Search results for Solar Energy

Visual of Solar Energy: the Hottest New Currency

Solar Energy: the Hottest New Currency

Energy-backed money could help transition humanity to a more sustainable world, both environmentally and economically.

Visual of Solar Energy Day and Night

Solar Energy Day and Night

Special balloons able to catch the rays of the sun from above the clouds, producing clean energy day and night thanks to the help of a fuel cell.

Visual of Solar Eclipse May Impact Power Supply Due to Increased Use of Solar Panels

Solar Eclipse May Impact Power Supply Due to Increased Use of Solar Panels

Solar eclipse may impact power supply due to increased use of solar panels

Visual of Rural Energy: From Kerosine to LED

Rural Energy: From Kerosine to LED

While for most of us, happy blog readers, access to electricity is taken for granted, things are quite different in developing regions of the world. In India for example, over 65% …

Visual of Using Solar Powered Drones as Satellites

Using Solar Powered Drones as Satellites

The experimental solar powered airplane Solar Impulse 2 succeeded its record-breaking journey over the Pacific. The Swiss team is now developing the next step of the project: solar drones.

Visual of Egypt's First Solar-Powered Village

Egypt's First Solar-Powered Village

This village is powered by building-integrated solar panels and provides shelter for 350 people, putting sunlight to better use.

Visual of Solar Trees

Solar Trees

Welsh designer Ross Lovegrove ('Captain Organic') placed several glowing Solar Trees in the streets of Vienna (October 2007). These solar powered streetlights could save cities …

Visual of Hacking Human Cells to Use Solar Power

Hacking Human Cells to Use Solar Power

A new biotech startup seeks to hack our cells to use solar energy instead of carbon and oxygen.

Visual of The Largest Solar Power Plant in the World

The Largest Solar Power Plant in the World

A floating photovoltaic system will lie on the waters of a Japanese dam, representing the largest solar establishment in the world.

Visual of EnergyTree

EnergyTree

The EnergyTree is a device dedicated to monitoring your household energy use. It monitors you energy output from sockets and any device that is using electricity. It also monitors …

Visual of Solar-Powered Plane Starts its Five-Month-Long Flight Around the World

Solar-Powered Plane Starts its Five-Month-Long Flight Around the World

Solar Impulse 2 is a Swiss project with the aim to enable long term flights using solar power.

Visual of Solar Tree That Provides Electricity

Solar Tree That Provides Electricity

A tree, made with 3D printed leaves that contain solar cells.

Visual of Solar Powered Electric Cars

Solar Powered Electric Cars

The sun sustains our planetary system. Its energy fuels life. And in the future, the sun will also fuel our cars. That’s the premise of Dutch startup Lightyear, a startup specialized in solar powered electric cars.

Visual of Solaris: Mind-Controlled Magnets

Solaris: Mind-Controlled Magnets

Solaris gives participants the power to control a pool of magnetic fluids with their brainwaves.

Visual of First Self Sufficient Solar-Powered Airport

First Self Sufficient Solar-Powered Airport

The Cochin International Airport is self-sufficient thanks to its solar power plant.

Visual of Drones and Robots Co-Work in Solar Farms

Drones and Robots Co-Work in Solar Farms

BladeRanger might have found the ultimate solution for solar panels cleaning putting drones and robots together at work.

Visual of A Panda Shaped Solar Plant

A Panda Shaped Solar Plant

China recently built a panda shaped solar plant to get kids interested in green energy.

Visual of Smartflower Solar Device

Smartflower Solar Device

POP is an all-in-one solar energy system that hold visible benefits for humans.

Visual of Lunar Solar Power Generation

Lunar Solar Power Generation

Japanese engineers plan to turn the moon into a giant solar panel station.

Visual of The Lightest Solar Cell Ever Made

The Lightest Solar Cell Ever Made

Researchers created solar cells as light as a soap bubble.

Visual of Chernobyl goes green: The ambitious plan to reclaim a nuclear disaster site

Chernobyl goes green: The ambitious plan to reclaim a nuclear disaster site

Chernobyl is famous as the site of the worst nuclear power accidents in history. The 1986 disaster has come to represent the perils of nuclear energy, much as Hiroshima represents …

Visual of BAT Flies High in the Sky to Make Energy

BAT Flies High in the Sky to Make Energy

Buoyant Airborne Turbine is a giant high altitude wind turbine that brings low cost energy to remote areas and off-grid sites.

Visual of Call for projects: bring your groundbreaking creativity to tackle pressing energy issues

Call for projects: bring your groundbreaking creativity to tackle pressing energy issues

We need to change the way we power our daily lives. Burning fossil fuels is the primary cause of climate change, yet this is still our main source of energy. Much of this energy …

Visual of First Entirely Transparent Solar Panel Could Transform our Cities

First Entirely Transparent Solar Panel Could Transform our Cities

Our constant need of new, cleaner energy led a Michigan State University research group to conceive a fully transparent solar panel that could replace ordinary windows.

Visual of First Solar Road Opens in France

First Solar Road Opens in France

World's first solar road opened in Normandy, France.

Visual of Energy-aware Internet-routing

Energy-aware Internet-routing

Data-hungry companies like Google, Microsoft and Amazon could reduce their energy consumption with 40% by rerouting data to locations where electricity prices are lowest on a …

Visual of Jewelry Harvests Energy from Veins

Jewelry Harvests Energy from Veins

Naomi Kizhner designed jewelry that can theoretically harvest energy from the body of the person wearing it.

Visual of Fake Grass Covered Roofs to Produce Energy

Fake Grass Covered Roofs to Produce Energy

The concept of using our rooftops to produce green, renewable energy for our houses is already very common if we look at solar panels. Now an international team of scientists is …

Visual of Will Kites Provide Wind Energy in the Future?

Will Kites Provide Wind Energy in the Future?

If you’ve watched clouds roll by, you know wind moves more steadily in the upper atmosphere. Turbines just can’t reach high-altitude wind energy. Kites can!

Visual of Free Solar Chargers in the Streets of NY

Free Solar Chargers in the Streets of NY

Solar chargers for everyday emergencies.

Visual of Energy Generated from Polluted Air

Energy Generated from Polluted Air

Scientists developed a device that converts polluted air into clean air while generating power.

Visual of Walking Energy Cells

Walking Energy Cells

Remember this one? Body heat is used to power machines in The Matrix . Nine years after the first of the trilogy came to screen, a company comes up with a body-powered-battery. In …

Visual of Bacteria that Turn CO2 into Energy

Bacteria that Turn CO2 into Energy

We’ve written earlier about man–made bacteria that eat waste & shit petrol . How about a genetically modified bacteria that can eat CO2 and excrete methane that could power …

Visual of Nano Product: Energy Belt

Nano Product: Energy Belt

With Energy Belt, stop treating your excess fat like a liability, and instead embrace its untapped potential. Artificial protocells in the belt mimic natural  brown fat, taking …

Visual of Biomechanical Energy Harvesting

Biomechanical Energy Harvesting

Let's face it: every time your cellphone battery runs empty you feel amputated and you quickly run back to your house to connect to a powering-adapter. Bionic Power Inc. is now …

Visual of Energy Consumption Shown on Power Plant

Energy Consumption Shown on Power Plant

Information decoration on a city scale. Every night from the 22 to the 29 of February 2008, the vapor emissions of he Salmisaari power plant in Helsinki will be illuminated to …

Visual of Energy Saving Chandelier

Energy Saving Chandelier

I deem you have to be over sixty to have an object with so many historical layers of media in your house. Let's analyze. We are looking at a chandelier in which the candle …

Visual of Building Grows Its Own Energy from an Algae-Farming Facade

Building Grows Its Own Energy from an Algae-Farming Facade

Algae panels make a German building completely energy independent.

Visual of Solar-Powered Donkeys to Stay Online

Solar-Powered Donkeys to Stay Online

Turkish shepherds are installing solar panels on their donkeys to stay connected.

Visual of EcoBot III: a Robot that Produces Energy Fueled by Organic Matter

EcoBot III: a Robot that Produces Energy Fueled by Organic Matter

There are robots that look like people, and then there are robots, like the Ecobot III, that look nothing like humans but have our same biological needs: they have to eat, digest …

Visual of The Future of Solar Power? Snail Teeth!

The Future of Solar Power? Snail Teeth!

The gumboot chiton snail produces the hardest biomineral known on earth - and it may hold the secret to better nanotechnology.

Visual of New Robot Turns Poo into Energy

New Robot Turns Poo into Energy

Though disgusting, sewage is an abundant, nutrient-rich resource. Researchers at the University of West England have taken advantage of this fact by creating  a robot that turns …

Visual of How a Hummingbird Creates Green Energy

How a Hummingbird Creates Green Energy

A start-up company build a wind turbine inspired by the hummingbird.

Visual of The path towards solar democracy with Marjan van Aubel

The path towards solar democracy with Marjan van Aubel

Solar cells are often considered an eyesore, used for their sustainability yet not for their beauty. Installed on roofs or in solar parks, they take up precious space. Well that’s …

Visual of Floating Green Power

Floating Green Power

Offshore renewable energy resources, such as floating solar arrays, have begun to pop up around the world.

Visual of Gathering Electricity from the Atmosphere

Gathering Electricity from the Atmosphere

"Atmospheric energy" has the power to revolutionize the production of electricity.

Visual of Marjan van Aubel wins ECO Coin Award

Marjan van Aubel wins ECO Coin Award

Each year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honor them with our ECO Coin Award . We …

Visual of POND: A symphony of lights and water

POND: A symphony of lights and water

Have you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …

Visual of Next Nature and the Curse of Oil

Next Nature and the Curse of Oil

The next step is to embrace and celebrate how cultural artifacts are escaping control, becoming autonomous, and forming the “next nature”.

Visual of Imported African Sun: Coming Soon

Imported African Sun: Coming Soon

The recently opened Noor solar power plant is now the biggest in the world. It will power Morocco and if everything goes as planned imported solar energy can be a reality too.

Visual of Making Power Stations Part of the Landscape

Making Power Stations Part of the Landscape

Can we have pretty power stations? The design of power stations is becoming more appealing.

Visual of Making Seawater into Clean Fuel

Making Seawater into Clean Fuel

Scientists have been hard at work searching for renewable energy sources. Now, a new breakthrough: the ability to produce hydrogen fuel from seawater.

Visual of An Ecstatic Dialogue with Richard Doyle

An Ecstatic Dialogue with Richard Doyle

When techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …

Visual of Jobs for Facilitators - Robots at Work #3

Jobs for Facilitators - Robots at Work #3

This is post number three of our serie 'Robots at Work'. In this episode we present you five jobs for facilitators, the ones who love to work with technology.

Visual of Electric cars might not yet be green, but we should buy them anyway

Electric cars might not yet be green, but we should buy them anyway

Transforming the way we travel is an essential part of tackling the climate crisis. The transport sector contributes about 20% of global carbon emissions . In the UK the figure is …

Visual of The return of trade: Blockchain technology is enabling trade to make a fierce comeback

The return of trade: Blockchain technology is enabling trade to make a fierce comeback

Before money came into existence, trading was all we knew. Farmers in China traded their spades for food and other goods, and this continued up until a point where most spades …

Visual of Interview: Pauline Van Dongen, Designer Merging Fashion and Technology

Interview: Pauline Van Dongen, Designer Merging Fashion and Technology

Dutch fashion designer specialized in wearable technology, Pauline van Dongen researches the human body in relation to its surroundings.

Visual of A Floating Gym in Paris

A Floating Gym in Paris

This floating gym harnesses human energy to sail down the Seine River in Paris.

Visual of In conversation with Teresa van Dongen, biodesigner exploring natural forms of artificial light

In conversation with Teresa van Dongen, biodesigner exploring natural forms of artificial light

There was a time when flipping the switch, and seeing a glass bulb light up, was magical to anyone in the world. Today, the presence of a light switch in a room, is something …

Visual of Why electric cars should be allowed to drive faster

Why electric cars should be allowed to drive faster

In response to the nitrogen crisis, the Dutch cabinet is planning to reduce the speed limit during the day to 100 kph. In itself a sensible decision. But it is strange that this …

Visual of Social Networking with Plants

Social Networking with Plants

Using energy is not a social activity. Every electrical device we use has its own carbon “foorpint” which, in excess, can harm other living beings. How and to what extent you’ve …

Visual of Fake Leaf is Twice as Efficient as the Real Thing

Fake Leaf is Twice as Efficient as the Real Thing

Improving on photosynthesis has long been a dream for scientists. The so-called artificial leaf – which wouldn't necessarily look like one – would run on only solar energy and …

Visual of Body hair helps animals stay clean – and could inspire self-cleaning technologies

Body hair helps animals stay clean – and could inspire self-cleaning technologies

Watch a fly land on the kitchen table, and the first thing it does is clean itself, very, very carefully. Although we can’t see it, the animal’s surface is covered with dust, …

Visual of Ermi van Oers wants to bring  living light to your living room

Ermi van Oers wants to bring living light to your living room

The Living Light harnesses plant energy to provide light. We spoke to its designer, Ermi van Oers, to find out more about the unique product.

Visual of A Stroll Through the Bubbles of Chemicals and Men

A Stroll Through the Bubbles of Chemicals and Men

A stunning pre-history of the anthropocene

Visual of Happy New Green 2017!

Happy New Green 2017!

A bright green is the color of 2017, a perfect choice if we take into account some of the positive developments in renewables reached during this controversial year.

Visual of How this self-sustainable microhome may change the future of housing

How this self-sustainable microhome may change the future of housing

Looking for a self-sustainable mobile microhome? Ecocapsule got you covered. This cute-as-pie capsule pod allows you to live completely off the grid in a low-energy, mobile …

Visual of Pyramid of Technology: How technology becomes nature in seven steps

Pyramid of Technology: How technology becomes nature in seven steps

How technology becomes nature in seven steps

Visual of Facebook's Internet Drone Unveiled

Facebook's Internet Drone Unveiled

Facebook introduced its solar-powered drone project aimed to provide internet access to rural areas.

Visual of Welcome to the Hearth of the Sun

Welcome to the Hearth of the Sun

Solarium, a video installation by NASA’s Solar Dynamics Observatory (SDO), puts visitors in the hearth of the sun.

Visual of ReGen, the Autarchic Off-Grid Village

ReGen, the Autarchic Off-Grid Village

Utopian off-grid ReGen Village produces all of its own food and energy is being implemented in Almere.

Visual of The future infrastructure of the blockchain might be green and humane

The future infrastructure of the blockchain might be green and humane

The connection we share through the Internet has laid the foundation for a whole new digital infrastructure, in which blockchain technology is heralded by many believers for being …

Visual of Driverless and electric, or car-free? How cities are cutting out cars, and why

Driverless and electric, or car-free? How cities are cutting out cars, and why

It’s common consensus in the tech industry that the days of cars as we know them—powered by gas, driven by humans, and individually owned by all who want and can afford one—are …

Visual of Afterlife for Atheists

Afterlife for Atheists

Where religions promise their believers a life after death and cryonics also needs a kind of belief in future technological development, designers James Auger and Jimmy Loizeau …

Visual of Snapshots from the Next Nature Lab

Snapshots from the Next Nature Lab

Last week, the young and talented designers of the Next Nature lab at the Eindhoven University of Technology presented their end of term works in an internal exhibition. There are …

Visual of Bionic Plants

Bionic Plants

Scientists designed a way to improve the efficiency of plants light harvesting during the photosynthesis, using nanotechnology.

Visual of eTree – Electric Gardening

eTree – Electric Gardening

An eco-sculpture that looks like a tree. Its foliage is made of solar panels able to produce energy.

Visual of Vertical Farms Growing In Giant Trees

Vertical Farms Growing In Giant Trees

Urban Skyfarm is a giant tree-shaped farm system for environmental improvement in food production and distribution.

Visual of France Says Adieu to Plastic Tableware

France Says Adieu to Plastic Tableware

First they banned plastic bags all over the country in July, now they released a new regulation: starting from 2020, no plastic cups, plates and cutlery can be distributed in France.

Visual of World's

World's "Coolest" Hotel

Sweden's new Icehotel 365 uses solar cooling to stay open all year.

Visual of The End of Air-Conditioning

The End of Air-Conditioning

New heat-reflective material signs the end of air-conditioning use.

Visual of Beyond Biomimicry: A New Urgency

Beyond Biomimicry: A New Urgency

Designers face an unprecedented urgency to alter their methods and reprioritize their goals to address the accelerating degradation of the environment. This new …

Visual of An introduction to Biomimicry

An introduction to Biomimicry

The first time I explained biomimicry to a stranger was not in a talk or a workshop but in a big-box bookstore just after Biomimicry: Innovation Inspired by Nature had come out. I …

Visual of 1962 Oil Company Advertisement boasts about ability to Melt Glaciers

1962 Oil Company Advertisement boasts about ability to Melt Glaciers

If this gasoline advertisement would be submitted to our infotizement contest , we would probably dismiss it for being too cynical and far fetched. Nonetheless, this ad was …

Visual of Nanotech Diatoms

Nanotech Diatoms

No, those aren't plastic trinkets or beads from a craft store. They're diatoms, a group of single-celled algae, and unlike almost all of our current technologies, they can rapidly …

Visual of

"Smart Highways" to Power Streetlights and Electric Cars

Roads are a ubiquitous, even defining aspect of our urban and suburban spaces. In the United States alone, parking lots and roads cover 16,000 square kilometers. So why must roads …

Visual of Urban Heat Causes Trees to Grow Faster

Urban Heat Causes Trees to Grow Faster

The high temperatures of urban environments causes trees to grow faster in the city than in rural areas. Researchers at Columbia's Earth Institute have discovered this by planting …

Visual of Innovative Nostalgia

Innovative Nostalgia

We humans simply feel more comfortable with technological change when it comes in a familiar form that refers to an existing and accepted object, habit, value, tradition or intuition.

Visual of Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture

Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture

Rachel Armstrong discusses living buildings, Venice's foundations, millennial nature and how to improve our future.

Visual of Shape-Shifting House Acts like a Flower

Shape-Shifting House Acts like a Flower

Imagine your home adapting itself to seasonal, meteorological and even astronomical conditions by changing its shape.  D*Dynamic is based on the discovery of mathematician Henry …

Visual of Pixel Space

Pixel Space

If the moon were only one pixel: a scale model of the solar system that shows how big our milky way actually is.

Visual of On the origin of the LED lamp

On the origin of the LED lamp

For thousands of years people used oil lamps and candles to illuminate their homes during the hours of darkness. Neither produced much light and both were inconvenient in use as …

Visual of Recreation in NextNature

Recreation in NextNature

(Not a tourist-pic from North Korea) In January this year, at the World Future Energy Summit in Abu Dhabi, Prince Willem-Alexander of the Netherlands said: "(...) My wife and I …

Visual of Sunflowers – electric gardening

Sunflowers – electric gardening

A retail lot in Austin, Texas recently sprouted a field of solar photovoltaic sunflowers that soak up the sun’s rays to provide shade while generating a steady stream of …

Visual of Antenna roofgarden

Antenna roofgarden

Don't ask me what the purpose is of having your roof crowded with antennas. Solar energy roof-gardens I could understand, but antenna roof-gardens just seem hopelessly old …

Visual of There’s Plenty of Room at the Bottom

There’s Plenty of Room at the Bottom

So you’re triggered by our call for products and now you’re considering to send in one, two or maybe three of your brilliant products for the Nano Supermarket? Good. Or – and this …

Visual of Self–Repairing Architecture

Self–Repairing Architecture

All buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …

Visual of NANO Supermarket Jury Report 2012

NANO Supermarket Jury Report 2012

After the successful introduction of the NANO Supermarket in 2010 it became even more clear that the contest and the presented results produced discussions and many challenges to …

Visual of Clothes that Turn Heat into Electricity

Clothes that Turn Heat into Electricity

With rising energy costs and our growing arsenal of iPads, smart phones, and wearable monitors, we're always on the lookout for new ways to power our devices.  Perpetua Power , an …

Visual of The Bionic Kangaroo

The Bionic Kangaroo

The BionicKangaroo technologically reproducesthe unique way a kangaroo moves.

Visual of What’s the Point If We Can’t Have Fun?

What’s the Point If We Can’t Have Fun?

Since Darwin we tend to look at the biological world exclusively in economical terms. The idea that monkey's, frogs, or even ants do more than simply propagate, doesn't find much acceptance among scientists. And yet, even crayfishes at times seem to displace objects just for fun.

Visual of Our Bodies, Our Fuel

Our Bodies, Our Fuel

This piece from Ars Technica details the breadth in the variety of energy sources emitting from our every day interactions.

Visual of 53 Shades of Blue

53 Shades of Blue

An artist installed a sculpture on the main street of Ljubljana, Slovenia, that measures the blueness of the sky.

Visual of Future Architecture: Digesting Walls

Future Architecture: Digesting Walls

The University of West England is developing living bricks, turning your walls into a digesting organism.

Visual of Turning Leaves into Batteries

Turning Leaves into Batteries

Other than decompose and give nutrition to the soil, leaves can be used to store energy, becoming the raw material of batteries.

Visual of Old Cellphones to Fight Deforestation

Old Cellphones to Fight Deforestation

A Californian engineer is using old cellphones and solar panels to save the rainforest ecosystem against deforestation.

Visual of How Much Carbon Do Your Clicks Cost?

How Much Carbon Do Your Clicks Cost?

How much carbon does a Youtube video burn? Greenpeace's #ClickClean initiative calls on big tech companies, like Google, to use renewable energy sources.

Visual of Interview: Lining Yao, Interaction Designer and Maker of Novel Materials

Interview: Lining Yao, Interaction Designer and Maker of Novel Materials

We recently interviewed Lining Yao, Chinese interaction designer who uses organic materials as a technology that brings us back to nature.

Visual of Otra Nation: Make Walls Great Again

Otra Nation: Make Walls Great Again

This group of 14 designers, engineers, builders and architects make a proposal of a wall for Trump's ambitious project.

Visual of Celebrating Dutch Water Protection: <br> Last Weeks to See 'Gates of Light'

Celebrating Dutch Water Protection:
Last Weeks to See 'Gates of Light'

If you are in The Netherlands you can explore the latest art project by Studio Roosegaarde and discover the iconic, yet historical value of the Closing Dike.

Visual of Power Aware Cord

Power Aware Cord

The Power Aware Cord transports electrical power while simultaneously visualizing energy usage. Electrical transfer is represented through glowing pulses, flow, and intensity of …

Visual of Simulacra and Simulations

Simulacra and Simulations

The simulacrum is never that which conceals the truth--it is the truth which conceals that there is none. The simulacrum is true. -Ecclesiastes If we were able to take as the …

Visual of Bacteria That Eat Waste & Shit Petrol

Bacteria That Eat Waste & Shit Petrol

Energy problem? Why not genetically alter bacteria to have them provide 'renewable petroleum'. Crude oil is only a few molecular stages removed from the acids normally excreted by …

Visual of Craig Venter – Catalyst of evolution

Craig Venter – Catalyst of evolution

If the six hour crash course on synthetic genomics is a bit too much for you, there is always a more snappy TED lecture in which Craig Venter ponders on whether we can create new …

Visual of The Playboy Interview

The Playboy Interview

In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …

Visual of FluDOC – Glowing Bacteria Show if You Have Influenza

FluDOC – Glowing Bacteria Show if You Have Influenza

Bacteria are traditionally perceived as infectious and unhealthy, but that is about to change. This week designer Jan van der Asdonk graduated from the Next Nature Lab at the TU/e …

Visual of Next Nature Introduction

Next Nature Introduction

This project - the Next Nature Network - is about Nature's brand image. One might surmise that "Nature," being 100 percent all-natural, can't have any brand image.  The facts …

Visual of Our Heart as a Power Plant

Our Heart as a Power Plant

Nanowire generators could one day lead to medical devices powered by the patient's own heart. A tiny, nearly invisible nanowire can convert the energy of pulsing, flexing muscles …

Visual of Apes Like Cooked Food, and What that Means for Human Evolution

Apes Like Cooked Food, and What that Means for Human Evolution

Humans are the only species on earth that cooks its food. Not only do we cook our food, but we usually find the flavor of cooked foods preferable to the raw version. Compare the …

Visual of Manko & The Earth [#12]

Manko & The Earth [#12]

Zero: 'Where to begin? We've had many discussions in our Lab about the future of the children. The plan was simple: to raise the kids to the physical age to be 'frozen' in. Then, …

Visual of Latro Algae Lamp

Latro Algae Lamp

As advances in nanotechnology bring us increasingly energy efficient products, plant life such as algae could become attractive sources for tapping energy. The Latro lamp by …

Visual of NANO Supermarket at Lowlands Festival

NANO Supermarket at Lowlands Festival

This weekend some of our sustainable, energy related, NANO Supermarket products are exhibited at the lustrous Lowlands popfestival . Come visit us at the Llowlab to charge your …

Visual of Turning Wind Farms into Seaweed Farms

Turning Wind Farms into Seaweed Farms

Closed to commercial shipping and fishing, offshore wind farms aren't put to much use besides generating clean energy. Ecofys , a Dutch sustainable consulting company, hopes to …

Visual of Offshore Wind Farms Generate Their Own Microclimates

Offshore Wind Farms Generate Their Own Microclimates

As we strive to milk all available energy from nature, we not only harvest but alter our surroundings in the process. By mixing the warm sea air with cooler air above, offshore …

Visual of Yes, Naturally

Yes, Naturally

The introductory essay from the Yes, Naturally book - available in our store!

Visual of GMO Trees to Simplify Paper Production

GMO Trees to Simplify Paper Production

Researchers engineered poplar trees for an easier production of paper and biofuels.

Visual of Bioprinting in the Kitchen of the Future

Bioprinting in the Kitchen of the Future

Cultivator is speculative design project on how bioprinting could find its way into the kitchen of the future.

Visual of Wireless Controlled Mouse, the Animal!

Wireless Controlled Mouse, the Animal!

A remote-controlled LED chip can make a mouse walk in circles.

Visual of A Cryptocurrency Helping to Cure Cancer

A Cryptocurrency Helping to Cure Cancer

Part two of a ten part series exploring the design of an invisible technology: money.

Visual of Diamond Batteries from Nuclear Waste

Diamond Batteries from Nuclear Waste

Researchers are turning diamonds into batteries.

Visual of Guerilla Gardening in Paris

Guerilla Gardening in Paris

Paris passed a new law that not only allows locals to plant their own urban garden around the city, but also encourages them in doing so.

Visual of Israeli Tech Turns Any Road Electric

Israeli Tech Turns Any Road Electric

ElectRoad developed a unique technology that powers the vehicle wirelessly from the road while driving.

Visual of The Next Nature Sneaker Series

The Next Nature Sneaker Series

We present for the real sneaker heads amongst us, six new futuristic pieces of footwear. Going from pineapple leather to self lacing 'Back to the Future' Nikes.

Visual of “Next Tokyo” City Plan Unveiled

“Next Tokyo” City Plan Unveiled

A proposal for a residential skyscraper in Tokyo Bay as part of “Next Tokyo”, takes into account the recurrent threats of rising sea levels, seismic activity and typhoons.

Visual of The Scandinavian Winds Power Your Internet

The Scandinavian Winds Power Your Internet

We may be still far away from pollution-free Internet browsing, but at least the next time you send an e-mail you can feel relief at the thought that the strong arctic winds of Scandinavia are keeping the Google servers cool and running.

Visual of PC Problems? Better Call a Witch!

PC Problems? Better Call a Witch!

Meet the witch who casts viruses out of computers with magic.

Visual of Dutch Trains Now Run on Wind Power

Dutch Trains Now Run on Wind Power

Dutch train passengers travel 100% on wind power.

Visual of When the Sun Casts Its Vote

When the Sun Casts Its Vote

Space weather can influence elections on Earth.

Visual of Iceland is mourning a dead glacier

Iceland is mourning a dead glacier

Death certificates and commemorative plaques aren’t something you’d normally associate with a glacier. But that is exactly how Iceland recently mourned the loss of 700-year-old …

Visual of Three ways virtual reality is revolutionizing teaching

Three ways virtual reality is revolutionizing teaching

You’ve probably heard how Virtual Reality (VR) is going to change everything: the way we work, the way we live, the way we play. Still, for every truly transformative technology, …

Visual of How fungi can help create a green construction industry

How fungi can help create a green construction industry

The world of fungi has attracted a lot of interest and seems to be becoming very fashionable of late. A new exhibition at Somerset House in London, for example, is dedicated to …

Visual of Featherless Chicken

Featherless Chicken

Behold the featherless chicken, created by Scientists at the genetics faculty at the Rehovot Agronomy Institute near Tel Aviv, Israel. The idea behind the development of this …

Visual of Green Electricity

Green Electricity

Electricity itself is a natural phenomena, but as regular AC/DC currency it becomes a commoddity. But Green Electricity is a strange thing. You pay more money for your electricity …

Visual of Humans to Blame for Global Warming

Humans to Blame for Global Warming

Global warming is "very likely" a human-caused problem that will last for centuries and require concerted international action to reduce its potentially devastating impacts, a …

Visual of MDI Air Car

MDI Air Car

Will the oil-driven car grow extinct in the decades to come? Guy Negre (Fr) thinks so, for he invented: THE CLEAN GREEN DRIVING MACHINE! Utopia is near; this (toy ) car runs on …

Visual of Economy is ecology

Economy is ecology

Nature is itself a free market system. A rain forest is an unplanned economy, as is a coral reef. The difference between an economy that sorts the information and energy in …

Visual of Hail Control Gun

Hail Control Gun

A single hail storm can destroy the year's harvest. For over 25 years, this gun has been used by vine and fruit growers in France, Spain, Austria and Belgium for one purpose: …

Visual of Search Engine

Search Engine

"Google has stationed approximately a million computers worldwide to be able to process the 40 billion searches per month. One search request uses as much energy as a low-energy …

Visual of BioStream

BioStream

A renewable energy technology company in Australia designed this power generation system inspired by the shape of the tailfins of sharks, tuna and mackerel. The currents on the …

Visual of Computer versus bacteria

Computer versus bacteria

Are bacteria faster than a computer? According a group of biological engineers they are. The scientists have done a research in which they have used the well-known bacteria …

Visual of Five strategies of Biomimicmarketing

Five strategies of Biomimicmarketing

Green electricity, Organic Shampoo, Jaguar convertibles, Red Bull, Bio Beef, Alligator gardening tools, Camel cigarettes and Puma sneakers. Once you develop an eye for it, it is …

Visual of Live with Micro-Algae

Live with Micro-Algae

The Eco Pod is a experimental design proposal towards the production of clean and renewable energy, which should operate in old, abandoned buildings. Pending an eventual recovery, …

Visual of Strategy #4: Brand It ‘Eco Friendly’

Strategy #4: Brand It ‘Eco Friendly’

The products in the fourth category don’t necessarily provide the consumer with a natural feeling. Their biomimicmarketing revolves around the claim to be ‘friendly towards …

Visual of Sunlight-shaped Furniture

Sunlight-shaped Furniture

Austrian designers Katharina Mischer and Thomas Traxler have created a solar powered machine that makes arrays of furnishings that vary based on how much sunlight it receives over …

Visual of Water Shows When the Heat is On

Water Shows When the Heat is On

Designer Carlijn Compen upgraded her watertap with some LED's that shift color along with the heat of the water. A simple yet effective example of information decoration that will …

Visual of Meet the Cellphone that drinks Coke

Meet the Cellphone that drinks Coke

Chinese designer Daizi Zheng created a conceptual mobile phone for Nokia that could be powered by cola. The idea is the phone could run on a battery that uses enzymes to generate …

Visual of Miniature Sensor Network for the Office

Miniature Sensor Network for the Office

"Have you seen my stapler? No, but just look it up on Google home office maps ." CSIRO Researchers have developed miniature sensors that track lab equipment, coffee mugs and …

Visual of Toy Emissions

Toy Emissions

You know the HeHe collective from their laser projection on a power plant emission cloud . But did you know these folks have a real emission clouds fetish going on? In this …

Visual of Animal-Free Meat Could Put a Hold on Global Warming

Animal-Free Meat Could Put a Hold on Global Warming

Growing meat in the lab, rather than slaughtering animals, could become a viable alternative for people who want to cut the environmental impact of their food consumption, but …

Visual of Bugged Bugs

Bugged Bugs

Some of you might remember the Next Nature article by Rolf Coppens called Withus Oragainstus . Since then there have been occasional newsreports on cyborg insects. For instance …

Visual of Evolutionary Janitors

Evolutionary Janitors

We normally think of polluted water as the source of disease, not the cure for it. The Gowanus Canal in Brooklyn, affectionately known as the Super Fun Superfund , is one of the …

Visual of Manufactured Rainbows

Manufactured Rainbows

Why wait for old nature to give us rainbows when we have so many ways of making our own? The image above shows solar-powered installation that uses recycled rainwater to create …

Visual of The Story of our Food

The Story of our Food

Every time we eat a piece of food, we take a bite out of the world. All these small bites tell a dozen stories. A carton of eggs presents the story of contented hens, a bottle of …

Visual of Bioinspired Robojelly Can Swim Forever

Bioinspired Robojelly Can Swim Forever

Scientists have developed a biomimetic robot that will be able to swim forever, since its artificial muscles are powered by water. And since Robojelly lives underwater, it will …

Visual of Growing Plants in the Dark

Growing Plants in the Dark

While sunlight contains all colors, the dominant type of chlorophyll in plants only needs purple light to function. This simple fact has big implications for the future of …

Visual of Power, Water and Shelter from Giant Mushrooms?

Power, Water and Shelter from Giant Mushrooms?

In his (fictional!) documentary, designer and artist Tobias Revell sketches the city of New Mumbai powered by giant mushrooms. These genetically-engineered fungal organisms …

Visual of To Generate Electricity, Just Tap on this Virus

To Generate Electricity, Just Tap on this Virus

Is your friend impatiently tapping on her phone, or is she just charging the battery? Researchers at the Berkeley Lab have produced the first virus-powered generator that runs off …

Visual of Will Eugenics Become an Acceptable Strategy to Avoid Climate Change?

Will Eugenics Become an Acceptable Strategy to Avoid Climate Change?

Climate change is one of the biggest challenges of today and various scenarios, ranging from artificial trees , pollution trading , co2 capturing to geo-engineering, have been …

Visual of Free Electricity from the Technosphere

Free Electricity from the Technosphere

Scientists learn how to harvest electricity from radio waves.

Visual of Moss Table Powers Its Own Lamp

Moss Table Powers Its Own Lamp

When moss photosynthesize, they release nutritious fats, carbs and proteins into their roots to feed colonies of helpful, symbiotic bacteria. In the process of breaking down these …

Visual of NANO Supermarket 2014 Call for Products

NANO Supermarket 2014 Call for Products

Submit your speculative product to the NANO Supermarket and win 2500 euro.

Visual of Q&A with CEO of In Vitro Meat Company

Q&A with CEO of In Vitro Meat Company "Modern Meadow"

Excerpts from the Rebbit AMA with Andras Forgacs, founder of a company that manufactures in vitro meat.

Visual of

"Soylent" Liquid Meals Will Save the World

Can a meal replacer save us money, time, and maybe even save the world?

Visual of In Vitro Recipe #3: Magic Meatballs

In Vitro Recipe #3: Magic Meatballs

Magic meatballs playfully familiarize children with the concept of in vitro meat.

Visual of Three Points in Support of In Vitro Meat

Three Points in Support of In Vitro Meat

The top three aspects why people should support cultured meat.

Visual of Transportations Of The Future

Transportations Of The Future

A selection of nine enthralling and striking concepts of future way of transportation.

Visual of Wearing Technology Under the Skin

Wearing Technology Under the Skin

UnderSkin is a device that would be implanted beneath the skin on your hand and charge off your body’s energy.

Visual of Changing your Mood on Demand with Brain-Altering Wearable Technology

Changing your Mood on Demand with Brain-Altering Wearable Technology

Thync, is a new brain-altering wearable technology that promises to “shift your state of mind and conquer life” by allowing its users to change their mood whenever they need it.

Visual of NANO Supermarket 100 m2 Pop-Up Store

NANO Supermarket 100 m2 Pop-Up Store

Our lustrous NANO Supermarket opened a 100m2 pop-up store in Stavanger, Norway.

Visual of Scientists could Reveal a Parallel Universe

Scientists could Reveal a Parallel Universe

Large Hadron Collider in Geneva will attempt to detect or create mini black holes, to reveal a new universe.

Visual of Seaweed Farms to Solve the Problem of Ocean Acidification

Seaweed Farms to Solve the Problem of Ocean Acidification

By burning fossil fuels we are responsible for the increase of carbon dioxide in the Earth's atmosphere. Aside from raising temperatures globally, this is also affecting our …

Visual of The Golden Quarter

The Golden Quarter

Some of our greatest cultural and technological achievements took place between 1945 and 1971. Why has progress stalled?

Visual of Cockroach Milk: the Next Superfood?

Cockroach Milk: the Next Superfood?

A recent research reveals that the next extra nutritious ingredient may be the liquid produced by cockrach mothers to feed their offsprings. Are you willing to try it?

Visual of I Want Wings!!!!!!!!!!!!!!

I Want Wings!!!!!!!!!!!!!!

Read Nicholas Carr's essay on the transhumanist dream of having wings.

Visual of Hyperloop Set to Change Mass Transit

Hyperloop Set to Change Mass Transit

The Hyperloop is a future transportation means that is safer, faster, and cheaper than current forms of mass transit.

Visual of Japan Is Ready to Pay Bills with Bitcoins

Japan Is Ready to Pay Bills with Bitcoins

Japan is the first country to accept the bitcoins as payment method for basic services.

Visual of Photoshop Hacks Become In Real Life Art

Photoshop Hacks Become In Real Life Art

UV Production House reflects on popular online platforms for maker culture.

Visual of One Day of Air Traffic

One Day of Air Traffic

Mike Kelly shows the entire day of traffic, in just one image.

Visual of Bionic Leaf Helps Vegetables to Grow

Bionic Leaf Helps Vegetables to Grow

Bionic leaf fertilizes crops to make them weigh 150 percent more

Visual of ECO Coin Award Interviews: Ritsert Mans

ECO Coin Award Interviews: Ritsert Mans

We asked Ritsert Mans, our second ECO coin award nominee about his bike, the technology that fuels it and his hopes for the future.

Visual of Sustainable Flying with Electric Planes

Sustainable Flying with Electric Planes

German company revealed fastest electric plane.

Visual of Tattooing Fruits and Veggies with Lasers

Tattooing Fruits and Veggies with Lasers

Eco-friendly lasers might soon replace stick-on labels on fruits and veggies.

Visual of Wind Turbines Threatens Birdlife

Wind Turbines Threatens Birdlife

A wind farm in Scotland is on hold because of its lethal killing power towards seabirds.

Visual of Earth is so strongly impacted by its human inhabitants that it's now a “hybrid planet”

Earth is so strongly impacted by its human inhabitants that it's now a “hybrid planet”

Humanity has for a long time considered itself the most important species on the planet. We are quite happy to share the world with other species, but we think we know who's in …

Visual of The future of the ECO Coin

The future of the ECO Coin

How can we design a cryptocurrency for the better of humanity and ecology? In this last chapter of the crypto deep dive series , we will dissect two kinds of blockchain …

Visual of Three scenarios for the future of farming

Three scenarios for the future of farming

Agriculture may be one of the oldest of our technologies. Over time it has developed, changed, revolutionized, industrialized - or simply put, it has evolved . Today’s farms are …

Visual of Lucas Foglia's photography explores the uneasy relationship between humans and nature

Lucas Foglia's photography explores the uneasy relationship between humans and nature

There’s no place on earth untouched by human activity: This was clear as Lucas Foglia whizzed across the vast, white expanse of Alaska's Juneau Ice Field last summer. He was …

Visual of The New Technology in Agriculture: Trees

The New Technology in Agriculture: Trees

New technologies are changing the landscape, but the latest trend reshaping rural environments and agriculture is agroforestry: the art of planting trees.

Visual of Four visions for the future of public transport

Four visions for the future of public transport

The way people get around is starting to change, and as a professor of transport strategy I do rather wonder if the modes of transport we use today will still be around by the …

Visual of Green roofs improve the urban environment – so why don't all buildings have them?

Green roofs improve the urban environment – so why don't all buildings have them?

Rooftops covered with grass, vegetable gardens and lush foliage are now a common sight in many cities around the world. More and more private companies and city authorities are …

Visual of Netflix: Symbol of quarantine

Netflix: Symbol of quarantine

Since the 16th of March 2020, the government of the Netherlands applied new measures to stop the spread of the novel coronavirus (COVID-19). Schools, cafes, restaurants and sport …

Visual of Next Generation: Hearing the first breath of Earth with Dora Lionstone

Next Generation: Hearing the first breath of Earth with Dora Lionstone

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Next Generation: The virtual infinity of Scarlett Yang

Next Generation: The virtual infinity of Scarlett Yang

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of Working with microbes to clean up electronic waste

Working with microbes to clean up electronic waste

If you were to stack up all the electronic waste produced annually around the world it would weigh as much as all the commercial aircrafts ever produced, or 5,000 Eiffel towers. …

Visual of 20k human chip

20k human chip

AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …

Visual of 24 hours economy

24 hours economy

Could the biggest, most successful discount store in the world really meet your every need? Twenty-four hours a day? That's what the TV spots are saying. Really living there. …

Visual of Entry 2006 exhibition opened

Entry 2006 exhibition opened

Today the Entry 2006 exhibition opened in the coalwashe building, Zollverein. For 100 days 'perspectives and visions in design' with over 300 exhibits from more than 20 countries …

Visual of Google Maps Mars

Google Maps Mars

Google has added it's first map of a Solar Planet to the google maps. The map of Mars provides detailed information of its mountains, craters, plaines and more (including …

Visual of Would You Like a Bouquet of Nanoflowers?

Would You Like a Bouquet of Nanoflowers?

These crystalline 'nanoflowers' were developed by Cambridge University PhD student Ghim Wei Ho. The nanostructures of silicon carbide are grown from droplets of gallium on a …

Visual of Bonsai tree table

Bonsai tree table

Somehow next nature seems to reveal itself through furniture. Earlier we've featured the treetrunk bench , the bone chair , the folding chair , sketch furniture and how to grow a …

Visual of Digizerk

Digizerk

Henk Rozema displaying his invention (2006), the digital tombstone "Digizerk". It was only a question of time that global digitalization would be introduced on cemeteries. The …

Visual of Next Nature Interview

Next Nature Interview

For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …

Visual of Sleeping beauty

Sleeping beauty

Where there is light, there is life. When you switch on the lamp, it provides you with light. You provide it with the generating power it needs togrow. Similar to living …

Visual of Tulip Island - Design a Polder

Tulip Island - Design a Polder

A proposal to gain 600.000 m 2 of land near the Dutch coast recently came from the CDA (Dutch Christian-Democratic political party). The idea is to create a tulip-shaped island …

Visual of Fatigue Risk Management

Fatigue Risk Management

"Through individual assessments, employee training and EnergyPods, MetroNaps can help you improve the safety of your workplace, the health of your employees and the productivity …

Visual of Green Blues: Biofuels add to Global Warming

Green Blues: Biofuels add to Global Warming

It is official: the Green Blues has begun. Almost all bio-fuels used today cause more greenhouse gas emissions than conventional fuels if the full emissions costs of producing …

Visual of Green Roofs for Living

Green Roofs for Living

This impression shows the ambitions of the city of Rotterdam for the coming decade. The city is supposed to have an image problem concerning its greenlife; as a big industrial …

Visual of Oil Price Threatens Biofuel Firms

Oil Price Threatens Biofuel Firms

Economy is ecology? Technology Review writes the price of oil has dipped to levels that could be far too low for many advanced-biofuel startups to succeed, especially those that …

Visual of Smart Forests - EWAN

Smart Forests - EWAN

At Massachusetts Institute of Technology , Christopher Love and colleagues are working to find out whether energy from trees can be used to prevent forest fires. A sensor system …

Visual of Soil Lamp

Soil Lamp

The design of Marieke Staps  used free and environment-friendly energy to create light. The metabolism of biological living produces enough electricity to burn the LED. The only …

Visual of A Society of Simulations

A Society of Simulations

An interviewer once asked Pablo Picasso why he paints such strange pictures instead of painting things the way they are. Picasso asks the man what he means. The man then takes out …

Visual of A.T.R.E.E.M.

A.T.R.E.E.M.

Meet A.T.R.E.E.M. (acronym for Automated Tree-Rental for Emission Encaging Machine), a device that compares daily activities, energy and products to the growth of a tree. "From an …

Visual of Cyborg Insects

Cyborg Insects

Scientists at the University of California created a neural implant for a beetle that gives them wireless control over the insect. Electrical signals delivered via the electrodes …

Visual of Ecology – A New Opium for the Masses

Ecology – A New Opium for the Masses

Marxist philosopher Slavoj Žižek discusses the 'naturalization' of capitalism and how ecology became a new field of capitalist investment. He also argues that the ultimate …

Visual of Economy, as Seen From Space

Economy, as Seen From Space

Reliable data on economic growth is hard to come by in many parts of the world, especially in developing countries. Yet according to scientists, outer space offers a new …

Visual of Fresh from the Pharm

Fresh from the Pharm

Will we in the future still buy several needs according food in shops, or will we grow M&M’s ourselves? There is a lot happening on in the field of food technology , think for …

Visual of Growing a nano forrest

Growing a nano forrest

John Hart, assistant professor of mechanical engineering at the University of Michigan, is inventing techniques for growing carefully structured forests of high-quality carbon …

Visual of Growth economy hits the ceiling?

Growth economy hits the ceiling?

We have lived for 200 years in a growth economy . That's more than a lifetime, so it is no surprise people tend to think of economy as infinitely growing. Herman Daly , who …

Visual of LHC – How physics becomes metaphysics

LHC – How physics becomes metaphysics

Little over a week after the Large Hadron Collider (LHC) became operational it broke down. As the world's largest particle accelerator isn't working, c omputer simulations are the …

Visual of Orthorexia Nervosa: the

Orthorexia Nervosa: the "healthy" eating disorder

Following anorexia nervosa (under eating) and bulimia nervosa (overeating and compensating), orthorexia nervosa (obsessively healthy eating) is the latest eating disorder in the …

Visual of Pollution trading – savior or scam?

Pollution trading – savior or scam?

While most people are still prudently changing light bulbs and recycling coffee cups to fight global warming – or at least their gnawing conscience – policy-makers have long moved …

Visual of The Next Hacking Frontier: Your Brain

The Next Hacking Frontier: Your Brain

WiredScience writes: Hackers who commandeer your computer are bad enough. Now scientists worry that someday, they’ll try to take over your brain. In the past year, researchers …

Visual of The World Without Technology

The World Without Technology

I remember the smoke the most. That pungent smell permeating the camps of tribal people. Everything they touch is infused with the lingering perfume of smoke – their food, …

Visual of The World's first Refrigerated Beach

The World's first Refrigerated Beach

Conspicuous consumption in the overdrive: The world's first refrigerated beach is to be built at a luxury hotel in the Dubai (aka the new Las Vegas) so the tourists don't burn …

Visual of Botnet Storm

Botnet Storm

No, this is not some solar system far, far away. Closer than you think, this is is a visualization of a botnet storm . For all you know this malicious virus, or one of its …

Visual of Go forth, Buy a Smartphone and Reproduce Thyself

Go forth, Buy a Smartphone and Reproduce Thyself

It took some years of evolution to turn sex (between different sexes) from a stricly functional activity attuned to reproduction, into the recreational activity it is primarily …

Visual of Grapple – a Grape flavored Apple

Grapple – a Grape flavored Apple

They say “An apple a day keeps the doctor away”, but now we wonder what this keeps away, the Grapple , a hyperfruit that "Grunches like an Apple. Tastes like a Grape." The …

Visual of Infobesity

Infobesity

Could this 2.0-bird be suffering from Infobesity ? Then it must be the result of excessive infocalorie consumption. Following people and news-sources on microblogservices like …

Visual of Join the Designers & Artists 4 Genomics Award

Join the Designers & Artists 4 Genomics Award

So, you are well aware that biotech will drive our evolution , you took the crash course on synthetic genomics , you've got your map of the DNA world in your backpack and are now …

Visual of Join the Synthetic Aesthetics project

Join the Synthetic Aesthetics project

So, you are aware biotech will drive our evolution , you took the crash course on synthetic genomics , you've got your map of the DNA world in your backpack and are now eager to …

Visual of Keep it cool with the Bio-Robot Fridge

Keep it cool with the Bio-Robot Fridge

The Bio Robot fridge is a speculative product that uses a non sticky, odourless gel to envelope stored food as individual pods. The idea is that the gel cools by absorbing heat …

Visual of Nano Supermarket – Jury Report

Nano Supermarket – Jury Report

Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …

Visual of Natural-Born Junkies

Natural-Born Junkies

Hippopotamus: a 2,5cm-long tablet-shaped nonliving chewable animal, member of a multi-species flock known as the Animal Parade, which tastes like fruit and is found in little pill …

Visual of Nature Preservation: The Literal Version

Nature Preservation: The Literal Version

* warning: high doses of irony detected in this article * Method #01: Canning Promotional gift 'Nature in a can' complete with soil and bean plant seeds (from DKNY , 2010). Method …

Visual of Nomadic Plants

Nomadic Plants

Nomadic Plants are a species assembled from a group of robotic-electronic-biological organisms living in symbiosis in order to survive in habitats affected by human activity. The …

Visual of Oil Diet: Recipes for Disaster

Oil Diet: Recipes for Disaster

Do you know how much oil you use per day? Neither did director John Webster. In 2005 he decided to make a documentary about oil from his own families perspective. How would it be …

Visual of The Buttons

The Buttons

Nowadays buttons are completely mundane and natural objects in our environment. You find them on phones, alarm clocks, keyboards, elevators, dishwashers and of course on the …

Visual of Anthropomorphobia

Anthropomorphobia

Are you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …

Visual of City Planning with Bright Bacteria

City Planning with Bright Bacteria

Renegade architect and futurist  Rachel Armstrong has proposed that our cities, currently constructed of dead trees, baked mud, and refined ore, need to be coated in a layer of …

Visual of Disgusting Switches

Disgusting Switches

If a light switch would be hairy or snotty nobody would want to turn on the light anymore, which is exactly why designer Katrin Baumgarten created some of the most one nauseating …

Visual of Get Thee Up into a Fake Mountain

Get Thee Up into a Fake Mountain

If you felt like building a 2,000 meter mountain in the Netherlands, which features would you like to add? Journalist and accidental landscape visionary Thijs Zonneveld wants to …

Visual of Humane Technology #2: Revive Human Intuitions

Humane Technology #2: Revive Human Intuitions

Our second principle: Humane technology revives human intuitions, in particular those we might have forgotten about. 'Conventional' technology aims to overcome our hominid …

Visual of Incredibly Shrinking Humanity

Incredibly Shrinking Humanity

Arne Hendricks thinks we can solve the ecological crisis by shrinking every human on earth to 50cm tall: http://bit.ly/sxxNr1 #powershow

Visual of Manko & Life [#8]

Manko & Life [#8]

Manko sighed. Nada: 'Did you like it?' Manko: 'I have to admit that if this is the starter, I'm not sure I'll survive the main course.' Everyone at the table laughed. Manko: 'Let …

Visual of Parks & Planes

Parks & Planes

Along with a library and museum, Amsterdam's Schiphol Airport recently added a park to its list of attractions. Officially opened by Princess Irene, the first Airport Park in the …

Visual of Should we clone Neanderthals?

Should we clone Neanderthals?

If Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …

Visual of Streetlight Trees

Streetlight Trees

We all know the cellphone masts disguised as trees , created in an attempt to blend technology within the 'natural' landscape. Now Taiwanese scientists have created trees that …

Visual of Tattoo 2.0

Tattoo 2.0

As a child you probably had one of those temporary tattoos that come packed with over-sweetened chewing gum. It was a nice decoration, and a way to stand out. Recently researchers …

Visual of The Incredible Shrinking Man

The Incredible Shrinking Man

It has been a trend for people to grow taller and taller during the evolution. When people get taller, they will need more energy, food and space. Since the human population is …

Visual of The Sound of the Blue Canary

The Sound of the Blue Canary

Blue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …

Visual of We Domesticated Ourselves

We Domesticated Ourselves

Our bodies are maps of our ancestor's social lives.  We evolved, physically and behaviorally, in incredibly complex social groups.  Such intense sociability may have favored the …

Visual of Algae in the Supermarket

Algae in the Supermarket

As mentioned  earlier , the world seems obsessed with algae. Not limited to producing light or energy , algae has also found its way to our plate as a new vegetable, and maybe …

Visual of Antifreeze from Fish Blood Keeps Low-Fat Ice Cream Rich and Creamy

Antifreeze from Fish Blood Keeps Low-Fat Ice Cream Rich and Creamy

Fat is what makes ice cream taste rich and creamy. It's called ice cream, after all, not ice skim milk. So how have some manufacturers managed to make reduced fat ice cream that …

Visual of Arne Hendriks – Incredible Shrinking Man

Arne Hendriks – Incredible Shrinking Man

Artist Arne Hendriks explores the possibilities and implications of downsizing the human species to better fit the earth.

Visual of Artificial Islands for a Tsunami-Proof Japan

Artificial Islands for a Tsunami-Proof Japan

Keiichiro Sako of  Sako Architects  has proposed constructing giant, drum-shaped islands on dry land as a means to protect residents of Tohoku from future tsunamis. The elevated …

Visual of Bacteria

Bacteria "R" Us

There is a domain of creatures that diffusively encircles an entire planet. There are so many of them that they occupy every conceivable ecological niche. Yet, despite their …

Visual of Better Than Nature?

Better Than Nature?

At the turn of the millennium, miniaturized canines acquired the cherished status of living, designer handbag ornaments.  These teeny tiny photogenic doggies, which had been …

Visual of Four Objections to Lab-Grown Meat

Four Objections to Lab-Grown Meat

In vitro meat has been billed as a way to  end animal suffering , put a stop to global warming , and solve the world's insatiable demand for animal protein. There's no doubt that …

Visual of Hybrid Hummer

Hybrid Hummer

There is something lustrous about a hummer pulled by horses. Peculiar image of the week.

Visual of Thijs Zonneveld – Let's build a Mountain

Thijs Zonneveld – Let's build a Mountain

“God created the world, except for the Netherlands. That the Dutch created themselves” , Voltaire remarked in the eighteenth century already to describe the overly cultivated …

Visual of Little Green Cows

Little Green Cows

The world is alight with algae fever. In this age of deep ecological design aspirations, the range of speculative design projects based on algae technology is growing. Algae are …

Visual of NANO Supermarket Unveils New Products

NANO Supermarket Unveils New Products

From sleek fashion to life-saving medicines. During the forthcoming Dutch Design Week , our lustrous NANO Supermarket debuts a new line of speculative nano products that might hit …

Visual of Nature Ludens: The Natural World at Play

Nature Ludens: The Natural World at Play

An ingenious Russian crow that used a lid as a snowboard to slide down a snowy roof persuaded millions of YouTube viewers that animals are not merely beasts of burden – they also …

Visual of The Ecological Human

The Ecological Human

The nature of humanity in the twenty-first century is, according to sociologist Steve Fuller, a ‘bipolar disorder’ beset with dualisms of identification such as divine/animal, …

Visual of “Soccket” Ball Generates Free Electricity

“Soccket” Ball Generates Free Electricity

It looks like a normal soccer ball, but Soccket has a secret: a hole for a charging cable. Designed by two Harvard students, the ball has a pendulum-like mechanism inside that …

Visual of Andras Forgacs on Victimless Leather

Andras Forgacs on Victimless Leather

Andras Forgacs argues that bioengineering meat and leather is a civilized way to move beyond slaughtering animals for hamburgers and handbags.

Visual of Cow Poower! Bacteria Turn Poo into Fuel

Cow Poower! Bacteria Turn Poo into Fuel

Farmers in the US are producing fuel and high-quality fertilizer from their cows' manure.

Visual of Did Monogamy Make Us Human?

Did Monogamy Make Us Human?

Pair-bonding sets humans apart from our relatives. But where did it come from?

Visual of From Eco-Apartheid to Earth Democracy

From Eco-Apartheid to Earth Democracy

Do humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.

Visual of Get Ready for the Arctic to Bloom

Get Ready for the Arctic to Bloom

In the warming Arctic, an area the size of the US is now covered in vegetation.

Visual of Let's Build a Garden on Mars

Let's Build a Garden on Mars

One would need a gardening robot, fitted plant species and some kind of dome structure for the plants to grow in.

Visual of Why Meat Grown in Labs is the Next Logical Step for Food Production

Why Meat Grown in Labs is the Next Logical Step for Food Production

Lab grown meat is part of the trajectory that agricultural technology is already following.

Visual of The Holy Grail of Immortality

The Holy Grail of Immortality

Injecting mice with telomerase enables them to live 24% longer than the average mouse.

Visual of Toss the Brita: Bacteria Can Filter Antibiotics from Water

Toss the Brita: Bacteria Can Filter Antibiotics from Water

Filter and recover antibiotics from drinking water using only bacteria, water and sunlight.

Visual of Totem Animals for the Anthropocene

Totem Animals for the Anthropocene

Invasive species become the animal symbols for a man-made world.

Visual of World's First In Vitro Hamburger Arrives

World's First In Vitro Hamburger Arrives

Break out the ketchup: Mark Post has grown the world's first entirely artificial burger from cultured beef cells.

Visual of You Can Never Go Back To Nature

You Can Never Go Back To Nature

One of the arguments that environmentalists use against factory farming and burning fossil fuels is that these activities are "unnatural" or that they "go against nature." But …

Visual of A Net will Collect Debris from Outer Space

A Net will Collect Debris from Outer Space

JAXA developes a net that could collect debris from outer space.

Visual of Electricity From Plants

Electricity From Plants

A new technology enables us to produce electricity from living plants at practically every site where plants can grow.

Visual of Glow in the Dark Trees

Glow in the Dark Trees

Daan Roosegaarde is exploring possibilities to replace streetlights with luminous trees.

Visual of Growing Crops with Video Projections

Growing Crops with Video Projections

Growing plants with projected YouTube videos.

Visual of Growing the Future of Meat

Growing the Future of Meat

Outside of the limits imposed by the edges of an animal’s body, the cells can reproduce and multiply until they exhaust the nutrients and space provided, filling petri dishes and vats to grow the future of meat.

Visual of In Vitro Meat: Animal Liberation?

In Vitro Meat: Animal Liberation?

Many people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.

Visual of Join the Bio Art & Design Awards

Join the Bio Art & Design Awards

So, you are well aware that biotech will drive our evolution , you took the crash course on synthetic genomics , you’ve got your map of the DNA world in your backpack and are now …

Visual of Learning Circuits While Playing With Clay

Learning Circuits While Playing With Clay

Kids learn the basics of electric circuits while playing with clay.

Visual of Love your monsters

Love your monsters

Why we must care for our technologies as we do our children.

Visual of Monster Machine Swallows Tree in 15 Sec

Monster Machine Swallows Tree in 15 Sec

15 seconds, that is the time it takes the mulcher monster to consume a 9 meter-tall, mature spruce – starting at the top, landing at the bottom.

Visual of Self-Assembling Fungus Tower

Self-Assembling Fungus Tower

Hy-Fi, a structure built from a combination of corn husks and fungus.

Visual of Super Computer Chips

Super Computer Chips

Indium gallium arsenide couldbe the material of the new super computer chips of the future.

Visual of The Anthropocene Explosion

The Anthropocene Explosion

We have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.

Visual of A Tiny Trackpad That Fits on Your Nail

A Tiny Trackpad That Fits on Your Nail

Researchers from the Massachusetts Institute of Technology have developed a tiny wireless trackpad that could easily fit on your finger nail.

Visual of Bio Art & Design Awards 2015

Bio Art & Design Awards 2015

If we are going to mutate the made & the born, let us at least do this creatively.

Visual of First Bionic Rose with Electronic Circuits

First Bionic Rose with Electronic Circuits

For the first time, researchers at the University of Linkoping , Sweden, have succeeded in establishing organic circuits within living plants. They combined electronics with the …

Visual of Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society

Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society

We recently talk to Nadine Bongaerts about the role and impact of synthetic biology, the gap between bio­sciences and society and the importance of communication to overcome the fear of new technologies.

Visual of Intimate Technology: the Battle for Our Body and Behaviour

Intimate Technology: the Battle for Our Body and Behaviour

Technology is nestling itself within us and between us, has knowledge about us and can act just like us.

Visual of Manta Ray Floating City

Manta Ray Floating City

French visionary architect Jacques Rougerie designed a utopian floating city shaped like a manta ray.

Visual of MIT Lets Robot Cheetah Off Leash

MIT Lets Robot Cheetah Off Leash

Robot Cheetah has grown up! Scientists at MIT's Biometrics Robotics Lab have now trained their robo-feline Cheetah to detect obstacles and jump over hurdles as it runs, making it …

Visual of NNN Movement & the First ECO Coin

NNN Movement & the First ECO Coin

We officially launched the Next Nature Movement in The Netherlands. To seal the beginning of the Next Nature Movement, director Koert van Mensvoort donated the first symbolic ECO coin.

Visual of See Through the Skin with Your Smartphone

See Through the Skin with Your Smartphone

In the near future he ability to see through things won’t be a dream anymore with this infrared smartphone camera.

Visual of Seeing the Sun Through Data

Seeing the Sun Through Data

The Smithsonian’s National Air and Space museum has taken the sun observation to the next level with a giant public display of images and data that show the sun in hyper-real detail.

Visual of The Risk of Technological Unemployment

The Risk of Technological Unemployment

Stephen Hawking gives his opinion on what technological unemployment, aka machines taking over our jobs, can represent for future human societies.

Visual of The Designer who Grows Furniture

The Designer who Grows Furniture

Gavin Munro is creating a farm where planted trees can be grown around braces and harvested as fully formed chairs, sculptures, lamps, and tables.

Visual of The Emergence of 4D Printing

The Emergence of 4D Printing

An inspiring TED talk by computational architect Skylar Tibbits about 4D printing, where the fourth dimension is time.

Visual of Agriculture Isn’t as Green as You Think

Agriculture Isn’t as Green as You Think

Agriculture today isn’t where it needs to be. Here’s how farmers are taking the next step for better agriculture tomorrow

Visual of Edible Battery for Ingestible Devices

Edible Battery for Ingestible Devices

Researchers at Carnegie Mellon University are developing edible batteries to power ingestible medical devices for diagnosing and treating disease.

Visual of The Enlightenment Is Dead, Long Live the Entanglement

The Enlightenment Is Dead, Long Live the Entanglement

We humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.

Visual of Google Sheep View

Google Sheep View

The Faroe Islands invented Google Sheep View 360.

Visual of Insects are helping us develop the future of hearing aids

Insects are helping us develop the future of hearing aids

The human ear is a miracle of mechanical evolution. It allows us to hear an astonishing range of sounds and to communicate and navigate in the world. It’s also easy to damage and …

Visual of Luminous Bike Lane Opened in Poland

Luminous Bike Lane Opened in Poland

The first self-sufficient luminous bike lane opened last week in Poland.

Visual of Meet the Weather Drone

Meet the Weather Drone

The Weather Drone controls the weather, it makes sure the sun will shine on your birthday, or that the rain will fall during a period of drought.

Visual of An Edible Drone for Humanitarian Aid

An Edible Drone for Humanitarian Aid

Nigel Gifford is developing a drone that will be relatively inexpensive, disposable and edible.

Visual of This Robotic Stingray is Alive

This Robotic Stingray is Alive

By way of reverse engineering and taking heart cells from a rat, researchers at Harvard University have designed a miniature robotic stingray that is alive.

Visual of Meeting the Future at TodaysArt

Meeting the Future at TodaysArt

Last week The Hague hosted a festival dedicated to contemporary experiments in music, art and digital culture.

Visual of Welcome to the City Made of Bone

Welcome to the City Made of Bone

Our cities are made out of steel and concrete. What if we replace them with wood and bone?

Visual of 1999 - Ectogenesis Enters The Matrix

1999 - Ectogenesis Enters The Matrix

The movie The Matrix brought ectogenesis to the public eye.

Visual of Animal Free Cow Milk

Animal Free Cow Milk

A San Francisco-based start up discovered a way to "brew" milk that has zero hormones, antibiotics, steroid or lactose inside, and a longer shelf-life.

Visual of Animal Tsunami Alerts from Space

Animal Tsunami Alerts from Space

Global data about animal movements are indispensable in our today international networked world to understand how to safe human health and wildlife simultaneously.

Visual of Architects, You Better Design Cars!

Architects, You Better Design Cars!

Hyundai envisions a future where your smart home is your driverless car, and vice versa.

Visual of A Whole Forest on a Surface Area of 3.5m2

A Whole Forest on a Surface Area of 3.5m2

Using moss cultures, the "CityTree" captures and filters toxic pollutants from the air, with the same environmental impact of 275 trees.

Visual of ECO Coin Award 2017 Nominations Open

ECO Coin Award 2017 Nominations Open

The nominations for the ECO coin Award 2017 are now officially open. Let us know who you think deserves to earn the award.

Visual of ECO Coin First Trial at DGTL 2017

ECO Coin First Trial at DGTL 2017

We had a wonderful first run of the ECO Coin during DGTL festival in Amsterdam.

Visual of ECO Coin Goes to DGTL Festival 2017

ECO Coin Goes to DGTL Festival 2017

This year the ECO coin will run its first community experiment with our partners at DGTL festival. Come and earn your first ECO!

Visual of ECO Coin Award Interviews: Sandra Rey

ECO Coin Award Interviews: Sandra Rey

We asked Sandra Rey, our third ECO Coin Award nominee, about her company Glowee and her hopes for illuminating the future in a more sustainable way.

Visual of ECO Coin Lab at Welcome to the Village

ECO Coin Lab at Welcome to the Village

Last weekend the ECO coin ran its second living lab at Welcome to the Village festival. We wanted to experiment with making our new sustainable currency more social and test our new ECO coin payment system.

Visual of Fellow Day 2017: Next Habitat

Fellow Day 2017: Next Habitat

Last week, our NNN fellows gathered to discuss the Next Habitat; how will we work in the future? And how does this affect our personal lives?

Visual of Flying Car Modular Transport System

Flying Car Modular Transport System

Airbus and Italdesign unveil modular urban land and air transport system.

Visual of From Industry 1.0 to Industry 4.0

From Industry 1.0 to Industry 4.0

Warehouse management practices and processes evolved with the time, but they’ll need to maintain their adaptability to accommodate Industry 4.0.

Visual of An afternoon with Josh Tetrick: The man who wants to bring in vitro meat to the market by 2018

An afternoon with Josh Tetrick: The man who wants to bring in vitro meat to the market by 2018

Meet Josh Tetrick, entrepreneur who wants to reinvent the food industry and plans to launch lab-grown meat on the market by the end of 2018.

Visual of Looking into the Artificial Eye

Looking into the Artificial Eye

Sensor specialists recently developed a sensor that mimics the mammalian eye.

Visual of Next Nature Gift Guide 2017

Next Nature Gift Guide 2017

The gift giving season is once again upon us and to help out those who are struggling to find that perfect gift for that special someone we have brought together a collection of Next Nature inspired gifts.

Visual of Recharge! Sun for Your Brain Cells

Recharge! Sun for Your Brain Cells

A gadget called HumanCharger promises "the sun in your pocket" to give you energy, by beaming light through your ears.

Visual of From Shopping Center to Urban Farm

From Shopping Center to Urban Farm

Rooftop farm takes over Israel’s oldest mall to grow thousands of organic vegetables.

Visual of Skyscraper Hanging from the Sky

Skyscraper Hanging from the Sky

What if we rethink the system and instead of building from earth to sky, we do it the other way around?

Visual of Smog Free Bicycles

Smog Free Bicycles

Introducing bicycles to purify pollution as you pedal.

Visual of Transformative Appetite: Shape-Shifting Pasta

Transformative Appetite: Shape-Shifting Pasta

MIT Media Lab developed pasta programmed on a computer.

Visual of The Water-Cleaning Bike

The Water-Cleaning Bike

How about a peddling ride accompanied by the sound of babbling water, with the awareness that what you are leaving behind is nothing else but clean water?

Visual of World’s First Lab-Grown Chicken Is Here

World’s First Lab-Grown Chicken Is Here

Memphis Meats reveals world’s first lab-grown chicken.

Visual of How AI and genomics will impact the future of making babies

How AI and genomics will impact the future of making babies

As if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …

Visual of This artwork lets trees tell the story of climate change

This artwork lets trees tell the story of climate change

In our ongoing battle against climate change, it's hard to transcend from our human position and ‘think’ like nature. Given, nature doesn't think the way humans do, but it does …

Visual of Here’s how the Dutch are embracing blockchain in the polder

Here’s how the Dutch are embracing blockchain in the polder

Smiling broadly and rattling with enthusiasm, the 33-year-old Rylana Doesburg shows off a QR-code on her phone: an angular pattern of black and white squares. “Thanks to this …

Visual of Adding a new dimension to marine restoration: 3D printing coral reefs

Adding a new dimension to marine restoration: 3D printing coral reefs

The local fishermen looked on skeptically. From the deck of a small motorboat, scuba divers grabbed odd chunks of ceramic – which could be described as rocky brains stuck on …

Visual of The return of direct democracy: Introducing a digital agora to the crypto-world

The return of direct democracy: Introducing a digital agora to the crypto-world

In Ancient Greece the people were part of a direct-democracy, this means that they would directly vote for policies and laws. Nowadays, it seems as though this horizontal approach …

Visual of Your Next Nature guide to Dutch Design Week 2018

Your Next Nature guide to Dutch Design Week 2018

Over time, our bodies, our food and our environment have become more and more subject to design. As designers, we hold the responsibility and have the unique chance to envision …

Visual of Interview: Huub Ehlhardt on the evolution of products

Interview: Huub Ehlhardt on the evolution of products

"To understand why a product is the way it is today, you need to learn about its evolutionary background." Meet Huub Ehlhardt, an engineer with a PhD in product design . Huub …

Visual of Should lab-grown meat be labelled as meat when it's available for sale?

Should lab-grown meat be labelled as meat when it's available for sale?

Australian regulators will soon be faced with a challenge: can animal flesh produced in a lab be called meat? Amid reports that lab-grown meat could be on sale this year, the US …

Visual of Scientists accidentally create mutant enzyme that eats plastic bottles

Scientists accidentally create mutant enzyme that eats plastic bottles

Scientists have created a mutant enzyme that breaks down plastic drinks bottles – by accident. The breakthrough could help solve the global plastic pollution crisis by enabling …

Visual of Next Nature Gift Guide 2018

Next Nature Gift Guide 2018

The season of giving has come and to make sure you can find the perfect gift for your loved ones we have brought together a collection of Next Nature inspired goodies. Whether you …

Visual of On the origin of the e-bike

On the origin of the e-bike

The oldest known serious candidate forerunner for the bicycle is the ‘running machine’ built by the German Baron Karl von Drais. His two-wheeled machine became known as the …

Visual of ReTuna: the Shopping Mall Selling Nothing but Recycled Products

ReTuna: the Shopping Mall Selling Nothing but Recycled Products

A Swedish shopping center is bucking the trend of mindless consumption. At the ReTuna Återbruksgalleria every product is made of recycled materials.

Visual of The Story of Money: Bits

The Story of Money: Bits

The story of money: an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. The final episode: bits.

Visual of How an app is helping restaurants cut food waste

How an app is helping restaurants cut food waste

Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …

Visual of Air pollution may be making us less intelligent

Air pollution may be making us less intelligent

Not only is air pollution bad for our lungs and heart , it turns out it could actually be making us less intelligent, too. A recent study found that in elderly people living in …

Visual of Why Next Nature Network is hiring an army of bots

Why Next Nature Network is hiring an army of bots

As we showed with HUBOT , we can use new technologies and robotics to make our work more enjoyable, interesting and humane. Aside from our speculative jobs, a lot of robotic …

Visual of Bio textiles: Meet six designers changing the future of fashion

Bio textiles: Meet six designers changing the future of fashion

We live in a world of fast or disposable fashion. This industry is increasingly impacting the environment due to the use of toxic chemicals, water and energy consumption, heavy …

Visual of Five must-see exhibitions before 2020

Five must-see exhibitions before 2020

A large-scale asian food market serving in vitro meat, a transatlantic expo on the future of nature and a travelling exhibition that explores our relationship with AI. These five …

Visual of Discover the art of the living at Centre Pompidou

Discover the art of the living at Centre Pompidou

Go forward to nature at the La Fabrique du Vivant (the Factory of Life), the newly opened exhibition at the Centre Pompidou in Paris. Exhibiting the recent works of fifty …

Visual of NATURE: Where biology and design merge

NATURE: Where biology and design merge

Cube Design Museum in Kerkrade and Cooper Hewitt in New York present the comprehensive exhibition NATURE - in which internationally renowned designers, artists and inventors …

Visual of Next Nature gift guide 2019

Next Nature gift guide 2019

Whether you're in need of a holiday gift for your techie spouse or tech-adverse grandpa, the truth is, your loved ones deserve better than a generic gift card. Now we understand …

Visual of Next Nature book launch: here's what you missed

Next Nature book launch: here's what you missed

The new Next Nature book is here ! Next Nature fellows, ambassadors, members and newly interested people came together on the 4th of June to celebrate the book launch with a …

Visual of The Coming World: Ecology as the new politics

The Coming World: Ecology as the new politics

In science fiction and popular science, 2030 is often suggested as the year in which our planet will run out of oil. Similarly, 2100 will be the year that, according to …

Visual of Smart cities could give the visually impaired a new outlook on urban life

Smart cities could give the visually impaired a new outlook on urban life

Travelling to work, meeting friends for a catch up or just doing some shopping are often taken for granted by people with no known disabilities. For the visually impaired, these …

Visual of Who should win the ECO Coin Award 2019?

Who should win the ECO Coin Award 2019?

Each year we celebrate ecological heroes as part of our ECO Coin Award and this year is no different. Have you seen an inspiring person who is making the world a more …

Visual of A path to humane technology

A path to humane technology

In 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …

Visual of Want to build an organization that lasts? Create a superorganism

Want to build an organization that lasts? Create a superorganism

For the past 25 years, I’ve studied everything from baboon cooperation in Ethiopia and orca whale innovation in the Bering Sea, to the Argentine ant invasion in my kitchen, and my …

Visual of How a 6.000-year-old fruit fly gave us cheese

How a 6.000-year-old fruit fly gave us cheese

Historians often trace the dawn of human civilisation back 10,000 years, when Neolithic tribes first settled and began farming in the Fertile Crescent, which stretches through …

Visual of How future fashion could help us cope with isolation

How future fashion could help us cope with isolation

Today we cannot meet, touch or hug our loved ones. And while we all like the feeling of the touch of another human being, physical contact does not just feel nice, it is crucial …

Visual of Interview Matilde Boelhouwer: Making urban environments flower again

Interview Matilde Boelhouwer: Making urban environments flower again

Matilde Boelhouwer is a designer whose work speculates between art, design, science, biology and food. Matilde shapes this obligation into a studio which mainly focuses on the …

Visual of Suzanne Lee wants to live in a sustainable material world. Built with biology, not oil

Suzanne Lee wants to live in a sustainable material world. Built with biology, not oil

Biotechnology is nearly as old as humanity itself. The food you eat and the pets you love? You can thank our ancestors for kickstarting the agricultural revolution, using …

Visual of Next Generation: Louise Silfversparre illustrates the remains of the Anthropocene

Next Generation: Louise Silfversparre illustrates the remains of the Anthropocene

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of The Coronation

The Coronation

For years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …

Visual of 'The Invention of Morel’ is a techno-lovestory from the future, written in 1940

'The Invention of Morel’ is a techno-lovestory from the future, written in 1940

Octavio Paz says calls  The Invention of Morel , “ without exaggeration… a perfect novel. ” According to Borges, “ to classify  [it]  as perfect is neither an …

Visual of Towards a global society as a superorganism

Towards a global society as a superorganism

Today we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …