually "make memories" (as their slogan claims) while capturing them.
Energy-backed money could help transition humanity to a more sustainable world, both environmentally and economically.
A recent study demonstrated how artificial light is a serious threat to plant pollination. It puts plant reproduction in danger, as well as the whole ecosystem.
Do you feel information overloaded? Do you experience stress? Do you feel like you are addicted to your smartphone, laptop, or the Internet? Get yourself digital detoxed!
Mythology still surrounds us, we just relate to it differently. Games and movies have replaced pantheons and folk tales. Fairies and gnomes left the forests and the rivers and moved to virtual realities.
Looking for a self-sustainable mobile microhome? Ecocapsule got you covered. This cute-as-pie capsule pod allows you to live completely off the grid in a low-energy, mobile …
Color-blind artist Neil Harbisson designed a brain-implanted antenna that converts colors into sound. This enables him to hear colors he cannot see, and extends his vision to …
This story is part of Next Generation, a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
The way people get around is starting to change, and as a professor of transport strategy I do rather wonder if the modes of transport we use today will still be around by the …
Oded Ezer is a typographer from Israel who never fails to push boundaries, or rather, discard them altogether. Ezer is a rebellious force that swings between commercial and …
The new Next Nature book is here ! Next Nature fellows, ambassadors, members and newly interested people came together on the 4th of June to celebrate the book launch with a …
Historians often trace the dawn of human civilisation back 10,000 years, when Neolithic tribes first settled and began farming in the Fertile Crescent, which stretches through …
Facial recognition is increasingly being used in many countries around the world. In some cases the take up has been dramatic . As a result, people are being observed by cameras …
We live in turbulent times. Thanks to science and technology, we are able to perceive our environment down to the atomic level. We can read DNA, manipulate cells, cut and paste …
If we are to build a greener, fairer and more equal society in the wake of COVID-19, it’s time for rich countries to end their practice of dumping plastic waste in developing …
In July 2018, a century-old red oak went live on Twitter. The account @awitnesstree , tweeting from the Harvard Forest in Petersham, Massachusetts, introduces itself in its bio: …
Assisted evolution raises complex questions. The practice involves human intervention to increase the rate of natural evolutionary processes. A technique that inevitably …
To pay tribute to the destroyed orange petunias during the Petunia crisis, Klaus Pichler has composed an illustrative book.
The free cultural paper Amsterdam Weekly discusses the Natural Revolution of and includes tree tips for successful living in the next version of nature. Download PDF (148kb) . …
May 17th 2008. Biggest Visual Power Show: Next Nature in LA . More pictures below. We are all born in a world that has been designed already. BVPS intro video by Floris Kaayk. Big …
We’ve written earlier about man–made bacteria that eat waste & shit petrol . How about a genetically modified bacteria that can eat CO2 and excrete methane that could power …
Imagine your cruise to the Galapagos came with a ghoulish warning: "Your hair will fall out, your skin will blister, you'll probably get cancer and your children's children might …
As cities push to the edges of the wilderness, wild animals are increasingly com
The surprising results of a year offline in the "real" world.
In vitro meat is creepy, unnatural and downright disgusting – and so is every other kind of food we eat.
Media artist, filmmaker and wonderjunkie Jason Silva talks about technological evolution and why humans are gods with anuses.
Outside of the limits imposed by the edges of an animal’s body, the cells can reproduce and multiply until they exhaust the nutrients and space provided, filling petri dishes and vats to grow the future of meat.
Food and Concept designer, Chloé Rutzerveld, explains her 3D food printing project Edible Growth.
The Campaign Against Sex Robots, recently launched, is pushing towards banning the continuation of sex robots development.
The new year is right around the corner, let’s forget about long-term future for a while to check out what new tech trends will hit it big in 2016. At the end of every year, …
According to a study our PC, equipped with a list of things we "Like" on Facebook , knows us better than our friends.
Google's PlaNet will be soon able to tell you where a photograph was taken by simply looking at its contents.
Replacing your old heart with a new heart from an animal may seem extreme? Well, this future may arrive sooner than we think.
It took less than 24 hours for Twitter to corrupt an innocent AI bot and teach it morally repugnant things.
Researchers prove that pristine landscapes haven’t existed for thousands of years, therefore we should change or mindset before trying to save the planet.
What if your co-worker was a robot? Dutch startup Smart Robotics is a job agency for robots that allows you to hire a smart-robot.
We met Anouk Wipprecht and talked about smart fabrics and accessories that can listen to our body, therapeutic fashion and the future of dressmaking.
Meet Josh Tetrick, entrepreneur who wants to reinvent the food industry and plans to launch lab-grown meat on the market by the end of 2018.
What if we could redesign the system to work for humanity and the planet we call home? What would the economy of ecology look like?
The way we interact with the technology in our lives is getting progressively more seamless. If typing terms or addresses into your phone wasn’t easy enough, now you can just tell …
Meet the Robo Wunderkind, a new breed of smart toys that introduces children to the basics of coding and robotics in a playful way. Advanced technologies are increasingly embedded …
Leather is one of the oldest and most versatile materials in the world. It’s a supple, tough, relatively strong and durable material and it’s relatively impermeable, yet …
The world of design is in need of new materials that align with the urgency for sustainability. Issues such as climate change, plastic waste and harmful materials require us to …
Pink chickens, synthesized tiger penises and salads grown from bodily fluids - how could they shape our future? In a Next Nature collaboration with the Gogbot Festival, the …
The Singapore Food Agency has approved “chicken bites” containing meat made from real chicken cells that were grown outside of a chicken’s body. Alongside similar news from Israel …
At just a millimeter wide, Xenobots are “neither a traditional robot nor a known species of animal", they are "a new class of artifact: a living, programmable organism”, says …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Our deficiencies have always driven us, even among our distant ancestors, back in the last Ice Age. Having neither the speed and strength to hunt large prey, nor sharp teeth and …
Although it’s seductive to think of human beings as the dominant species on earth, many others play important roles too. Bacteria, insects, algae colonies, rocks and the …
As with many of the products we consume, there’s a cost beyond what we pay at the store. Producing coffee has an environmental cost, too.
The human world often sees itself as separate from the rest of the natural world. Because we have deemed ourselves, ironically, as higher functioning beings over all others on …
Every piece of plastic that’s ever made, still exists. It results in a floating garbage dump in the ocean, full of life. While this (geo)design was never intentional, humans …
In the digital era of a globalized world, our screens have become a second set of eyes. Communication has advanced leaps and bounds, to a point where we cannot imagine a world …
A German artist refused a photography prize after admitting his image was AI-generated.
Exploring the intersection of technology and art, a team of creatives presents a virtual performance that pushes the limits of human expression.
We have identified eight key defining moments that tell the story of geodesign, from ancient insight to artificial intelligence.
When Earth goes south, cowboys go all the way up. The Space Rush of 2020s has something to do with settler colonialism.
Fakeness has long been associated with inferiority. Fake Rolexes that break in two weeks, plastic Christmas trees, leaky silicone breasts that cause cancer, imitation caviar. Even …
Are we on the verge of a future human evolution, one that isn’t, at least in it’s very core, “the survival of the fittest”, but rather “the evolution of the richer”? Think about …
My name is Jason Silva. I've spent the last 5 years hosting and producing a tv show on Al Gore's Emmy-winning Current TV network and I'm a fellow at the Hybrid Realities …
Look around you and try to find the most natural thing in the room you are in now. It is you. Now, you wouldn’t be so sure in the apocalyptic Los Angeles of 2019 depicted in Blade …
In Next Nature, not only old nature is being idealized. Because of the rapidness of new emerging technologies, we have a tendency to dwell on earlier prototypes. To recall …
Many people will have heard of the infamous swastika made up of larches that revealed itself every autumn in a forest outside Berlin . The trees, which turned yellow at the end …
Sexuality and sensuality are phenomena which have been a nature for us as long as we humans exist. Not only humans experience these phenomena; also animals experience sexuality …
If you happen to be in the neighborhood you might want to drop by at the exhibition Post Natural Organisms of the European Union in Amsterdam. The small but delicate expo, curated …
During the late 1930’s the philosopher Walter Benjamin wrote its widely influential essay ‘The work of Art in the Age of Its Technical Reproducibility’. While describing a general …
Bio-hackers developed a protocol to augment human sight to see into the near infrared range.
The top three aspects why people should support cultured meat.
Technology helps us understand the unfolding of the Anthropocene.
Stephen Hawking gives his opinion on what technological unemployment, aka machines taking over our jobs, can represent for future human societies.
The world’s largest indoor farm in Japan is 100 times more productive than traditional agriculture.
The human ear is a miracle of mechanical evolution. It allows us to hear an astonishing range of sounds and to communicate and navigate in the world. It’s also easy to damage and …
Yearly 90 million metric tonnes of methane are burped and farted into the atmosphere by cattle with effects on climate change. Researchers are looking for ways to change the cow's diet, feeding it oregano, seaweed and super grass.
With the evolving technique called EEG, electroencephalography, we can measure brain activity and ultimately even read the brain.
Future workspace, human interaction and unique experiences: here’s how artificial intelligence and VR impact on architects and engineers.
We asked Ritsert Mans, our second ECO coin award nominee about his bike, the technology that fuels it and his hopes for the future.
Read our conversation with the ECO Coin Award Winner of 2015: Yoyo Yogasmana.
The gift giving season is once again upon us and to help out those who are struggling to find that perfect gift for that special someone we have brought together a collection of Next Nature inspired gifts.
An "electronic personhood" for robots has been discussed in the European Parliament recently, raising big questions about equality, citizenship, legal and ironically, human rights for artificial intelligent machines.
If humans would disappear from the face of the Earth today, we would still leave 30 trillion tons of mass in the geological record. Certainly, "we were here" is written all over.
How many cyborgs did you see during your morning commute today? I would guess at least five. Did they make you nervous? Probably not; you likely didn’t even realize they were …
Sports have always had an important place in human societies, providing entertainment, exercise, and a demonstration of the exceptional things the human body can achieve. But in a …
Virtual reality has come a long way. Like most technological leaps, it’s had a huge push from the entertainment industry, but current applications span a wide range of social and …
We sat down with Shahar Livne, an Israeli-born designer who graduated from the Design Academy in Eindhoven to talk about her vision on the future of plastics.
Astonishingly, we’re still living in a world where most women feel uncomfortable talking about their periods and some don’t even have access to sanitary products. This is why …
Today, there's an app for everything. They help us satisfy our cravings, allow us to communicate at all times and make it easier to share special moments. But the dark, cold …
This year we are proud to announce that, with her ambitious work within the field of bioluminescence for Glowee, Sandra Rey is the ECO Coin Award 2017 winner.
Robots are coming for our jobs. Virtual reality is coming to make the jobs that remain easier to accomplish. All of the world’s manufacturing sectors are in the process of …
In response to the nitrogen crisis, the Dutch cabinet is planning to reduce the speed limit during the day to 100 kph. In itself a sensible decision. But it is strange that this …
As evolution goes on, the human body is evolving too. What does it mean to be human in times of advanced biotechnology and genetic engineering? Are our bodies ready for our …
You might already have what’s often called a “smart home”, with your lights or music connected to voice-controlled technology such as Alexa or Siri. But when researchers talk …
Transforming the way we travel is an essential part of tackling the climate crisis. The transport sector contributes about 20% of global carbon emissions . In the UK the figure is …
What does it mean to become a cyborg? Better yet, aren't we cyborgs already? What then, does it mean to have a body? Is a 'standard' desirable, what does that even mean, and what …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Interior based on bacteria, spaces morphing perception and the merging of man, animal and machine. These five must see exhibitions in the Netherlands explore the intersection of …
In the past few years, scientists have hatched some pretty crazy-sounding schemes in the name of protecting Earth and its inhabitants. From building an underwater wall 120 …
The world needs interdisciplinary creators who are designing not just for humans, but for the rest of the living planet. To foster this thinking, Biodesign Challenge (BDC) pairs …
The deepest regions of the oceans still remain one of the least explored areas on Earth, despite their considerable scientific interest and the richness of lifeforms inhabiting …
In imagining future urban landsapes, we need to answer questions about what can be sustained and what cannot, where cities can be located and where they cannot.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch: magazine@nextnature.net. …
Cyborgs - part human, part machine - are becoming more present in society, but their rights are not yet established.
What is the meaning of art on the moon? Artist on the Moon is the latest project from Icelandic visual artist Borghildur Indriðadóttir , who aims to perform for the stars and …
What if living objects could re-connect humans with their menstrual cycle and change the way we perceive it?
Wondering how next natural furniture may change your way of life? Will we feed our lamps? Grow chairs? Talk with our tables?
Researchers from the University of Colorado created a recipe book to cook with mycelium.
No self-respecting manager would be without a BlackBerry. But now these handheld gadgets, which provide workaholics with constant email updates, are being blamed for chronic …
This years edition of the Ars Electronica festival , which has been hangout for international experts from the arts and sciences for almost three decades, focuses on the nature …