Technology vs Football: 4-4
Ties van de WerffSome matches remain interesting, even though they're predictable. Take the continuous battle between technology and football. Every time the stakes get high, such as at the World …
Some matches remain interesting, even though they're predictable. Take the continuous battle between technology and football. Every time the stakes get high, such as at the World …
Kevin Kelly, Senior Maverick at Wired Magazine talks about the nature of technology and propose to define technology as the 7th Kingdom of Life.
People have complex relationships with their own (and other’s) bodies. In Traditional Chinese Medicine (TCM), it is believed that your feet are a map of your body and can provide …
As a Google user, you're familiar with the speed and accuracy of a Google search. How exactly does Google manage to find the right results for every query as quickly as it does? …
A wearable lighting device that changes color and shade according to movement, facial expressions, weather and mood.
We’ve been told since grade school that what we eat is important, but we’ve all been told to eat the same sort of healthy things. This isn’t bad, but with the up-and-coming …
Producing an iPhone in 1991 would have cost 3,56 million of dollars.
Video testimonial for our Next Nature Appzine, all the way from India!
Buckle up for a cinematic espresso shot from performance philosopher and NNN ambassador Jason Silva.
How technology becomes nature in seven steps
Is the use of personal devices becoming a replacement for the spectrum of emotions that make us all humans?
This question is an excerpt from the Pyramid of Technology toolkit Cooking is a process through which humans outsource part of their bodily functions to technology (think …
This question is an excerpt from the Pyramid of Technology toolkit In the late nineties, the Tamagotchi egg was released. A small egg-shaped device that contained a digital …
This question is an excerpt from the Pyramid of Technology toolkit Imagine asking your grandparents if they ‘have googled anything lately?’ Chances are they actually did, …
This question is an excerpt from the Pyramid of Technology toolkit Take a mundane object from your house. Now ask yourself: How will this particular technology enchant me? …
This question is an excerpt from the Pyramid of Technology toolkit The first computers barely fit in your living room. This all changed with the introduction of the desktop …
In conversation with architect Julia Watson, a leading expert on Indigenous technologies and author of 'Lo-TEK, Design by Radical Indigenism'.
I remember the smoke the most. That pungent smell permeating the camps of tribal people. Everything they touch is infused with the lingering perfume of smoke – their food, …
Stick-on shoes, wakeup lights, bionic limbs: these are examples of humane technology. But what exactly does this mean? It can best be explained in contrast with its opposite. …
We must be mindful about how we engage with technology: what we use it for, why, and whether it helps us or hinders us. Sometimes our tech seems to be flowing in inhumane …
We interviewed William Myers and Emma van der Leest, curators of Nature Loves Technology, our exhibition at Floriade 2022
Digital and genetic techniques increasingly influence life. Our belief in progress through technology stands in the way of a moral debate on this development. By Rinie van Est We …
Technology is nestling itself within us and between us, has knowledge about us and can act just like us.
We must be mindful about how we engage with technology: what we use it for, why, and whether it helps or hinders us. Sometimes our tech seems to be flowing in inhumane directions, …
Over the coming years, nanotechnology will invade our everyday lives. Nanotechnology, usually defined as the control and manipulation of matter at the nanoscale, will be …
In 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …
The Pyramid of Technology toolkit is a workshop-in-a-box that helps you better understand technology and catalyze innovative processes.
Written by Kevin Kelly , published in The Technium . I claim that technology has its own agenda. What is the evidence that technology as a whole, or the technium as I call it, is …
In 2009 the Initiative for Science, Society and Policy coined the phrase ‘living technology’ [1] to draw attention to a group of emerging technologies that are useful because they …
Technology is coming closer to us. In the form of decades old headphones or state-of-art devices. It has always been a part of our lives and this only seems to develop further: …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
We called upon artists, filmmakers and film enthusiasts around the world to create a one-minute videos for the intimate technology series.
We are happy to announce our new upcoming weekly video-series on the 'Intimate Technology' theme.
In this talk at TEDxGhent, our own Dr. Van Mensvoort shows how technology becomes nature in seven steps and what engineers, inventors, designers and entrepreneurs can learn from that.
Emoji, Skype, Selfies - can these communication technologies close the generation gap? In part, yes! Young people are teaching senior citizens how to use technology, and it’s …
Next Nature Network is curating the One Minutes series for September 2017.
All too often, technology frustrates us. It forces our behavior into constrained pathways. Even more insidious, technology can knock us out of alignment with our values, goals or …
Droog Foundation and Next Nature Network invites you to join the conversation about Intimate Technology: April 23, in Amsterdam.
This movie titled "All My Clothes" reminds us of a more straightforward example of intimate technology: the clothes we wear every day.
Are cities in their current form really the future of the human habitat? What is a next nature version of the city and how would it look like? In line with this perspective, NNN designer Hendrik-Jan Grievink led two workshops in Tokyo.
Today, there's an app for everything. They help us satisfy our cravings, allow us to communicate at all times and make it easier to share special moments. But the dark, cold …
The world needs interdisciplinary creators who are designing not just for humans, but for the rest of the living planet. To foster this thinking, Biodesign Challenge (BDC) pairs …
We think of selfhood as residing in our everyday stream of consciousness. But could we possibly have a second digital self in our online behaviors? Watch episode 3 of our Intimate Technology series.
Thync, is a new brain-altering wearable technology that promises to “shift your state of mind and conquer life” by allowing its users to change their mood whenever they need it.
Designer and architect Neri Oxman explores how digital fabrication technologies can interact with the biological world. Watch the TED talk.
What if you could upload your fondest memories to the cloud? Watch episode 4 of our Intimate Technology video series.
"Misbehaving (Ro)bots" asks whether technology could hope to replicate these small bothersome quirks that instill a feeling of intimacy.
Do we treat our technologies with more care and sentimentality these days than we did in the past?
The last episode of our Intimate Technology series follows a minute in the life of a hyperconnected family in the digital era.
The third principle of humane technology: It should take human values as a cornerstone of its development. Technology doesn't have to be expensive or electronic to be humane. …
And now for the sixth and final principle: Humane technology improves the human condition and helps people realize the dreams they have of themselves. No matter what your …
Cars increasingly rely on technology designed to make driving easier and safer. But are these improvements creating less-skilled drivers?
At this moment in time, many people are staying at home in order to flatten the curve . It is times like these that we realize how vital technology is to us and our societies. It …
Then, as now, one person could literally change the course of history, with nothing more than an idea.
Haptic technology refers to technology which interfaces the user via the sense of touch by applying forces, vibrations and/or motions to the user (Just think of the Wii ). At the …
Our second principle: Humane technology revives human intuitions, in particular those we might have forgotten about. 'Conventional' technology aims to overcome our hominid …
Over the past decade scientists have tried to get technology surfaces to be as sensitive as our skin, especially as our fingertips. Human tact is a very sophisticate interface …
The body, like any technology, is made up of countless individual components. Yet, apart from dire medical emergency, have you ever thought about mixing and matching these …
Principle number four: Humane technology should resonate with the human senses, rather than numbing them. If you're an office worker or a video game fanatic , you may spend most …
UnderSkin is a device that would be implanted beneath the skin on your hand and charge off your body’s energy.
Principle number five: Humane technology doesn't outsource people, but instead empowers them. How healthy or humane is it to have an escalator to the gym? Humane technology should …
We may soon all be making natural gestures to interact with our digital devices.
This mashup video project integrates various video clips that ask: What is nanotechnology? Via Posthumanblues , via Futureblogger . See also: Small Talks , Bacteria Bots , …
Looking at this nextnatural comic, our co-evolutionary relationship with technology might need some work.
Mobile phones are nextnature: Twenty years ago they didn't exist, now everyone has one and when you leave your house without it, you feel amputated. Like you are missing a limb …
Once common, statue-loving has disappeared from the sexual landscape.
What if your devices had a life of their own? Guy Farber’s playful short movie "An iReal" explores this very possibility.
What do a kingfisher, cocklebur pods and a Namibian beetle have in common? Besides being living organisms, they have all served as inspiration for creative human technologies to …
Technologist, environmentalist and nextnature thinker avant la lettre Kevin Kelly , muses on what technology means in our lives – from its impact at the personal level to its …
In this particular piece of video art, loyal readers of nextnature.net might recognise the building as Zeche Zollverein in Germany, where we organized the Biggest Visual Power …
A macaque stole a tourist's iPhone and fiddled around with it like a human would.
New technologies are changing the landscape, but the latest trend reshaping rural environments and agriculture is agroforestry: the art of planting trees.
Dutch fashion designer specialized in wearable technology, Pauline van Dongen researches the human body in relation to its surroundings.
Humans have been manipulating living things for thousands of years. Examples of early biotechnologies include domesticating plants and animals and then selectively breeding them …
It's getting difficult to discern what's technology and what's not.With wearable technology becoming more and more integrated into society, our lives become infused with more technology.
Exploring the co-evolution of yeast and humans, while discovering the aesthetic value of yeast biotechnology, is what designers Anna Dumitriu and Alex May have been concocting. …
Last week, Next Nature Lab had the first Meat & Greet to explore the future of in vitro meet.
Imagine a trash can that matches the size of your ordinary bin, yet it scoffs at weeks' worth of discarded food before even considering fullness. You're off the hook, as there's …
Imagine you could communicate telepathically with a whale, listen to the WiFi networks in your environment, or experience smells through seeing color. Developments in technology …
Biosequin, seaweed textiles, and microbe sunscreen: these ideas and more are marking the next wave of bio-innovators during the Biofabricate Summit 2024.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
THRIVE expo showcases the latest works at the convergence of art, design, and biology, which examine current and future uses of biotechnology.
Sex is one of the most powerful, fundamental human drives. It’s caused wars, and built and destroyed kingdoms. It occupies a significant percentage of most people’s thoughts. As …
“Please refrain from hand shaking" is a common sign we now see as a result of public health organizations advising people to avoid shaking hands as a greeting. As people still …
Wearable Interfaces, Smart Materials and Living Fabrics. V2_, Institute for the Unstable Media, Rotterdam, and Amsterdam-based Virtueel Platform, the expertise centre for …
Smartphones have become almost a part of who we are. According to tech industry experts, however, the smartphone's days are numbered and that number is lower than you might expect.
What if women of childbearing age no longer had to interrupt their careers for a pregnancy? In Kuang-Yi Ku ’s project Grandmom Mom, we take a look into the future. In 2050, the …
Climate change will transform how we live, but these tech and policy experts see reason for optimism
What if humans would be able to listen to what nature has to say? Conservationists are trying to grasp non-human sounds , which might help us to better understand environmental …
Watch a fly land on the kitchen table, and the first thing it does is clean itself, very, very carefully. Although we can’t see it, the animal’s surface is covered with dust, …
Blockchain is useful for more than cryptocurrency. It’s revolutionizing industry after industry. Next, it may change the way we get our food. The agriculture industry is complex. …
Before money came into existence, trading was all we knew. Farmers in China traded their spades for food and other goods, and this continued up until a point where most spades …
New technologies – from artificial intelligence to synthetic biology – are set to alter the world, the human condition, and our very being in ways that are hard to imagine. The …
In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …
Technology is not neutral; the same tech might empower some and disempower others. It is time to check our Technoprivilege, argues author Hendrik-Jan Grievink.
Meet the teledildonics, an ingenious species of bi-directionally controlled sextoys from the future, available today. These touch emulating vibrators find each other on social sex …
Pleun van Dijk is a speculative artist/designer who investigates the intimate relationship between human and technology.
An interview about the history and promises of synthetic biology, and the problem with the word "nature".
Rachel Armstrong discusses living buildings, Venice's foundations, millennial nature and how to improve our future.
Are you working on projects where technology and human interaction are involved, and are you looking for a new approach? As of today, we offer a brand new workshop concept for you …
NNN director Koert van Mensvoort writes a letter to humanity.
When techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …
In this essay, anti-civilization, anarchist philosopher John Zerzan critiques the concept of 'next nature.' He argues that rather than freeing us, our self-domestication through …
Interview with Liam Young on his work in speculative architecture, the future, and our role in nature as humans.
10 design requirements to fully immerse ourselves into the 21st Century—in which technology makes our world richer, not poorer.
Ten books that continue to inspire the next nature philosophy—gathered for you to read this summer.
The next step is to embrace and celebrate how cultural artifacts are escaping control, becoming autonomous, and forming the “next nature”.
With New Year’s resolutions in full swing, many people may have chosen to cut down on their tech use – or even give it up altogether. The growing popularity of such “digital …
Next Senses explores the unchartered territory of how we could experience the world with technology
Written by Werner Lippert & Peter Wippermann, Curators of the Entryparadise exhibition (26/8 until 3/12, 2006, at Kohlenwäsche, Zollverein) Design is about to undergo a …
Don’t be surprised when you catch a human face on a screen strolling through the Van Abbe museum for contemporary art in Eindhoven, as these are Europe’s very first robotic …
Sometimes a festival can be so much more. Tapping into arts, design, and electronic and experimental music festival, Sónar Lisboa (8-10 April) is one for the body and for the …
We recently talk to Nadine Bongaerts about the role and impact of synthetic biology, the gap between biosciences and society and the importance of communication to overcome the fear of new technologies.
Read Nicholas Carr's essay on the transhumanist dream of having wings.
The artificial womb is on the verge of becoming a reality, but how it will affect our culture is for us to decide.
We are now so used to communicating with some robotic device in our homes. But this skill cost Furbies a national ban in the US.
NNN organizes workshops using a physical Pyramid of Technology as conceptual tool.
There it is. A hefty hen, with its head up high and its beak out. And a gigantic VR headset over its beady little eyes. What does this battery hen see? ‘An experience of a free …
Color-blind artist Neil Harbisson designed a brain-implanted antenna that converts colors into sound. This enables him to hear colors he cannot see, and extends his vision to …
We humans simply feel more comfortable with technological change when it comes in a familiar form that refers to an existing and accepted object, habit, value, tradition or intuition.
Smiling broadly and rattling with enthusiasm, the 33-year-old Rylana Doesburg shows off a QR-code on her phone: an angular pattern of black and white squares. “Thanks to this …
It's not an easy task to define the practice of designer Jasna Rok . Fashtech pioneer? Radical innovator? Visionary designer? ‘All of the above’ seems only appropriate. In fact, …
As evolution goes on, the human body is evolving too. What does it mean to be human in times of advanced biotechnology and genetic engineering? Are our bodies ready for our …
Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …
A flock of drones that fly like birds, drifting blocks of concrete, a choreography of opening and closing flowers. The work of Studio Drift is challenging the distinction between …
Pink chickens, synthesized tiger penises and salads grown from bodily fluids - how could they shape our future? In a Next Nature collaboration with the Gogbot Festival, the …
Trading animal skins for pixels, our digital selves call for a digital wardrobe. The Institute of Digital Fashion , led by CommuneEast founder Leanne Elliott Young and Digi-Gxl …
Many people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.
We met Anouk Wipprecht and talked about smart fabrics and accessories that can listen to our body, therapeutic fashion and the future of dressmaking.
You might already have what’s often called a “smart home”, with your lights or music connected to voice-controlled technology such as Alexa or Siri. But when researchers talk …
This is #2 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …
With 7.9 billion people and counting, the Food and Agricultural Organisation of the United Nations predicts that by 2050, food supply needs to grow by 70% in order to accommodate …
Technology brings us closer to nature, and indigenous insight reconnects us to our roots.
Since the early days of the net, the electronic pastoral has lent itself to all sorts of dubious agendas pushed by science, the military and even libertarian tendencies. In the …
All buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …
The sublime is an aesthetic concept of 'the exalted,' of beauty that is grand and dangerous. Through 17th and 18th century European intellectual tradition, the sublime became …
An interview with Daisy Ginsberg, artist and synthetic biologist.
Technology helps us understand the unfolding of the Anthropocene.
Technology breaks as an inspiration for names. Among the most popular names of 2015 we can find Instagram filters.
Have you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …
We live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …
It’s been over a decade since artificial retinas first began helping the blind see. But for many people, whose blindness originates beyond the retina, the technology falls short. …
At ISEA 2010 , the International Symposium on Electronic Arts, media artists and media researchers from all over the world present their work in Dortmund (Germany). This year, …
How many cyborgs did you see during your morning commute today? I would guess at least five. Did they make you nervous? Probably not; you likely didn’t even realize they were …
With the invention of the radio antenna in the late 19th century, we became a different species: Introducing the human insect. A species, able to communicate across oceans using …
Biotechnology is nearly as old as humanity itself. The food you eat and the pets you love? You can thank our ancestors for kickstarting the agricultural revolution, using …
Imagine if everyone spoke a language that you don’t understand. It’s not a foreign language–it’s been spoken around you since the day you were born–but where as everyone else …
In the digital era of a globalized world, our screens have become a second set of eyes. Communication has advanced leaps and bounds, to a point where we cannot imagine a world …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The first essay ever written on Next Nature, published in Next Nature Pocket and in Entry Paradise, New Design Worlds . ( download pdf ) (German version: Erkundungen im Nächste …
Unlock our devices with our fingerprint, this technology for security represents a change in our digital life.
Outside of the limits imposed by the edges of an animal’s body, the cells can reproduce and multiply until they exhaust the nutrients and space provided, filling petri dishes and vats to grow the future of meat.
We recently talked with Suzanne Lee about the textile industry and technology, growing leather in the lab, and the use of new alternative materials in the future of fashion.
Biosensors, cultivated meat and spider’s silk. For synthetic biologist and Next Nature ambassador Nadine Bongaerts, these are all advances towards a new world, where polluting …
Imagine this: you wake up on a lazy Sunday morning, trudging your way to the fridge only to be welcomed with the smell of something rotting. Did the meat expire sooner than …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Mars ain’t the kind of place to raise your kids, laments the Rocket Man in Elton John’s timeless classic. In fact, it’s cold as hell. But that doesn’t seem to worry a new …
Computational Biologist Jing-Dong (Jackie) Han and her team uncovered a technology to interpret signs of biological aging directly from facial characteristics.
Controlling devices with your mind. Unreal? Think again. Brain-computer interfaces have been changing the game in healthcare, gaming, and accessibility lately.
Meet United Matters, a London collective exploring how we might live in the future by blurring the boundaries between craft, science and technology.
Before we can decide if we will ever be willing to eat in-vitro, we need to explore the food culture it will bring us.
In 1992, decades before the era of wearable technology, Apple produced its first watch: no apps and vintage design.
FysioPal is a smart top made to support and enhance the upper-body and posture.
Two robots opened the show of Chanel during the Paris Fashion Week of 2017. Well robots, two models dressed up like humanoid robots entered the catwalk. Is Chanel going Next Nature?
The phone call was as unexpected as the American accent at the other end of the line. And when she hung up a few moments later, Ira van Eelen had to stop to catch her breath. More …
Face-detecting systems in China now authorize payments, provide access to facilities, and track down criminals.
From the Georgia Institute of Technology arrives FingerSound, a smart ring that recognizes thumb gestures and converts them into words and numbers.
Solar cells are often considered an eyesore, used for their sustainability yet not for their beauty. Installed on roofs or in solar parks, they take up precious space. Well that’s …
What is the first thing that comes to mind when you hear the term 'biohacking'? Perhaps you are now thinking of a bunch of kids sitting in their kitchen with a DNA kit, (wannabe) …
Travelling to work, meeting friends for a catch up or just doing some shopping are often taken for granted by people with no known disabilities. For the visually impaired, these …
Today we cannot meet, touch or hug our loved ones. And while we all like the feeling of the touch of another human being, physical contact does not just feel nice, it is crucial …
When you look through a super-telescope, you can still see the planet Earth. Once called the blue planet, she now looks red and parched. We had no choice but to abandon her… On a …
Is social media ruining the world? Dramatic political polarization. Rising anxiety and depression. An uptick in teen suicide rates. Misinformation that spreads like wildfire. The …
Interior based on bacteria, spaces morphing perception and the merging of man, animal and machine. These five must see exhibitions in the Netherlands explore the intersection of …
Nature provided humans with an extensive set of sensory modalities, allowing our brain to constantly gather sundry inputs from the outer world. These sensory inputs help us …
Energy policy blah blah blah, life cycle analysis blah blah blah, energy return on energy invested, peak oil, carbon footprint, renewables, hydro, nuclear, blah blah blah blah …
Just because you can doesn’t mean you should – real-world genetic engineers can learn from the cautionary tale. “ Jurassic World: Dominion ” is hyperbolic Hollywood entertainment …
Humans’ natural sense of privacy helps them regulate the boundaries of public and private, but fail when trying to identify privacy risks in the online world.
AUSGANG Studio combines art, technology, and living materials to tell stories of our world's trajectories.
Economy is ecology? Technology Review writes the price of oil has dipped to levels that could be far too low for many advanced-biofuel startups to succeed, especially those that …
Imagine a world where the shapes of all objects around you would be able to change on the fly. Envision a future where nanotechnology and morphing become ubiquitous and blend in …
After the successful introduction of the NANO Supermarket in 2010 it became even more clear that the contest and the presented results produced discussions and many challenges to …
The Namib desert gets less than a half an inch of rain per year, yet the stenocara beetle manages to survive in these punishing conditions. The beetle's secret lies in an array of …
Samsung is working on a brain interface that lets you go truly hands-free with your phone.
Lab grown meat is part of the trajectory that agricultural technology is already following.
Volume magazine interviews Next Nature founder Koert van Mensvoort.
Alexandra Daisy Ginsberg discusses the promises and realities of synthetic biology.
We have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.
A new technology aims to provide doctors with a true hologram of organs.
Researchers from the Massachusetts Institute of Technology have developed a tiny wireless trackpad that could easily fit on your finger nail.
There is a new artificial skin technology that could give humans magnetoception in the future.
An he hi-tech Swedish office block implanted a microchip under the employees’ hand skin.
On may 21st, Next Nature Network art director Hendrik-Jan Grievink will host a workshop around the idea of Speculative Sensing: exploring the potential of senses found in nature …
Interview with Mike Thompson and Susana Cámara Leret.
Moving tattoos from purely aesthetic crave to a healing method thanks to nanotechnology.
Biometric technology replaces passports in Australian airports.
We recently spoke to Ilari Laamanen, to peel the outcrops of Momemtum9, and unveil the overlapping themes to the next nature philosophy.
We recently interviewed Lining Yao, Chinese interaction designer who uses organic materials as a technology that brings us back to nature.
What if you could unlock your phone by simply looking at the camera? According to Apple, this is precisely how the iPhone X will work. But how secure is it?
"To understand why a product is the way it is today, you need to learn about its evolutionary background." Meet Huub Ehlhardt, an engineer with a PhD in product design . Huub …
Before fully autonomous cars take over our streets, we may experience a transition phase: Fasten your seatbelts, as Nissan introduced a so-called Brain to Vehicle (B2V) system to …
Meet the Robo Wunderkind, a new breed of smart toys that introduces children to the basics of coding and robotics in a playful way. Advanced technologies are increasingly embedded …
Last week, the gene editing world was hit by news the equivalent of a nuclear bomb. In a video on YouTube , Dr. Jiankui He at Southern University of Science and Technology in …
The idea that AI can compose electronic music may sound a little off to people. It raises essential questions about creativity as a product exclusive to humans: can an AI be …
The emerging technology of the artificial womb confronts us with a series of moral and societal questions. How to cope with that? Join us on 29 March at Eindhoven University of …
When I was a kid, my parents took me to the beach every summer. We’d swim in the ocean and play on our inflatable raft in the surf. When the tide was low, I’d build a sand castle …
We live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …
Let’s talk about the most controversial of "m words"—monogamy. And let’s have this conversation with in mind its prehistoric origins. Our modern picture of prehistoric societies …
What does the merge of bodies and technology mean for the human? For cyborg Kai Landre, cybernetic extensions become body parts and not technology. Kai began his transition to a …
Today our human impact on Earth is humongous. Climate change, plastic oceans, mass urbanization and deforestation. Scientist recently calculated the technosphere now outweighs the …
Here are 5 things you cannot miss at Floriade Expo 2022
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
How will we stay healthy in the future? Can we utilize the power of design to move towards a more healthy society?
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
A German artist refused a photography prize after admitting his image was AI-generated.
What if we could control our dreams? In the near future, this might become a reality. Prophetic developed a new technology that enables lucid dream control.
Visual artist Heleen Blanken explores the complex relationship between people, nature and technology.
For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …
(Extracted directly from Pink Tentacle , thanks!): Researchers from Japan’s ATR Computational Neuroscience Laboratories have developed new brain analysis technology that can …
Is the evolution of the single bladed razor into an exorbitant five–bladed vibrating gizmo the outcome of human needs, or is there another force in play? Say hello to Razorius …
Previously, experiences of time emerged from nature as given – offering seasons, the rhythm of humans, plants and animals. Nowadays, people integrate nature-time, body-time, inner-time, clock-time, and global 24/7 systems-time. Human beings, in past, current and next natures, have to deal with emergence and design of time in order to survive.
The world is alight with algae fever. In this age of deep ecological design aspirations, the range of speculative design projects based on algae technology is growing. Algae are …
The surprising results of a year offline in the "real" world.
A new technology enables us to produce electricity from living plants at practically every site where plants can grow.
Food and Concept designer, Chloé Rutzerveld, explains her 3D food printing project Edible Growth.
Truly advanced technology will be light as sunshine and indistinguishable from nature.
Your next phone could be the noPhone: a technology-free alternative to any smart mobile device.
The Archéologies des Medias exposition turns archaic technology that was once cutting-edge into art.
Francesca Barchiesi's glove concept allows the user to translate hand gestures into images and information.
Project Jacquard makes it possible to weave touch and gesture interactivity into any textile.
Thanks to the antenna implanted in his skull, Neil Harbisson can hear images and paint sounds.
Coelux skylight recreates natural sunlight using Nano Technology.
These parents use the Apple Watch to share their newborn child's heartbeats with friends and family.
Bioprinter creates bespoke lab-grown body parts for transplant.
Read Benjamin Aldes Wurgaft's essay on judaism in relation to the production of laboratory-grown meat.
Companies try a new, more secure payment system using selfies.
Dutch experience designer Leanne Wijnsma designs for the human instinct and puts the sense of smell back to where it belongs, as modern hazards have shifted to the digital realm.
ElectRoad developed a unique technology that powers the vehicle wirelessly from the road while driving.
A Facebook chatbot that offers interactive cognitive behavioral therapy. It’s called Woebot and it's your personal virtual counselor.
Where contraceptives such as the pill disconnect sex from reproduction, in vitro fertilisation disconnects contraception from sex, and the artificial womb would disconnect the …
The Living Light harnesses plant energy to provide light. We spoke to its designer, Ermi van Oers, to find out more about the unique product.
How can we design a cryptocurrency for the better of humanity and ecology? In this last chapter of the crypto deep dive series , we will dissect two kinds of blockchain …
Agriculture may be one of the oldest of our technologies. Over time it has developed, changed, revolutionized, industrialized - or simply put, it has evolved . Today’s farms are …
The connection we share through the Internet has laid the foundation for a whole new digital infrastructure, in which blockchain technology is heralded by many believers for being …
Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
The world is developing, climate change is happening and it's time for us to do something. Now. One strategy would be to simply stop eating meat — or at least reduce the amount of …
Intensive agriculture may be nourishing most of the Earth’s inhabitants, but it’s doing the opposite to earth itself. Its dependence on singular crops, heavy ploughing machinery, …
Who are you, who do you want to be, and what do you need to do to get there? We are constantly pushed to lead the perfect life. The media present us with a picture of an existence …
In 1953, a Harvard psychologist thought he discovered pleasure – accidentally – within the cranium of a rat. With an electrode inserted into a specific area of its brain, the rat …
A must-read to the Next Nature fan: Catching Fire: How Cooking Made Us Human (2009). Written by British primatologist Richard Wrangham, the author shares his hypothesis that …
What will the supermarket of the future look like? And what kind of food will you be able to buy there? That is what the Embassy of Food is researching. The production and …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
When we think of robots, we typically do not think of small cellular organisms made with embryonic cells from frogs. However, this is exactly what the joint teams at University of …
Looking at evolution, we see that there’s always a next nature. Nature changes along with us. How will that influence our way of life in the future?
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Exploring the intersection of technology and art, a team of creatives presents a virtual performance that pushes the limits of human expression.
Within the digital realms of our smartphones, WhatsApp groups cater to diverse intents: exchanging witty dad jokes, soliciting style counsel ahead of night-outs with friends, or …
Biotechnology startup Cortical Labs successfully guided human brain cells in a petri dish through a simulated game of Pong.
Augment your physiology. Enhance your prospects. From neuro-electronics, to robotic-prosthetics and mind-altering pharmaceuticals.
Mark Weiser (originally written for ACM Interactions ). What is the metaphor for the computer of the future? The intelligent agent? The television (multimedia)? The 3-D graphics …
John Zerzan, published in Green Anarchy issue #24 - Spring/Summer 2007 The rapidly mounting toll of modern life is worse than we could have imagined. A metamorphosis rushes …
In our NextNature event BVPS (May 2008), Kevin Kelly spoke of technology as the 7th kingdom of life : a form of evolution whithout the nasty side–effect of dying (Every object …
Unlike many people fear that computers will overtake humans, Ray Kurzweil states that robots will merge with humans, robots the size of cells which can do the job way more …
Will we in the future still buy several needs according food in shops, or will we grow M&M’s ourselves? There is a lot happening on in the field of food technology , think for …
Multi-touch designer and developer Richard Monson-Haefel considers sound as an important part of our user interfaces. As an application of " Calm Technology " which revolves …
Nanotechnology has been hailed for its benefits because of the potential ability to create drugs that could cure cancer and radiation poisoning, make miniature pollutant filters …
Are you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …
Interview witth TEDx on how people are technological by nature, yet how we also need humane technology to remain human, or become even more human than we are today.
Designer, artist and engineer Dan Chen has developed the ' End of Life Care Machine ', a machine designed to guide and comfort dying patients with a carefully scripted message. …
In vitro meat has been billed as a way to end animal suffering , put a stop to global warming , and solve the world's insatiable demand for animal protein. There's no doubt that …
The future of farming is not to be found in further mass-industrialization nor in the return to traditional farming with man and horse power, but rather in swarms of smart, cheap robotic farmers that patiently seed, tend and harvest fields one plant at a time without the need for damaging pesticides.
Venice, Italy is sinking. To save it, Rachel Armstrong says we must develop living technology.
3D printers using concrete can now create complete houses from the ground-up.
A stunning pre-history of the anthropocene
Vegetarian food products typically mimic existing meat products. The meat flower reverses this principle.
A speculative nanotech pill that lets you virtually rove your body, zapping cancer cells as you go.
This whole week you can come and taste meat ice at Le Bistro In Vitro in the main hall of Eindhoven University of Technology.
With advances in genomics, imaging and other technology,scientists have to face the age of big data.
A revolutionary new smartphone for the blind uses a completely tactile interface.
Scientists designed a way to improve the efficiency of plants light harvesting during the photosynthesis, using nanotechnology.
At times it seems we serve our technology as much as it serves us. The OFFTIME App wants to save us from our own devices.
As technology evolves, what today seems like science fiction may be the job market of tomorrow: 11 professions of the future.
The image on the left is a car, as we know them. It has a lot of digital technology in it already, but not nearly as much as the other one.
Some modern thinkers argue that new technology is making us antisocial.
Biomaterials researchers at MIT came up with a very tiny device able to monitor vital signs from deep inside the body.
An international team of scientists used nano-sized needles in order to promote production of new blood cells.
A special absorbant film that require no soil may be able to grow plants more efficiently than soil farming.
The Wood-Boring Wasp inspired scientists to create a new robotic needle which will be used in brain surgery.
Artists respond to biometric technology and data collecting software through subversive projects.
BlackBerry has just confirmed that it will no longer create its own phones, marking the end of an era for the once dominant leader of the smartphone market.
We humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.
A group of researchers is working to optimize the way we sleep, increasing our relaxation, and therefore reducing the time devoted to our naps.
Researchers are experimenting with a new technology that would be able to grow drones from chemical compounds.
We are entering an age of technological singularity, in which artificial intelligence and biological enhancement are combined in order to construct the next stages of human evolution.
Is human cloning here? Chinese scientist is ready to clone people at his ‘replication factory’.
Speculative designer Agi Haines' work focuses on (re)designing the human body, and speculates upon future scenarios.
Part one of a ten part series exploring the design of an invisible technology: money.
An experiment tries to prevent crime by identifying aggressive behavior with new surveillance technology before actual violence is used.
Many companies are seeing the potential of this technology to solve food scarcity, reduce pollution and offer cruelty free meat. One of these firms is Tyson Foods, the meat giant.
A smart, huggable bed partner, who also improves your sleep quality. Sounds great, right? Soon, you might be able to order one yourself: Somnox is a soft robotic pillow that gently breathes as you hold it.
Researchers designed a smart fabric able to encode data readable by a magnetometer, like the one in your phone, without electronics or batteries.
A clinical startup sells millennial blood to reverse aging.
DNA is the densest known storage medium in the universe - and Harvard University researchers have managed to use it to store GIFs inside bacteria.
As a digital detox dietitian, you know exactly how much digital technology your client needs and you give professional advice with a personal approach.
“Within a few years it will be possible for a premature baby to continue to mature in an artificial womb,” says gynecologist Guid Oei. It is therefore that the Artificial Womb: …
Hooray! The team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …
A breakthrough technology that responds to signals from the brain has transformed the life of a paralyzed 28-year-old man called Thibault. Four years after the initial incident …
For the closing event of Reprodutopia , a true meeting of minds took place as we discussed the social implications surrounding the future of reproductive technologies. Multiple …
Imagine, it’s 2050 and you are feeling hungry. What will be on your plate? Where will your food come from, and how will it be produced? It may be juicy ants from the nearest …
We are proud to invite you to our largest showcase (so far), currently on display at OCT Art & Design in Shenzhen, China. Spanning across three floors, with a total surface of …
Driving long distances without a passenger can be lonely. If you’ve ever done it, you might have wished for a companion to talk to – someone emotionally intelligent who can …
As the ills of factory farming become more pronounced, people are increasingly gravitating towards vegetarian or pescatarian diets. Besides producing a large percentage of our …
With gyms closed and millions cooped up and restless at home, it’s little wonder that “healthtech” is now being billed as the next big battleground over which the likes of …
As with many of the products we consume, there’s a cost beyond what we pay at the store. Producing coffee has an environmental cost, too.
This is #3 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …
Water scarcity is among the top five global risks affecting people’s wellbeing. In water-scarce areas, the situation is grim. Conventional sources like snowfall, rainfall, river …
The digital world has been creeping closer to your face. Was a time when a laptop was about as personal as you got with a computer. Then came smartphones, and a few years later, …
The Sun is the most important source of energy for sustaining life on Earth, but it gives us a lot more than just light and heat. It also gives us solar storms.
Assisted evolution raises complex questions. The practice involves human intervention to increase the rate of natural evolutionary processes. A technique that inevitably …
You are in for a surprise when you look at food and concept designer Chloé Rutzerveld 's portfolio. It is hard to believe that somebody so young - she is just 25 - has already …
Each year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honour them with our ECO Coin …
In the supermarket of the future, part of the Embassy of Food at Dutch Design Week, designer Merle Bergers will present her project Microbiota To Go.
A report from 2021 from the National Academies of Sciences, Engineering and Medicine tackles a controversial question : Is solar geoengineering – an approach designed to cool the …
The music industry is witnessing drastic changes. With the emergence of artificial intelligence technology, no industry has been left untouched and there are broad discussions …
Virtual news anchors seem to spread like wildfire across Asia. We've witnessed Xinhua present the news from China and applauded Lisa on becoming India’s first regional AI news …
Did you know that some Dutch people are so addicted to their devices that they'd rather give up sex, vacations, or even a finger than their phone?
The extent to which new technologies are intervening with everyday life can hardly be underestimated. Virtual realities, nano- and biotechnology are increasingly providing new …
Philips presented an A4-sized colour electronic paper . A paper-thin and bendable viewing panel. "This represents the next generation in display technology," Chung In-Jae, chief …
Good morning anywhere in the world! Waking up is a problem (at least for 50% of the population). That's why alarm clocks exist; machines and devices are invented to solve …
Theorists predict a new class of materials that could render objects invisible. The materials work because they interact with light in unusual ways. Researchers are beginning to …
The 1966 science-fiction movie Fantastic Voyage famously imagined using a tiny ship to combat disease inside the body. With the advent of nanotechnology, researchers are inching …
Old nature provided us with a wide variety of food: fresh milk, crispy vegetables, nutritious meat. Yet this is not enough, we want more: We want a printed steak , square …
Remember Asimo ? Honda has now developped a new Brain-Machine Interface technology that allows humans to control the humanoid robot simply by thinking certain thoughts. The BMI …
Doctor gets chip. Chip gets virus. Virus infects other devices... Dalek shoots doctor? Dr. Mark Gasson of Reading University implanted a RFID chip under his skin last year. It is …
It took some years of evolution to turn sex (between different sexes) from a stricly functional activity attuned to reproduction, into the recreational activity it is primarily …
The Intimacy dress takes our notion personal space to a next level: the closer someone approaches, the more transparent the dress becomes. As such, the garment becomes a sort of …
Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …
This project - the Next Nature Network - is about Nature's brand image. One might surmise that "Nature," being 100 percent all-natural, can't have any brand image. The facts …
In the last few decades there have been numerous films that take the struggle between mankind and its increasingly intelligent and autonomous technology as a leitmotif. Ranging …
Nanowire generators could one day lead to medical devices powered by the patient's own heart. A tiny, nearly invisible nanowire can convert the energy of pulsing, flexing muscles …
Traditionally, technology is seen as a force that diminishes our instincts and puts us at a distance of nature. Increasingly however, we realize technology can also energize and …
This week the oldest and classiest Dutch newsmagazine De Groene Amsterdammer features an 11-page special with lots of material from the forthcoming Next Nature book The special …
Dutch mechanical-engineer Jarnos Smeets dreams of flying like bird. Nothing new really, many people have had this dream for ages. Yet being an engineer and all, Jarnos is seriously propelling his dream towards a reality.
They might not be as fast, but goats offer several advantages over diesel-powered lawnmowers. They're quieter, they emit fewer greenhouse gases, and they fertilize soil as they go …
Do you ever miss being able to smell the woods in an online travel journal? The odor of a new leather jacket in an online shop? Or perhaps you just couldn’t find the words in an …
More remarkable than the look and taste of the burger, which only stood out because it was presented in a petri dish and described by one of the panelist as 'hot', was the revelation that Serge Brin, co-founder of Google.com, financed the project.
Floris Kayak discusses online hoaxes and the future of technology.
Ever curse the fact that you have to wait hours to sober up after a night at the bar? Now, you can sober up almost instantly – that is, if you're a mouse. Researchers at MIT …
There is a similarity between strings of binary and strands of organic DNA: they both carry actionable information encoded into reconfigurable symbols. Using nature’s biodiversity …
Filtering sea water to drinkable fresh water is no longer science fiction.
Designer Behnaz Farahi envisions an interactive 3D printed outfit that can detect and respond to the gaze of the other and respond accordingly with life-like behavior.
An exoskeleton chair that allows the body to move freely.
Using bone conduction, this device allows to hear the sound directly in the head, keeping the ears free.
Dozens of American Airlines flights were grounded as pliots' iPads crashed.
Think you've had enough sun? Ask your bikini!
Dr. Garth Webb, an optometrist from British Columbia, has invented the Ocumetics Bionic Lens : lenses that after being implanted through an eight minute surgery, improve eyesight …
An extraordinary yogurt that could soon implement accurate, young disease diagnosis.
The Random Darknet Shopper, with bitcoin to burn, has purchased counterfeit jeans, master keys, dodgy cigs and even a bag of ecstasy tablets. Who is legally liable?
In the near future he ability to see through things won’t be a dream anymore with this infrared smartphone camera.
When there is such abundance of areas where IoT could be applied, several ridiculous, unnecessary products are inevitable.
The new year is right around the corner, let’s forget about long-term future for a while to check out what new tech trends will hit it big in 2016. At the end of every year, …
During the event The Biosphere Code, Stockholm University researcher Victor Galaz and colleagues outlined a manifesto for algorithms in the environment.
Hitech is changing sports, but what are the consequences?
A polymer film coating can turn contact lenses into computer screens.
On June 17th a NNN Fellow Day was organized to explore the future project: Next Senses.
A team of scientists has developed a way to deliver drugs into our body using nanobots as vehicles and our toughts as controllers.
With the evolving technique called EEG, electroencephalography, we can measure brain activity and ultimately even read the brain.
Researchers discovered a way to store data in five dimensions on a nano structured glass able to survive for billion of years.
American company Ideo has taken the essence of on-demand economy at heart, presenting a vehicle with detail-designed services for the future of carpooling.
Brighter inks, without pigment: nanostructured capsules could bring about paints and electronic displays that never fade.
What if you had the choice of sparing your child from diseases and disorders such as Alzheimer’s disease, heart disease or autism?
Do you feel information overloaded? Do you experience stress? Do you feel like you are addicted to your smartphone, laptop, or the Internet? Get yourself digital detoxed!
Startup Helix launched an online hub where you can digitally explore your genetic code by downloading different apps on your computer or smartphone.
Sensor specialists recently developed a sensor that mimics the mammalian eye.
A needle free oral delivery system might in the future dissolve the old way of vacancies injected by syringes.
Imagine being 16 and studying for a job that soon won't exist. What kind of future is that? New occupations will come thanks to robotization.
Virtual reality is already becoming a part of the conversation surrounding social media. Will it become the next popular social network?
At Border Sessions Festival in the Hague a workshop was hosted by Next Nature Network on the artificial womb.
In the future, artificial wombs could replace incubators as they mimic the natural environment of the female uterus. But what will these devices look like?
Sports have always had an important place in human societies, providing entertainment, exercise, and a demonstration of the exceptional things the human body can achieve. But in a …
Dear Louise Brown, On behalf of the future I would like to congratulate you on your birthday. It has been 40 years that you where born into this world on July 25th 1978, …
There was a time when flipping the switch, and seeing a glass bulb light up, was magical to anyone in the world. Today, the presence of a light switch in a room, is something …
Last month I had the opportunity to immerse myself in Tokyo’s newly opened digital art landscape, the Mori Digital Art Museum. The museum stands out for it enables virtual …
Always thinking about food? What about food that doesn’t exist yet? On the 18th of September at De Studio, Next Nature Network will host a night of talks on the future of food and …
What do in-vitro human skin, spider silk and cow manure have in common? They are all unlikely materials that can cloth, protect and inspire humans, as realized by award-winning …
As modern humans, we are out of balance with our natural environment. With use of technology, we try to prolong our human lifespan and create materials that live longer than we …
The food chain has always worked roughly like this: sunlight feeds plants. Plants feed insects. Insects and plants feed animals. Plants and animals feed people. Then …
Hooray! This just in: Next Nature Network is granted a significant contribution from the Dutch government intended to develop a Future Lab for design & technology in Eindhoven …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Nonhuman Nonsense is a research-driven design and art studio existing somewhere between utopia and dystopia. They wonder upon our relationship with the non-human, embracing …
In imagining future urban landsapes, we need to answer questions about what can be sustained and what cannot, where cities can be located and where they cannot.
We now live in a world where plastics are becoming a part of our marine ecosystems. As a result, we strive hard to clean the plastics from our oceans. Dr. Max Liboiron ( Michif …
What is the metaverse and to what extent should we believe that the vision being presented to us is really going to be central to our daily lives?
Are we alone in the universe? The famous Seti (Search for Extraterrestrial Intelligence) programme has been trying to answer this question since 1959. American astronomer Carl …
Imagine if you could power your kettle using the energy generated from the vegetable cuttings quietly breaking down in your kitchen’s compost bin. That reality might not be so far …
It’s widely known that the world has a plastics problem. What’s less widely known is that we have a similar problem with another kind of waste: electronics
A team of researchers from Freiburg University has developed an artificial muscle that may result in improvements in medicine, prosthetics, and implants.
If we want to bring down global CO2 emissions to zero, we will need technological innovation and massive infrastructure projects.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
*Our open call will continue for another month due to popular demand* Calling all art students, academics and everything in between. Are you a recent graduate (or soon to be)? Do …
Musicians have stumbled upon an unconventional and intriguing creative partner: plants. Yes, that's right, plants. Through the use of advanced sensors and software, …
Researchers at the University of California discovered that bots now excel at solving CAPTCHAs faster and more accurately than humans.
Imagine a place called Reprodutopia. How would such a place look like?
NeuroSky (founded in 2004) innovator in "wearable" bio-sensor/signal processing systems and SEGA TOYS are developing mind-controlled computer games and next generation consumer …
Erich Berger has a 96 year old grandmother who is a cyborg. She features dentures, hearing aids, glasses, pace maker, a metal implant on the pinkie toe, and more. Quotes from the …
Man's ability to control illumination is magical in itself but is seldom experienced as such because light switches are purely functional and generally don't stir up imagination. …
This copy of Rodins "Le Penseur" / "The Thinker" (1880) shouldn't have that much on its mind... By using laser-technology, Korean researchers have crafted the microscopic version …
The VIBE - emotional sensing necklace combines conductive ink and textile sensors. The necklace can read multiple biometric signals of the wearer and communicates them to other …
What you are looking at, is the logo of perhaps the (in idea) biggest competitor on the search-engine market. It is beta-testing right now, but its demo video looks promising. Why …
wired.com | video | Related posts: Robotic hand | Bionic arm Invented by Dan Didrick of Naples, Florida, the device has NO batteries, electronics, servos or actuators. Instead, …
Let's face it: every time your cellphone battery runs empty you feel amputated and you quickly run back to your house to connect to a powering-adapter. Bionic Power Inc. is now …
Human-product relationships increasingly play out in a realm which was previously considered exclusive for human-human and human-animal relationships. Panasonic now redesigned one …
Why not use the human body to grow products for the medical industry? The designer Michael Burton envisions Future Farm where the body is used as a farm to cultivate clinical and …
Nanotechnology isn't just protecting your food - it's in your food. Scientists are manufacturing nano-sized vitamins that are easier for our bodies to absorb. In the future they …
At the beginning of the computer era, many objects and experiences from everyday life were transferred to the digital environment in order to make technology understandable (think …
Our society seems to be driven by an obsession of gathering personal data. Yes, they say it is for your own good, so we willingly collaborate by filling in our most intimate …
Water inside your phone used to be rather devastating, but with the NEC FOMA N702iS (only in Japan) , designed by Oki Sato, it is turned into a joy. Watch the faked fluid move on …
Delicious retro-future meat from Japan. Food technology in the overdrive. Japanese researchers successfully cloned what is believed to have been the forefather ox of Gifu …
As technology evolves, people are more and more depending on it to function properly. But the nature of technology is that it needs networks, sources, software, batteries and …
WiredScience writes: Hackers who commandeer your computer are bad enough. Now scientists worry that someday, they’ll try to take over your brain. In the past year, researchers …
Today's technology advances so rapidly that people are often unable to update their media schemas in time and as a result are left cluelessly in awe of it all. Mike Thompson's …
So you’re triggered by our call for products and now you’re considering to send in one, two or maybe three of your brilliant products for the Nano Supermarket? Good. Or – and this …
Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …
The Dutch evening News payed a visit to our Nano Supermarket to familiarize the television viewers with the intricate world of nanotechnology and its potential impact our economy …
Now here is something for the NANO Supermarket : Massachusetts-based Draper Laboratories have developed a special injectable ink with nano–particles. This ink eventually could …
The Quest for Fire (1981) shows the Next Nature of 80.000 BC. Set in a world without highways, supermarkets, airports, Internet, television, farming, money or written language, …
In 2009, undergraduates at the University of Cambridge worked with scientists and artists to engineer E. coli into E. chromi , a new type of bacteria that secretes a range of …
Technology is evolving us, says cyborg anthropologist Amber Case in her 8 minutes of TED . We become a screen-staring, button-clicking new version of homo sapiens, relying on …
Humans are the only species on earth that cooks its food. Not only do we cook our food, but we usually find the flavor of cooked foods preferable to the raw version. Compare the …
Catalytic Clothing is a fashionably calm technology that aims to tackle air pollution by embedding a substance in the clothing that purifies air when you wear it. The purifying …
It works like this. Position yourself with a friend in front of a battery hen and flap your arms as fast as you can when the music sets in. The harder you flap the faster your …
The human body as an instrument is a cool example of how culture and nature are merging. Calvin Harris used a giant human synthesizer to perform his single. The material used is …
Manko sighed. Nada: 'Did you like it?' Manko: 'I have to admit that if this is the starter, I'm not sure I'll survive the main course.' Everyone at the table laughed. Manko: 'Let …
Are we creating the penicillin or the asbestos of the 21st century? Prior to the arrival of the Nano Supermarket , we share some speculative nanotech products with you. Here’s the …
#! Possibly the answer for blind people with cynophobia, the fear of dogs. This robot guide dog is stil a bit slow compared to the old nature version, but as technology advances …
We all know the cellphone masts disguised as trees , created in an attempt to blend technology within the 'natural' landscape. Now Taiwanese scientists have created trees that …
Swallowable Parfum is a digestible scented capsule that works through your own perspiration. Once absorbed, fragrance molecules are excreted through the skin’s surface. A unique …
A delicious Montepulciano in only 6 seconds? This is now possible with the universal Nano wine. All you need is a microwave oven. In 5,64 seconds at 1000 watt you have a sublime …
There is a domain of creatures that diffusively encircles an entire planet. There are so many of them that they occupy every conceivable ecological niche. Yet, despite their …
Congrats to Sean Serafini, the winner of our April Next Nature Spotter contest. While we received many images of fake nature , Sean's entry delves deeper into more diverse next …
Canada-based Okanagan Specialty Fruits is pitching a genetically engineered apple that does not turn brown when bruised or exposed to air. This new technology, available in both …
The One Laptop Per Child program is experimenting with what at first seems to be the lazy way to philanthropy: dropping off tablet computers in remote Ethiopian villages and then …
Nothing beats the factory-scent of expensive, freshly unboxed technology! Artist group Greatest Hits produced the Apple Unboxing Scent for use at an exhibition in Melbourne, where …
Our peculiar image of the week is exemplary of our human longing for technology that intimately integrates with our body & senses. We are all cyborgs .
With Energy Belt, stop treating your excess fat like a liability, and instead embrace its untapped potential. Artificial protocells in the belt mimic natural brown fat, taking …
Do away with dishonest health claims for eggs and uncertain promises of organic, free-range hens. With eggshells that change color according to hormones, medicines, and nutrients, …
350 million years after crawling from the sea, the Lungless suit will bring us back. Inspired by fish gills, the Lungless Aquatic Respiration Suit uses millions of cascading …
For years, people have relied on harsh drugs and irritating alarms to control when they sleep and when they wake. Now, the Nansense wristwatch offers an all-natural way to …
Nico is cute, cuddly and serious about your child’s health. Many adults smoke around children with no thought for their developing lungs. Covered in nicotine-sensitive nano-cloth, …
We call upon designers, technologists and artists to submit their speculative nanotech products for the next round of the NANO supermarket.
Designed by Luc de Smet, Awear is a speculative bracelet that can detect and record the sources of allergies for children in uncontrolled environments, such as schools and …
As the NANO Supermarket opens discussions on the ethics, purpose and usability of nanotechnology, Frederik De Wilde is researching its artistic possibilities. De Wilde is a guest …
The nature of humanity in the twenty-first century is, according to sociologist Steve Fuller, a ‘bipolar disorder’ beset with dualisms of identification such as divine/animal, …
Is your friend impatiently tapping on her phone, or is she just charging the battery? Researchers at the Berkeley Lab have produced the first virus-powered generator that runs off …
Designer Tuur van Balen argues biotechnoloyg is actually very accessible and creates an 'anti-depressant yoghurt' on stage.
Augmented Reality is supposed to be just over the "Peak of Inflated Expectations" of Gartner's hype cycle . This video, however, is vaulting the technology directly onto the …
A device that remotely controls cattle's movements promises to transform the American landscape.
A new armband interprets your muscle contractions to act as a novel computer interface.
Unpolished creativity at the Next Nature lab from the Industrial Design Department at the Eindhoven University of Technology.
Should digital technology imitate that which exists, or could it also surpass it?
In future electric cables could be made ??of spider webs. 100% natural electric cables, sounds like an oxymoron, but it’s possible! Researcher at Na tional High Magnetic Field …
A new implant lets blind people see letters, crosswalks and people.
Two master's students have created a speculative device to simulate the sensations of eating.
Media artist, filmmaker and wonderjunkie Jason Silva talks about technological evolution and why humans are gods with anuses.
Nano-scale sponges show promise for defeating a variety of bacteria and toxins.
Robots use swarm intelligence to rebuild coral reefs.
A new wearable device provides runners with info on posture, rhythm and stride length.
A bracelet able to transfer a touch between two people.
Buckle up for a 1:11:28 interview with technology philosopher and founding editor of Wired Magazine, Kevin Kelly.
Robots are coming to replace humans at work, are they a real threat to the world’s unemployed?
Kids learn the basics of electric circuits while playing with clay.
A tool that could turn the arm into a touch screen display.
At Home in the Lab with Mark Post, Father of the In Vitro Hamburger. Interview from The In Vitro Meat Cookbook
The latest subspecies in the Razorius line is the Razorius Gilletus Flexball. While Gillete proclaims they reinvented shaving, others argue Gillette's new razor is everything that's wrong with America.
Like the exorbitant feathers of the peacock, which only function is to aesthetically stand out amid its competitors, this new species of Razorius Gilletus only differs from its predecessor aesthetically.
Indium gallium arsenide couldbe the material of the new super computer chips of the future.
Researchers proved it is possible to provide the Moon with the wireless connectivity we have on Earth.
The Spider Dress is programmed to define and protect the personal space of the wearer.
Kids try to figure out what the "prehistoric" Walkman is and how it works.
Researchers are working on artificial organs-on-chips will be used for drug development.
Scientists have been trying to develop GM pigs that could be used to solve the shortage of organs for transplant patients.
Bioengineers at Harvard University have created the first cyborg tissue.
It might be possible to grow a new heart in labs using spider silk.
If you do not want to slave away under the sun, pushing a bulky mower around, drones can do it for you.
This potentially revolutionary device includes LED lights and temperature sensors to provide medication directly to the wounded section of the skin.
The popular car brand is working on augmented reality goggles that enhance the driving experience.
In these modern times a traditional first aid kit won't do anymore. As the world around us innovates, our needs in case of an emergency change as well.
Amazon introduced a new gadget, named Dash Button, that will help you order groceries automatically.
This piece from Ars Technica details the breadth in the variety of energy sources emitting from our every day interactions.
From chef, to nurse, and also lover. Get ready, a new generation of robots is going to invade our lives!
It seems thinking machines could put the human race in danger. How realistic these fears are?
The glitch meant many woke an hour earlier than usual, leaving not just phone customers but whole households unhappy about rising early.
Stephen Hawking gives his opinion on what technological unemployment, aka machines taking over our jobs, can represent for future human societies.
Although it still is a theory, nanotechnology might enable us to control the elements, except fire.
No matter which brand is going to rule the wireless headphones scene, it's time to get used to have a computer in our ear that we never need to take out. Until it may grow into it someday!
A team of cyborgs and digital enthusiasts developed a wearable technology for the body that perceives a human sixth sense.
The first beauty contest judged by complex algorithms has sparked controversy after biased results.
After reports of Samsung phones causing serious damage, plane delays and even hospitalization, the company made a first recall. However, the new phones were still bursting into flames.
Part two of a ten part series exploring the design of an invisible technology: money.
Here's a look at how drones can and will impact the agriculture and farming industry.
Robert Gordon says all the major inventions have been made, but that's only true for our limited knowledge of future possibilities.
Facebook provides a new tool for suicide prevention
Researchers have the developed the EQ-Radio: a tool to read people emotions from a distance.
Robots in health care could lead to a doctorless hospital.
The Scrip, a new universal cash device is bringing back the old metallic sparkle of the money and mixing it with today’s technology in order to fill the deficiencies of our credit and debit cards.
Our workshop with kids from Lanterna Magica, an unconventional primary school in Amsterdam.
Australian biohacker Meow-Ludo Meow Meow implanted a chip in his thumb to make contactless payments.
In the last months we've been witnessing a refugee crisis of huge proportions. More than a million people crossed the sea to flee violence in Africa and the Middle-East. Together …
This robot nanny is designed to take on adult responsibilities, raising concerns regarding the consequences of using robots to raise our children.
U.S. researchers are working on an affordable braille tablet for blind people.
Researchers at University of Washington have introduced a new wireless communication method that allows small wearable devices to ‘talk’ to everyday devices.
Samsung just revealed the prototype version of Bedtime VR Stories, a technology that connects parents to their children in virtual reality, right before bedtime.
Jasper van Loenen developed a wearable that sends a corrective electrostatic shock to its wearer when visiting an unprotected website.
The first cyborg Olympics will take place in Zurich in October.
With her project Future Food Formula, food designer Chloé Rutzerveld is looking for innovative methods to design vegetables.
Scientists keeping a human embryo alive in lab for 13 days for the first time.
Gene therapy can cure up to 200 different diseases and the list is growing.
Google cars can now measure urban air quality and collect data to create interactive maps with the most detailed views of pollution patterns ever created.
The Juncao Technology Project makes it possible to grow edible and medicinal fungi on chopped grass or herbal plants.
Imagine being able to enter your office through a digital representation of reality. It sounds crazy, but it’s possible with augmented and virtual reality.
We are pleased to announce the launch of the Next Nature Memory Game. Now available in our web shop, it playfully explores the shifting borders between biology and technology.
The gift giving season is once again upon us and to help out those who are struggling to find that perfect gift for that special someone we have brought together a collection of Next Nature inspired gifts.
The Tappy 'smart ring' is a wedding ring connected to your bank account.
The EyeQue personal vision tracker is a smartphone app that allows you to test your eyes from the comfort of your couch.
On the occasion of the Earth Day, 22 April 2017, philosopher Koert van Mensvoort wrote his Letter to Humanity.
It’s been called China’s “pork miracle.” For centuries, pig-rearing in the country was predominantly a backyard occupation. (The etymology of the Chinese character for “home” …
It takes years to design a new banknote, having hundreds of people working on every little detail, all done under the watchful eye of governments and professionals. However today, …
Over time, our bodies, our food and our environment have become more and more subject to design. As designers, we hold the responsibility and have the unique chance to envision …
The ECO Coin Award honours outstanding ecological heroes. In 2015, we handed out our first ECO Coin award to Yoyo Yogasamana for his digitalization of sustainable knowledge to …
The Netherlands leads in cheese, clogs, and cultured meat. This sustainable and animal-friendly form of meat has largely been developed in our country. In 1997, Willem van Eelen …
Australian regulators will soon be faced with a challenge: can animal flesh produced in a lab be called meat? Amid reports that lab-grown meat could be on sale this year, the US …
It may soon be possible for your phone to automatically figure out whether it’s you or your five-year-old who’s swiping the screen—and, if it’s the latter, block apps you want to …
Growing meat artificially, instead of within an animal, may soon be an available reality. Meet one of the pioneering developers of this product of the future: Aleph Farms. With …
Conventional wisdom says that you can’t replace the human touch in terms of medical care, but in our rapidly changing technological environment, it appears that this perception …
Robots are coming for our jobs. Virtual reality is coming to make the jobs that remain easier to accomplish. All of the world’s manufacturing sectors are in the process of …
Designers face an unprecedented urgency to alter their methods and reprioritize their goals to address the accelerating degradation of the environment. This new …
Oded Ezer is a typographer from Israel who never fails to push boundaries, or rather, discard them altogether. Ezer is a rebellious force that swings between commercial and …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
For thousands of years people used oil lamps and candles to illuminate their homes during the hours of darkness. Neither produced much light and both were inconvenient in use as …
Within a few years, it may be possible for premature babies to grow inside an artificial womb. And when that day arrives, should men be able to give birth to children? Should we …
Our In Vitro Meat Cookbook has inspired many people around the world. Just recently, we had the BBC over at our headquarters to see what makes us thick. This idea of in vitro meat …
A few years ago, convincing meat-free “meat” was nothing more than a distant dream for most consumers. Meat substitutes in supermarkets lacked variety and quality. Plant-based …
The virus is forcing all of us to sit at home. While we are allowed to have social contact—albeit at an appropriate distance, intimate contact is hard to find. How to cope with …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
Matilde Boelhouwer is a designer whose work speculates between art, design, science, biology and food. Matilde shapes this obligation into a studio which mainly focuses on the …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
Imagine waking in the night, and feeling the vibrations of an earthquake on the other side of the world pulsing through your body. This is a reality for Catalan-born artist Moon …
It's that time of year again; the Unicode Emoji 13.0 has announced that 117 new emojis are to be implemented in the second half of 2020. It got us curious of what these new emojis …
The current lockdown in much of Europe has city-dwellers flocking to the countryside to wait out the outbreak sweeping the continent. Seeking relief from coronavirus, urbanites …
From all the memes that have reached me through my screen since the outbreak of the corona pandemic, there is one that perfectly reflects my thoughts in the beginning of March …
For years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …
Data Dating is an exhibition that explores what it means to find romance in the internet age. Love it or hate it, technology has transformed the way we date. So, how are digital …
Good day astronauts of spaceship Earth! Today it was announced that Next Nature's plans for the Evoluon have been awarded a financial contribution of €7.6 million from the Region …
If we could extend our senses in order to perceive the planet in a deeper way, would our understanding and our behavior towards it be different? We caught up with cyborg …
The influence of humans on the earth can hardly be underestimated. Think of climate change, deforestation, and the decline of biodiversity. We are heading for a sixth mass …
Where were you on the 4th October 2021? During the day that will be remembered for the Facebook outage, not everyone was equally impacted.
Shimmering lights drifting as elm seeds in the wind, luminous strings of light shifting between man-made and natural structures, dandelion seeds melding with brass and light. …
In July 2018, a century-old red oak went live on Twitter. The account @awitnesstree , tweeting from the Harvard Forest in Petersham, Massachusetts, introduces itself in its bio: …
FIBER Festival explores the future of a changing world through audiovisual art, daring conversations, and experimental electronic music.
In 1972, the Club of Rome published The Limits to Growth, a report about the future of the world. They described the limits of the world’s resources and what it is capable of …
In the summer of 2018, the European Court of Justice (that’s Europe’s highest court) reviewed a case and concluded that gene-edited crops should be subject to the same regulations …
The Moon Gallery aims to set up the first permanent museum on the Moon. Soon launching to the International Space Station, full of ideas worth sending to the Moon. The gallery is …
People in the world’s developed nations live in a post-industrial era, working mainly in service or knowledge industries. Manufacturers increasingly rely on sensors, robots, …
The new sci-fi musical “ Neptune Frost ,” set in a Rwandan village constructed with computer parts, tells the story of an intersex hacker and a coltan miner who lead an anarchist …
The next solar farms might be located in space, instead of on Earth. A prototype satellite by Caltech launched in January seems to be up and running, showing its capability to …
This speculative kitchen device shows us a future where growing meat at home is not just a possibility but a reality.
Embracing nature's ingenuity, designer Nicole Chrysikou harnesses the power of bacteria for her pottery practices.
Food design gives us a taste of innovation. It visualizes, speculates, challenges and problem-solves.
We have identified eight key defining moments that tell the story of geodesign, from ancient insight to artificial intelligence.
The GloCar uses LED lights to change body panel colours, intensity and frequency. A driver can thus choose at will to either stand out or blend in. Alongside the cosmetic value …
The body suit pictured above has LEDs that illuminate according to the wearer's state of excitement. Skin signals are measured and change light emission through biometric sensing …
Consider an Orangina bottle: shaped like an orange it is designed to look like one. But it does so in a very primitive way. Imagine the product is the packaging. Wouldn't it be …
One day you will step into the garden to look at the flowers - and the flowers will look back at you. Rich Fletcher, Nikolai Slavov, and Hiroshi Ishii from MIT Tangible Media …
A critical and visual take on culturally emerged Nature. Full of statements from designers and thinkers from around the globe. Wild systems, Genetic Surprises, Calm Technology, …
No self-respecting manager would be without a BlackBerry. But now these handheld gadgets, which provide workaholics with constant email updates, are being blamed for chronic …
If you're longing for the touch of a loved one who is a few thousand miles away, what better way than to pick up the Hug Shirt for the both of you? This shirt is capable of …
Tickle is a small robot that walks on the human body to generate a pleasant, tickling sensation.It has two motors and rubber feet for a good grip on the skin. When it encounters a …
Behold the BoxFish, Mercedes' bionic concept car. This tropical fish is outstandingly streamlined. Its engineers were able to achieve a wind drag coefficient of just 0.06 in the …
Tech company Fuijtsu released a new way to look around you while driving a car. Following the old fashioned neck turning and mirroring this tech has cameras around the vehicle to …
Nowadays, children know more corporate logo's and brands than bird or tree species. The average Western person has more worries about the instability of financial markets and …
A million years from now that hand would probably look more evolved, but the idea is nice: What if we would mold objects of the now into stone or bricks to preserve them over time …
This Tuesday, search giant Google released an experimental tool that tracks the intensity and movement of the influenza virus across the United States by monitoring the number of …
Starting next spring, a complete human-genome sequence can be ordered the Californian startup Complete Genomics for just $5,000, Techreview reports. Currently sequencing still …
Too much carbon emissions warming up the planet? No problem: just bring the stuff back to where you got it from in the first place. Experts have been advising to bury carbon …
Humans have domesticated animals for thousands of years. The earliest known evidence of a domesticated dog is a jawbone found in a cave in Iraq and dated to about 12,000 years ago …
At Massachusetts Institute of Technology , Christopher Love and colleagues are working to find out whether energy from trees can be used to prevent forest fires. A sensor system …
If you've ever wanted to know just exactly how much DNA you share with your ridiculously tall brother or doppelganger best friend, you'll soon be able to find out. 23andMe , a …
Voodoo is an ancient religion, originating from Africa, who’s mystical practice is believed to bring reward to those who are willing to place their destiny in the hands of loving …
May 17th 2008. Biggest Visual Power Show: Next Nature in LA . More pictures below. We are all born in a world that has been designed already. BVPS intro video by Floris Kaayk. Big …
The shrinking size of electronics allows for the implantation of increasingly sophisticated electronic devices in the human body, paving the way for new prosthetics and …
Most people know about light emitting organisms such as jellyfishes, fireflies and mushrooms . Some time ago, genetic engineers transferred genes responsible for the luciferin and …
A renewable energy technology company in Australia designed this power generation system inspired by the shape of the tailfins of sharks, tuna and mackerel. The currents on the …
Forget about palmistry! MRI scans for candidates in top jobs such as bank directors could soon become part of the job-application package, says Erasmus University researcher Prof …
Dr. Herb Smokler teaches us how to husband and harvest Computational Wood. Omitting he jerky production value of the video, one has to appreciate the inventive idea of treating …
Image: A. Sidorov Have you ever fantasized about creatures which carry the biggest smile? Or creatures which are so deeply covered with fur that you wish they were real? Good …
The Eyeborg Project is the work of Rob Spence, a 36 year old filmmaker residing in Toronto, Canada and Kosta Grammatis – an unemployed engineer from San Francisco, California. …
John Hart, assistant professor of mechanical engineering at the University of Michigan, is inventing techniques for growing carefully structured forests of high-quality carbon …
Are you ready for some techno-optimism? Buckle up and enjoy the ride with bio-tech evangelist Gregory Stock . Some quotes from his prophetic TED talk : "We are seizing control of …
Graphic designer Roel Boonen takes the Apple cult to the extreme with this iReligion triptych. His piece is illustrative on how central corporations and digital technology have …
This smart-looking image is a model of what James M. Tour at Rice University (Texas) and his research team like to call a 'nanocar'. The clustered molecules can roll around on a …
Buttons are everywhere: throughout your day you press them on phones, alarm clocks, keyboards, elevators, dishwashers and of course on the computer screen. Although buttons did …
Scientists at the Eindhoven University of Technology are creating artificial pork. Prof. Dr Mark Post and his colleagues of the department of Biomedical Engineering have extracted …
Getting information as fast as possible and on the spot is the trend. So what could be more direct than having information fired directly into the eye? Today - together with his …
Coughing into your cell phone could soon save you a trip to the doctor's office. Thanks to software currently being developed by Star Analytical Services , people may soon be able …
As our everyday living spaces are packed with electronics and become increasingly sentient, we might one day wake up in a house that knows more about your family's state than you …
My name is Jason Silva. I've spent the last 5 years hosting and producing a tv show on Al Gore's Emmy-winning Current TV network and I'm a fellow at the Hybrid Realities …
By analyzing billions of phone calls, researchers at Scandinavian telecom company Telenor , mapped how social connections between people – measured partly by how often they called …
With all the new health management gadgets available becoming more and more widespread and cheap (even in the form of free iPhone apps), your brain, your stomach, your heart, …
As technology progresses we constantly have to adapt ourselves to an ever changing media landscape. Designers try to smooth the changes with a ' progressive nostalgic ' strategy: …
Some years ago scientists managed to build a rudimentary invisibility cloak, which was an impressive device but it had some important limitations, not least of which was that it …
"Have you seen my stapler? No, but just look it up on Google home office maps ." CSIRO Researchers have developed miniature sensors that track lab equipment, coffee mugs and …
Surely we are quite attuned to some unexpected flavors in these quarters, but this Nano Care™ Blueberry Paste Wax wins our syncretic mash-up award for combining technorethoric …
What if a scratch on your car door could heal itself, just like the human skin does? Engineers are working on a way to transfer the self-healing ability of the skin to surfaces …
Are we creating the penicillin or the asbestos of the 21st century? In the months preceding our Nano Supermarket Project , we share some speculative nanotech products with you. …
Brian Eno - artist, composer, inventor, thinker - spoke to Kevin Kelly about the meaning of Africa for music and technology. "Africa is everything that something like classical …
For most of us, obtaining food is easy. We go to the grocery store, where fruits are labeled and meats arranged by species. We go to a restaurant, sit, and wait for our food to …
No shellfish, no peanuts, no soy, no milk, no eggs. An increasing number of people suffer from various food allergies, which force them to constantly scan food packages for …
Researchers are working on a language and a device that will help humans and dolphins talk with each other. Denise Herzing , a researcher and founder of the Wild Dolphin Project …
In the short movie Blinky, on a boy and his robot, director Ruari Robinson reflects on our daily dealings with technology and its risks. Alex is a child growing up in a family …
Inspired by crickets, researchers of the MESA+ Institute for Nanotechnology of the University of Twente in the Netherlands have build a biomimetic sensor that can measure changes …
By nature, man is not meant to fly. But while we're at it, we may as well turn it into an experience . Charles Champion, Airbus Executive Vice President Engineering, envisions a …
Manko was completely cut off from everything around him, virtually dead, buried alive inside of his own body. He remembered Zero's advice not to panic, but to no effect. He had no …
When Nada returned as promised with a small bowl of soup in her hands, Manko was sitting upright with a grumbling stomach. Even now that Manko could see normal again, Nada's hair …
From Friday 28 January - Wednesday 2 Februari the Nano Supermarket will be opened at the Leidseplein in Amsterdam. Additionally, on the 27th of January we will be opened at the …
The appliance company Bosch claims that its new technology keeps food so fresh that meat from the Ice Age (and presumably the Cretaceous as well) can be stored without incident …
Say hello to teacher Engkey ! The city of Daegu — South Korea, introduced 29 robot teachers in 19 elementary schools as part of a large scale project to robotize teaching. The …
If Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …
For just £1.19 ($1.99, €1,59) you can download an app for your iPhone which offers tips and guidelines with the sacrament, "the perfect aid for every penitent" as the description …
Every time we eat a piece of food, we take a bite out of the world. All these small bites tell a dozen stories. A carton of eggs presents the story of contented hens, a bottle of …
The Animal Architecture Awards have just announced the winners of their 2011 contest. Taking first place is Simone Ferracina's Theriomorphous Cyborg , a (speculative) augmented …
Food technology in the overdrive: Pork molded in the shape of a piglet.
Did you know that phones were once used for calling up our (human) friends? Researching the beginning of it all, we came accross demo video's on the cloud called "internet" where …
Associate professor Anne Trubek argues that handwriting will soon be history , because writing words by hand is a technology that's just too slow for our times, and our minds. A …
Has nature become a fairytale or do we want it to be one? In their installation The Clockwork Forest , artist collective Greyworld seems to opt for the latter. The work of art …
A team of researchers from three universities have succeeded in creating the first device that boosts the brain power of primates. In the study, five rhesus macaques were trained …
Although chocolate milk producing cows may sound silly, scientists are seriously analyzing the feasibility of the idea. Why not add genes of cocoa and sugar to a cow, in order to create a cow that produces sweet chocolate milk?
La Pâte Meat Fruit aims to seduce and inspire diners with an entirely new eating experience that balances eating meat and fruit. In vitro technology is used to grow meat …
Biological physicist Gabor Forgacs normally works on the “printing” of new organs for use in clinical trials, however, his technology could also be used to bioprint meat. In the …
At first sight it seems plain wrong to roast your burgers on this utterly technological machine: barbecuing is supposed to be a nostalgic low-tech activity that brings us back to …
Some months ago we wrote about the dream of mechanical-engineer Jarno Smeets to fly like bird . Over the last few months Jarno worked steadily to materialize his dream. Today …
Using a condom impregnated with artificial nano-antigens, Conception Control only permits sperm with the right chromosome to pass through: X for girls, Y for boys. Conception …
Dog feces are an unsightly blemish on city streets. With Glo-Doo, dog food laced with bioluminescent bacteria transforms each pile into an appealing way to light up the night. As …
Using genetically modified bacteria, Keratin Ink turns your fingernail clippings into a highly personal ink for writing and drawing. The bacteria transform the keratin in your …
At the beginning of menopause, celebrate your reproductive past by giving “birth” to a unique peace of jewelry. By using Menoé’s nano-coated birth control pills over a lifetime, …
No, those aren't plastic trinkets or beads from a craft store. They're diatoms, a group of single-celled algae, and unlike almost all of our current technologies, they can rapidly …
While for most of us, happy blog readers, access to electricity is taken for granted, things are quite different in developing regions of the world. In India for example, over 65% …
Roads are a ubiquitous, even defining aspect of our urban and suburban spaces. In the United States alone, parking lots and roads cover 16,000 square kilometers. So why must roads …
Imagine how much easier the job of window cleaners would be if they could simply scale walls like Spider-Man instead of using elevators, ladders and other gear. Ever since the …
Nanocrystalline cellulose (NCC) sounds almost too good to be true. The same microscopic particles that help trees to stand up straight are also lightweight, non-toxic, stronger …
Krill, those tiny members of the ocean's planktonic community, have an importance disproportionate to their size. They are a vital food for whales, penguins and increasingly, …
Artist Bartholomäus Traubeck created a hyper-nostalgic record player that, rather than making music from vintage vinyl records, uses slices of woods to generate sound.
Google becomes the authority on existential questions about aging.
Are you blessed with a Maria Callas kind of voice? If, like us, you don't go beyond croaking the occasional " I want to break free" in the shower, watch out. If the artists of …
Farmers in the US are producing fuel and high-quality fertilizer from their cows' manure.
There are robots that look like people, and then there are robots, like the Ecobot III, that look nothing like humans but have our same biological needs: they have to eat, digest …
A new kind of piezotronic transistor mesh could make for robotic skin that’s as sensitive as your own is, covered in thousands of tiny mechanical hairs.
A so-called "natural" beer is marketed by portraying an utterly technological process.
Is a deep-fried iPad as unhealthy as a McDonald's meal?
Hendriks’s activity explores the positive transformative power of creative impulses and the importance of fundamental free scientific research.
Invisible ear implants for listening to music, getting directions, and recording conversation.
Buckle up for a new series of videos from performance philosopher Jason Silva.
Retro futuristic vision from the sixties: "The menu is given to the automatic chef via typewriter or punched computer cards."
When moss photosynthesize, they release nutritious fats, carbs and proteins into their roots to feed colonies of helpful, symbiotic bacteria. In the process of breaking down these …
Only genetic engineering can stop citrus from going commercially extinct. But is the public ready to accept GM orange juice?
Sensors, a communication interface and an actuator for tactile feedback all hidden ina wig.
Restoring the sense of touch with an artificial hand, using a brain interface.
The gumboot chiton snail produces the hardest biomineral known on earth - and it may hold the secret to better nanotechnology.
UltraHaptics is a system for creating haptic feedback in mid-air, offering new kind of interactions with our touchscreens.
New technology can make completely transparent paper.
Buoyant Airborne Turbine is a giant high altitude wind turbine that brings low cost energy to remote areas and off-grid sites.
LifeHand 2: a prosthetic hand that infers the ability to feel rudimentary shapes and forms by touch.
Electronic whiskers put sensitive catlike sensors on robots.
A company is working on culturing celebrity stem cells for cannibal cuisine.
Scientists succeeded in implanting non toxic nano-motors into living cells.
A jury of design and science experts awarded the best NANO Supermarket product a € 2.500 prize.
Is there a possibility to clean up the oceans from plastic pollution?
This 3D Grass Printer can print a garden in any shape you can imagine
Researchers found a technology that allows to recover valuable substances from wastewater.
In 1981 the idea of what we call smartwatch was nothing more than a funny joke.
The '50s robot band, Le Trio Fantastique, is exemplary of human distant longing for technology that integrates with our body and senses, to the point of taking our place!
In vitro meat has the capacity to transform meat production as we know it, introducing an entirely new way of thinking about and interacting with food.
The first 3D printed house is a recognisable and attractive Dutch Canal House, an exhibition and building site in the heart of Amsterdam.
Power Loader: the power amplification exoskeleton robot.
The top three aspects why people should support cultured meat.
On the emerging field of technologies that are worn close to or on the body
Will handwriting soon be history? Or will we always prefer a handwritten love letter from our beloved?
Cultivator is speculative design project on how bioprinting could find its way into the kitchen of the future.
The current technology has not been able to replicate Christ the Redeemer perfectly, until now.
Ikea’s research laboratory was inspired by our Magic Meatballs to re-design their famous meatballs.
Facebook introduced its solar-powered drone project aimed to provide internet access to rural areas.
Time ago we wrote about the fact that US Food and Drug Administration was considering whether to approve the first genetically engineered salmon. We have a verdict: from now on …
A wooden floor that follows the curves of the tree it's made of, thanks to smart milling techniques.
While the Watson technology is exponentially increasing its processing power on an annual basis and steadily moving from answering trivia questions, to cooking advice, onto medical advice, it is about time we confront it with the million dollar question: "Watson, what do you want?".
A musical robot able to improvise a jazz solo in response to an actual person performing jazz.
Naomi Kizhner designed jewelry that can theoretically harvest energy from the body of the person wearing it.
A startup called New Wave Foods is developing artificial shrimp meat in the laboratory.
There is now a new application that allows random people to cheer you up on Twitter.
Starship, a robot that will remodel our local deliveries system.
With its 656 beds, this hospital offers unconventional and leading computerized assistance for all sorts of patients.
In the quest for competitive advantage, companies adopt wearable biometric technologies to monitor employees and improve business results.
The tour of our lustrous NANO Supermarket is coming to Riga, Latvia.
A group of students at the MIT Media Lab are working on an electronic textile that might help us interact with people more easily.
A 3D printed helmet able to translate brain activity into the movements of its shape-changing structure.
My New Flame uses LED technology to faithfully recreate the experience of light from the ancient past
According to researchers we could go a step further and use stem cells derived from your skin cells.
Some of our greatest cultural and technological achievements took place between 1945 and 1971. Why has progress stalled?
What happens when our dreams become a commodity and advertisers gain the technology to enter our dreams?
Scientists managed to create what every woman has been dreaming of: a second skin to reduce wrinkles and tighten the skin.
ching 64GB SD cards to each of our fingers challenges how we store and share information in a world were our digital privacy is at risk.
The eco-friendly food packaging material able to improve food safety, conservation and quality.
Mercedes-Benz just revealed the first self-driving city coach and took it to the streets of Amsterdam for a test drive.
Chloé Rutzerveld presents a modern version of the iconic stroopwafel, fully made of vegetables.
Interview with Govert Flint, designer, architect and self-taught artist.
Researchers created solar cells as light as a soap bubble.
Eating meat has made us who we are today: evolved, intelligent humans, able to use a verbal language.
Replacing your old heart with a new heart from an animal may seem extreme? Well, this future may arrive sooner than we think.
Extinct European bisons are being reintroduced in parks. But what makes a national park?
The Modular Body is an online science fiction story by Floris Kaayk about the creation of OSCAR, a living organism built from human cells.
As emerging biotechnologies are blurring the lines between synthetic food and natural food, who will regulate cellular agriculture?
Spiritual leader Deepak Chopra just unveiled a 20-minute therapy session inviting us to come back to the present moment through virtual reality.
United Nations aims at turning a playful technology into a serious medium.
A robot monk has been created in China, mixing spirituality with artificial intelligence.
In 1978, the world's first test-tube baby was born, her name is Louise Brown.
It should come as no surprise that artificial intelligence naturally extends into the way we work. Let's look at how AI changes the way we relate to work.
We asked Ritsert Mans, our second ECO coin award nominee about his bike, the technology that fuels it and his hopes for the future.
Virtual reality experiment tries to help people frightened of death with outer-body experience.
NNN fellow Govert Flint discusses Enrichers in Frame magazine.
In 2017, a hoverboard can fly 164 feet above earth and able to hover over the Atlantic Ocean.
We talked with Bas Haring to discuss the conception, image and will of the robot. Read our conversation with him and update your ideas about robots.
The Next Nature Academy offers the philosophy, the tools and the methods that will shift the way you think about nature and technology.
A new feature rumored to be in the next iOS update called Theater Mode could dim smartphone usage in cinemas.
This is post number three of our serie 'Robots at Work'. In this episode we present you five jobs for facilitators, the ones who love to work with technology.
A new report recommends that we decide the legal status of robots sooner rather than later. It even suggests that they could be given personhood and rights.
Forever by your side. Elrois a South Korean firm developed an app that allows you to engage with your dead friends lovers or idols.
A robot inspired by a sloth was developed in order to control crops growing in our fields.
Researchers at the University of Technology in Delft have created flat structures able to fold themselves into three-dimensional constructions.
Right now, somewhere in a laboratory in California, the Netherlands or Japan, a technician is taking a few thousand skeletal muscle cells from a living animal, and placing them in …
And it’s already showing incredible results. VR transports us to faraway worlds without even asking us to leave our chairs. Yet we usually hear about it in the context of video …
The oldest known serious candidate forerunner for the bicycle is the ‘running machine’ built by the German Baron Karl von Drais. His two-wheeled machine became known as the …
Five people suspected of illegal gold mining in Peru are in custody after indigenous community members used a system called ForestLink to alert authorities to the activity. …
Genealogy services have exploded over the past few years, and Spotify is capitalizing on the boom by providing curated playlist based on users’ DNA. Here's what you should know. …
The South Beach diet. The Atkins diet. Eating paleo. Cutting out gluten. Going vegan. The list of fad diets and health crazes goes on, yet health statistics in the US and around …
Hello meat lovers! In vitro meat innovator Aleph Farms has taken the saying 'one small step for man and one giant leap for mankind' to a whole new level. The startup has succeeded …
As a young bio designer at the start of your career, you'll have to overtake all kinds of obstacles. From the collection of living materials to working in a laboratory and …
Emma is in poor health. She has painful varicose veins, stress-related eczema, puffy skin, a grey complexion, red eyes and a hunch-back. She is an imagined office worker of the …
To our Chinese friends (and beyond)! From 2 November 2019 to 1 February 2020, we'll be crossing the globe for a large showcase at the OCT Art and Design Gallery in Shenzhen, …
Now that the team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …
Transforming the way we travel is an essential part of tackling the climate crisis. The transport sector contributes about 20% of global carbon emissions . In the UK the figure is …
Each year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honour them with our ECO Coin Award . We …
With most of us stuck at home because of lockdown, for the singles around us intimacy may have turned into a distant dream. Could we find our salvation in technology? And what …
What does it mean to become a cyborg? Better yet, aren't we cyborgs already? What then, does it mean to have a body? Is a 'standard' desirable, what does that even mean, and what …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
What if design began to put everything but the human first? The needs of the human not paramount to the design process, but instead the other entities that we cohabit planet earth …
You are what you eat; a quite common message in the midst of our self-growth society. We have to eat well to become the best version of ourselves - more productive, healthier …
As our reality exists increasingly within digital realms, our virtual world demands a virtual identity. Our work is hybrid, our social identity is online and our connection is …
The 14 Golden Rules of HUBOT are rules of conduct which must be followed and which everyone needs to hold each other to account. Themes like respect, teamwork, creativity, and …
If you are a regular reader of content from Next Nature, then you know that 3D printing can be used in all sorts of technological developments, such as organ printing , food waste …
The image of the whole Earth as seen from space has become a symbol of the environmental movement. Time for an update?
There are more than 1.4 billion cars in the world today, and that number could double by 2036 . If all those cars burn petrol or diesel, the climate consequences will be dire. …
In old nature, wood is grown in the forest. In the next nature, wood might be grown in a lab. Akin to the process of growing in-vitro meat , researchers in Velásquez-García’s …
The human world often sees itself as separate from the rest of the natural world. Because we have deemed ourselves, ironically, as higher functioning beings over all others on …
From icy tundras to billowing clouds, the colour white crops up repeatedly in our planet’s palette. This colour provides a natural way for light from the sun to reflect back from …
This is #1 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …
From mouse, to stylus, to finger: our virtual tactile perception has changed a lot over the years, just like our overall virtual experience. With new developments our virtual …
The podcast Food by Design was created by Sarah Codraro and Sandeep Pahuja, and is hosted by Sandeep. According to the makers "Our food system is not 'broken'. It’s working …
While the pandemic has restricted us from doing many activities we like, household hobbies such as DIY , baking and crafts have become more popular. Now there’s a way to combine …
Promising food design projects do not always find their way to producers, the market and ultimately to consumers. Why is that and what can we do to advance these ideas? Why is it …
We need to talk about COVID-19. Again (or, still). One of the main questions about SARS-CoV-2, the virus that causes COVID-19, has for a while been about its origins. Most viruses …
Globally, humanity consumes almost 350 million tons of meat a year. In the next 10 years, this number is expected to increase by a significant percentage. Scientists believe that …
The textile industry is the second largest polluter in the world that leads to a chain reaction of nasty results: loss of biodiversity, water pollution and soil erosion are just a …
In a feat of biomimicry that seamlessly marries biology with physics, tests carried out at the University of Southern California’s Viterbi School of Engineering made fascinating …
For the last six months millions of Indian farmers have been marching through the national capital in an effort to repeal the laws that they believe would end guaranteed pricing …
Roman Krznaric's ultimate guide to radically change our perception of time and become good grand-grandparents
In Next Nature: Why Technology Is Our Natural Future , Koert van Mensvoort takes us on an epic exploration through the wonderful world of culturally emerged nature. It offers a …
In Next Nature: Why Technology Is Our Natural Future , Koert van Mensvoort takes us on an epic exploration through the wonderful world of culturally emerged nature. It offers a …
It’s our pleasure to announce the first issue of the Next Nature Magazine. Indeed, a good old fashioned magazine. Next Nature Magazine presents 176 pages of thought-provoking …
The idea of colonizing Mars has become the big speculative future of humanity on Earth. But, artist Alexandra Daisy Ginsberg has radically different ideas to contribute to the …
In an era of high-tech and climate extremes, we are drowning in information while starving for wisdom. Architect Julia Watson imagines a design movement building on indigenous …
When the first baby is born off-Earth, it will be a milestone as momentous as humanity’s first steps out of Africa . Such a birth would mark the beginning of a multi–planet …
In 2020, scientists made global headlines by creating “ xenobots ” – tiny “ programmable ” living things made of several thousand frog stem cells. These pioneer xenobots could …
Will there still be a supermarket as we know it today in 2050?
Many aspects of the current metaverse were already familiar 143 years ago.
What does the supermarket of the future look like? The Embassy of Food at Dutch Design week.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Sleep and dream like a koala, relax under biodiversity and feel the meditative effect of artificial wildlife.
Cyborgs - part human, part machine - are becoming more present in society, but their rights are not yet established.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Finding realistic solutions to the humanitarian and environmental issues in the textile and fashion industries.
The sun lies at the heart of our solar system, providing life-giving light, heat and energy to Earth. The sun always gives, without asking for anything in return. In the …
We met at the Floriade grounds in Almere with Xander de Bruine, program manager Floriade Expo 2022, with project manager Jennifer Palumbo. Along with head curator William Myers we …
From the mythical fountain of youth to the many anti-aging procedures available today: humans have dreamed of internal youth for a long time already. At lot of us perceive aging, …
It's not every day that someone walks into your office with a shoebox, and even more rare when that shoebox contains a potential future.
A significant milestone has been reached as the US Department of Agriculture has granted approval to a vaccine for insects for the very first time. An important breakthrough, …
To explore the public opinion towards cultured meat, speculative food designer Leyu Li created fictional influencer “Meaty Auntie” and turned to TikTok.
Beyond being little umami bombs, mushrooms are: protein-packed and nutritious. But here's the pitfall: their cultivation can be pricy. Especially gourmet mushrooms such as …
Researchers used genetic information from an extinct mammoth to create a lab-grown meatball.
Remember when we created a little petition back in 2018 in the hope to legalise the tasting of in vitro meat? About 4000 of you agreed with us and signed it. If you were one of …
The Netherlands is a real coffee country. With the amount of coffee Dutchies drink per year, they have been in the top 10 of most coffee drinkers for years. Drinking so much …
Toregem Biopharma designed an antibody drug that can possibly regenerate teeth using the body's own tissues.
It seems that traffic jams aren't just a problem confined to Earth's highways and byways. How did this happen? And should we be concerned?
Wondering how next natural furniture may change your way of life? Will we feed our lamps? Grow chairs? Talk with our tables?
Designer Govert Flint proposes a new office concept, entirely based on movement and play.
To pay tribute to the destroyed orange petunias during the Petunia crisis, Klaus Pichler has composed an illustrative book.
Paradise by the Laptop Light is a visual power event with short films, speedlectures, special guests and one laptop. It will be held on 23 November 2007 16:30, as part of STRP Art …
Paradise by the Laptop Light is a visual power event with short films, speedlectures, special guests and one laptop. It will be held on Friday 23 November 2007 16:30 - 18:00, as …
The free cultural paper Amsterdam Weekly discusses the Natural Revolution of and includes tree tips for successful living in the next version of nature. Download PDF (148kb) . …
It might just be my old nature mind, but I still find it a daily miracle: being able to walk into the bakery around the corner and trade a piece of paper – called money – for a …
Now why is that girl so excitingly staring at a few blurry blobs on a flat screen? Is it because these blobs are connected to her breath... What? Yes that is right, you are …
Many people tend to eat too fast. As a result they do not receive signals from the stomach that they are in fact full. The result can be overeating and obesity . To encounter …
An interviewer once asked Pablo Picasso why he paints such strange pictures instead of painting things the way they are. Picasso asks the man what he means. The man then takes out …
For over 40 years Australian artist Stelios Arcadious Stelarc has made art with medical instruments, prosthetics, robots, virtual reality systems and biotechnology to investigate …
Susan Blackmore studies memes: ideas that replicate themselves from brain to brain like a virus. She makes a bold new argument: Humanity has spawned a new kind of meme, the teme, …
In the nineties laser printers revolutionized graphic design. Currently 3d desktop printers are revolutionizing industrial design. Next we will be printing buildings and …
DNA evidence has been the most bulletproof evidence for forensic sciences in recent years. Not anymore. A laboratory at Nucleix, a life-sciences company, has demonstrated it is …
Are you using Twitter and looking for faster ways to update your followers with your utterly mundane status on what you are thinking? Adam Wilson from the University of Wisconsin …
Douglas Coupland is a writer and artist based in Vancouver. For the canadian newspaper Globe and Mail, he wrote The ‘radical pessimist's guide to the next 10 years’ a dystopian …
There are many advantages of bare feet sporting: better motion control, more feeling in your feet and direct floor contact, etc. In this way you are more grounded and more aware …
Back in 2009 Rob Spence, a cyborg film maker, worked together with a team of ocularists, inventors, engineering specialists on a prosthetic eye which can capture and stream video. …
There is a new version of the well-known cellphone masts disguised as trees. Instead of adding fake nature to these masts, ChamTech Operations wants to put a layer of invisible …
Today, shoes have been naturalized to the extend that we hardly can imagine life without them. Yet, shoes didn't exist in old nature, hence there must have been a day when …
Breast cancer is a disease that comes with feelings of helplessness and loneliness. This nanotechnological necklace allows you to regain some control regarding your disease, in …
During the late 1930’s the philosopher Walter Benjamin wrote its widely influential essay ‘The work of Art in the Age of Its Technical Reproducibility’. While describing a general …
"Atmospheric energy" has the power to revolutionize the production of electricity.
With rising energy costs and our growing arsenal of iPads, smart phones, and wearable monitors, we're always on the lookout for new ways to power our devices. Perpetua Power , an …
Submit your speculative product to the NANO Supermarket and win 2500 euro.
The introductory essay from the Yes, Naturally book - available in our store!
During the 2014 Dutch Design Week, the NANO Supermarket debuts a new line of speculative nano products.
The desire to avoid face recognition algorithms could bring us a whole new set of make up styles,
Objects that normally used to surround us became more and more virtual, radically changing the aspect of our workplace.
Nowadays humans suffer from diseases that didn't exist in the past, a trend that will probably continue into the future. A wide range of new disorders, especially related to the …
Scientists are working on an ingenious approach to carbon capture that will enhance the way plants isolate carbon dioxide from other emissions in order to contain it.
A new biotech startup seeks to hack our cells to use solar energy instead of carbon and oxygen.
We had the honor of hosting Bruce Sterling in our Next Nature Network headquarters to talk to him about the concept of the convergence of humans and machines.
Conceptual designer Thomas Thwaites is currently investigating and experiencing to live life as a goat.
Going to the lustrous IoTx conference in Dubai this year? Don’t miss out the Next Nature lecture.
The SAVE THE HUMANS! book is now available on our web shop.
The Wearable Tomato Project consists in a robot that dispenses tomatoes.
A severely injured tortoise was saved by a team of doctors thanks to a 3D printed shell.
We already recognize faces in our cars, now it is time for our cars to recognize our faces.
Norman Foster's project for a Droneport that will give a valid, affordable alternative to reach and bring help to remote areas.
We recently stumbled upon a rare mutation: the non-disposable disposable razor.
What happens to robots that are no longer needed? In the future robots will be biodegradable.
The movie The Matrix brought ectogenesis to the public eye.
Future workspace, human interaction and unique experiences: here’s how artificial intelligence and VR impact on architects and engineers.
NNN is currently doing a preliminary research into the idea of the artificial womb. This timeline will help you navigate through the investigation.
What can we learn from listening to the buzz of bees' conversation? With the help of a new monitoring system, a Canadian researcher is hoping to find out.
If you’ve watched clouds roll by, you know wind moves more steadily in the upper atmosphere. Turbines just can’t reach high-altitude wind energy. Kites can!
An "electronic personhood" for robots has been discussed in the European Parliament recently, raising big questions about equality, citizenship, legal and ironically, human rights for artificial intelligent machines.
We published a timeline series to explore medical, cultural and technological developments in relation to the ectogenesis concept.
This is post number one of our serie 'Robots at Work'. In this episode we present you five jobs for caretakers, the ones that work with their hearts.
As if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …
The local fishermen looked on skeptically. From the deck of a small motorboat, scuba divers grabbed odd chunks of ceramic – which could be described as rocky brains stuck on …
Humanity is facing the disconnection between biological reproduction and the body, facilitated by the emerging technology of the Artificial Womb. Envisioned in bleak science …
Today is Earth Day! This means that we think about the relationship between man, nature and technology, as technology is becoming a nature of its own. Acknowledged in 192 …
Scientists have created a mutant enzyme that breaks down plastic drinks bottles – by accident. The breakthrough could help solve the global plastic pollution crisis by enabling …
The season of giving has come and to make sure you can find the perfect gift for your loved ones we have brought together a collection of Next Nature inspired goodies. Whether you …
The story of money: an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. The final episode: bits.
What makes us human? And why do we sometimes fear artificial intelligence? And what about technological singularity - the moment in time when artificial intelligence outperforms …
The first time I explained biomimicry to a stranger was not in a talk or a workshop but in a big-box bookstore just after Biomimicry: Innovation Inspired by Nature had come out. I …
Occupying the 52nd floor of Tokyo’s Mori Tower, Mori Art Museum is internationally renowned for its visionary approach and highly original curation of contemporary art. The …
Nature has always been a source of inspiration for many artists and designers, yet the urgency to connect to nature is more pressing than ever. Environmental issues such as …
Each year we celebrate ecological heroes as part of our ECO Coin Award and this year is no different. Have you seen an inspiring person who is making the world a more …
Facial recognition is increasingly being used in many countries around the world. In some cases the take up has been dramatic . As a result, people are being observed by cameras …
Patricia Piccinini is an artist interested in the relationship between humans and non-humans, the natural and the artificial, science and storytelling. Working with silicone, …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
The way we currently build is not sustainable. We will have to develop a sustainable living environment that matches our human needs, intuitions and potential.
1. THE FUTURE IS PRESENT Design Museum Danmark How will contemporary design define the future? THE FUTURE IS PRESENT grasps the very essence of Danish artistry of material …
This cell-shaped building for the institute for Nanobiomedical Technology & Membrane Biology in Chengdu, China, is an unusual croos-disciplinary collaboration between MIT …
While recent developments in brain-computer interface (BCI) technology have given humans the power to mentally control computers, nobody has used the technology in conjunction …
In the 1960s, scientists found that a particular jellyfish makes a protein that glows, known as green fluorescent protein. In the 1990s, using genetic engineering, researchers …
By putting this cockroach in control over a mobile robot, our perception of the animal is changed. Technology empowers the little creature you would normally squash under your …
Starting as noise makers, the owlproject work on different products which are deeply rooted in nature. And electronics.With their logs the owlproject travel around the world, …
The US Army Research Lab in collaboration with the University of Delaware developped a special liquid called s hear thickening fluid . It is actually a mixture of hard …
Earlier we discussed the Magical Interaction project, in which Joris van Gelder rethought the boring activity of switching on/off a light by transforming it into a magical …
Nowadays, most people can't make anything at home because it's too expensive. Roboticist Hod Lipson wants you to stop shopping and use his portable 3-D printer to make your own …
If future anthropologists would ever dig up this cellphone, they might identify it as some sort of mysterious pseudo-religious device carried around fervently by early 21th …
For mobile gamers in western Japan, a hearty seafood dinner awaits just a few key clicks away, thanks to a unique new cellphone fishing game that rewards successful players with …
According to the inventors of the dogpause bowl , slow eating dogs are happier than fast eating dogs. Having a dog in the first place is supposed to improve the quality of life, …
Shot taken before the robot in question short-circuited and started to kill all humans in sight.
So you thought that animated Pixar Lamp from the movies was just a fantasy? Not anymore. Luxalive is a prototype of an reading lamp that moves according to the character of its …
Confused with the pile of remote controls in your house? Now here is an idea: get a robot to control them. Researchers at Toshiba have developed a talking robot, named ApriPoko, …
'The LED Dog Tail Communicator' is an initiative of James Auger and Jimmy Loizeau, and it is part of the larger 'Augmented Animals' project. Its focus points to technological …
Are we on the verge of a future human evolution, one that isn’t, at least in it’s very core, “the survival of the fittest”, but rather “the evolution of the richer”? Think about …
Since the days of Plato, the lost city of Atlantis has captivated the imagination of many. The city, if you don’t already know, was said to be a naval power located roughly 600 …
Designer Laura Boffi envisions a future in which human instincts will leap behind on technological progress. For example, once the 'disease called mortality' is cured with …
By DAVID BARBOZA SHANGHAI — China made public on Tuesday regulations aimed at cracking down on the use of virtual currencies amid worries that a huge underground economy was …
Starting February 2009 the Industrial Design department of the Eindhoven University of Technology takes Next Nature as one of its educational themes. The Industrial Design …
Data-hungry companies like Google, Microsoft and Amazon could reduce their energy consumption with 40% by rerouting data to locations where electricity prices are lowest on a …
Japanese design agency To-Genkyo proposes a dynamic freshness label for meat products. The hourglass-shaped label contains special ink that changes color based on the amount of …
In the future, every street will be a Nokia street? Perhaps not, however we may expect some changes in street signage due to the arrival of mobile & gps technology. Once …
The big lobby to endeavor for a climate neutral lifestyle must have reached its peak. It is common knowledge that recycling electronic and battery operated utensils is better for …
Scientists of the University of Pennsylvania are creating electronics that almost completely dissolve inside the body, through the use of thin, flexible silicon electronics on …
Unsure how this melting polar bear ice sculpture created by artist Mark Coreth fits in Next Nature mythology. The art piece was presented last week in Copenhagen and is sponsored …
Gadgets! You love them when you buy them, but what happens next? Over half of Brits have abandoned gadgets because they don't know how to use them properly. Seventy-one per cent …
A major breakthrough in the world of genetics: Researchers have successfully reprogrammed skin cells into stem cells. Using a technique called iPS cell reprogramming (developed in …
Have you heard the buzz on virtual money in online games? Some years ago the first virtual millionaire was announced, yet there have also been reports on people being practically …
The Swedish design group Front brings the principle of the digital computerdesktop trashcan back to the physical world. When your trashcan basket is full it bulges outward. When …
Researchers have designed bacteria that can produce a special glue to knit together cracks in concrete structures. Technews Daily reports the genetically modified microbes have …
Alright the title "Making Perfect Life" ' may sound a bit 20th-century-modernistic-techno-optimistic-naive, but for the rest we are confident this conference is going to be pretty …
Language is communication technology. As Marshall McLuhan said, the spoken word was ‘the first technology by which man was able to let go of his environment in order to grasp it …
We would call this a sustainable technology if only the average pet's carbon footprint wouldn't be comparable to that of an SUV .
In this first review of the works of Manko, we'll discuss the complex sorts of plagiarism in Augmented Reality art that are typical for our contemporary art scene. This introduces …
Last month we discussed how the vacuum played a big role in Manko's life since he lost his right leg. Soon he developed this idea further, beyond the mere notion of extensions …
Mud tub is an experimental tangible interface that allows people to control a computer while playing in the mud. By sloshing, squishing, pulling, punching, etc, in a tub of mud …
Are we creating the penicillin or the asbestos of the 21st century? In the months preceding our Nano Supermarket Project , we share some speculative nanotech products with you. …
Do you also have that feeling sometimes that your dentist is undertaking all kinds of activities in your mouth that aren't really necessary? Yet, you usually just trust the …
In our ‘ under the beach lies the pavement ’ series. Already in 1973, Steven M. Johnson drew cartoons of oil drilling platforms disguised to look like palm trees, in an attempt by …
Waiter, there's a robot in my soup! Weighing only 60 milligrams, with a wingspan of three centimeters, robo-fly's tiny movements are modeled on those of a real fly. While much …
During the 1960s, monkeys were sent into outer space as part of the US space exploration program. But they didn’t all return, until now. Via scaryideas.com | Related: WWF
Inspired by body language of animals (in particular squamates and porcupines), designer Jop Japenga created a headphone with an adaptive skin that responds to the music played on …
The ‘Decay’ project explores how traces of time and use can be embedded in textile. By wearing a carbon fibre suit over a white blouse, textile designer Marie Ilse Bourlanges …
As neuroscience progresses, we gain access to previously inaccessible and unexplored areas of the human mind. Consequentially the intricate processes in our brain are cultivated …
By hooking up a commercially available EEG headset to a Nokia N900 smartphone, Jakob Eg Larsen and colleagues at the Technical University of Denmark in Kongens Lyngby have created …
In March, Mazda recalled 65,000 cars, not because of any structural faults in the vehicle, but because the engineers had inadvertently created the perfect habitat for a tiny …
Another step in the fusion of the made & the born: Surgeons in Sweden have successfully transplanted a fully synthetic, tissue-engineered organ – a trachea– into a man with …
Always wanted a pair of kitten ears to express your feelings to the world? Well, you probably never thought of that – as you have to be a Japanese genius to come up with such an …
Designer Revital Cohen imagines a future where life-support machines are replaced with life-support animals. In this scenario, a transgenic lamb is allowed to frolic in the fields …
Zero: 'Where to begin? We've had many discussions in our Lab about the future of the children. The plan was simple: to raise the kids to the physical age to be 'frozen' in. Then, …
From 9 - 14 March 2011 the Nano Supermarket opens its doors in Pampona, Spain. The NANO Supermarket presents speculative nanotech products that may hit the shelves within the next …
Sexuality and sensuality are phenomena which have been a nature for us as long as we humans exist. Not only humans experience these phenomena; also animals experience sexuality …
Nobuhiru Takahashi, student at the Kajimoto Laboratory of the University of Electro-Communications in Chofu City, Tokyo, invented this Internet French kissing device. When a …
For past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. Making good use of anthropomorphism isn’t easy. As you’ve probably …
Recently, a video clip has been circulating the web that purportedly shows a rabbit born earless due to the radiation at Fukushima. BoingBoing has a convincing take-down of the …
Like with pets and babies, we seem to like it when devices mimic our behaviour and social patterns. In the process of domesticating technology, we teach products to behave like …
Transporting and displaying cold food is an incredibly wasteful and inefficient process. Current display refrigerators, like those that display meats or cheeses in supermarkets, …
A study, in Language and Cognition has shown that time does not exist as a separate concept for the Brazilian Amondawa – an Amazon tribe first contacted by the outside world in …
Text for blind people using the Braille alphabet has been around for some time. But instead of making separate books for the visually impaired, why not change the way we all read? …
The United States Food and Drug Administration recently approved Elelyso, the first drug to be grown in genetically modified plant cells. Produced in carrot cells, this drug helps …
Finally a vending machine that doesn't want you money, it wants hugs. Embrace it to get a free can of coke. Might give you rushes of anthropomorphobia too though. Via The Pop-Up …
Plastic is a part of the earth's ecosystem , but it's a part that no one wants. At Harvard, scientists are looking to replace single-use plastic bottles, plates, and cups with …
Know garlic? Now imagine we could make something that functions alike, but smells a lot better. That's what Swallowable parfum is about.
In dry areas like the desert, on mountain tops or on the moon it’s impossible to grow anything. Or is it? A rain in the desert sparks extreme plant growth from the moment the …
Neural synapses in the human brain are extraordinarily complex structures. Responsible for relaying information between neurons, chemical synapses govern the release of over 100 …
Some desert animals, like the kangaroo rat, get through their lives without needing to drink even a drop of water. Now, a Japanese design company aims to make humans just as …
Imagine you buy a special kind of window which you can place on your wall wherever you want, enabling you to get different views, not always looking at the same tree or house of your neighbors.
Closed to commercial shipping and fishing, offshore wind farms aren't put to much use besides generating clean energy. Ecofys , a Dutch sustainable consulting company, hopes to …
Is the neon green tetra GloFish soon to be the florescent, transgenic terror of America's waterways? The internet hype machine has repeated ad infinitum the Washington Post's …
It looks like a normal soccer ball, but Soccket has a secret: a hole for a charging cable. Designed by two Harvard students, the ball has a pendulum-like mechanism inside that …
In a time of all-horse hamburgers and E. coli outbreaks, food provenance has become a huge issue. Consumers are becoming increasingly aware of the lack of traceability within the …
Peoples attitudes online are wholly different from their behaviours in real life
A psychiatrist argues that beer gave us civilization - but do intoxicants play a deeper evolutionary role than that?
Do humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.
Baudrillard intersects with social media in the world of fake online girlfriends.
A global wine shortage is looming. Never fear: Next Nature has a solution.
By attaching to the vagus nerve, a chip can contribute to "natural" weight-loss.
In the movie Fantastic Voyage, a submarine and its crew were shrunk and injected into the body of a sick man in an attempt to save his life. Despite the fictional nature of this …
Data doesn't live forever – and a new breed of archeologists are trying to recover it.
Excerpts from the Rebbit AMA with Andras Forgacs, founder of a company that manufactures in vitro meat.
A new website changes the text's font size depending on your distance from the computer.
Can a meal replacer save us money, time, and maybe even save the world?
Need a password that you'll never forget and can never be stolen? Try storing it in a pill in your gut.
The first – and only – mechanical gears found in nature.
Having 50% more “conscious lifetime” might sound like an appealing proposition to anyone with a hectic schedule. This could be achieved not necessarily by living longer, but by …
Buckle up for another cinematic espresso shot from our favorite performance philosopher Jason Silva.
An implant equipped with an accelerometer can tell when you're chewing, chatting, smoking or sipping.
Neurofeedback shows promises in treating a range of mental ailments.
An artist visualizes WiFi waves across landmarks in Washington, DC.
Break out the ketchup: Mark Post has grown the world's first entirely artificial burger from cultured beef cells.
For every smartphone user to recognize, is that merely the lighting of your screen, a vibration or ring distracts you from almost every activity. Even when you are spending time …
Anti Drone Tent is a small construction of emergency blankets that blocks infrared sensing, making it invisible to drones.
Scientists designed artificial cells built from silicon, able to copy basic functions of life.
Smart contact lens project to monitor glucose.
Smart Tags stick to containers of food and change color when something has expired.
A selection of nine enthralling and striking concepts of future way of transportation.
Wearable multifunctional antenna made of silver nano wires to monitor recovering people.
Italian research studio is working on EYE: a 3D bioprinted sight augmentation.
Researchers from UC San Diego announced that they have developed 3D print tiny microrobots in the shape of fish able to detect and remove toxin from liquid.
Soon, we might be getting a taste of the first lab-grown chicken meat.
Browsing through your virtual bookshelf gives you the feeling of having an easily accessible collection of books, just like your good old analog one.
iSkin is a flexible, stretchable and visually customizable on-body touch sensor for mobile computing.
Researchers discovered a protein that can be used to produce the first ice cream that melts more slowly that the normal products on the market today.
The Campaign Against Sex Robots, recently launched, is pushing towards banning the continuation of sex robots development.
With recent successful experiments, we may see doctors switching from the single forceps to hordes of so-called microgrippers.
A pill that makes you smarter without causing harmful side-effects? Modafinil might be this “smart-drug”.
What should I wear today? The answer to one of life’s big questions could came from an algorithm created to solve all your fashion problems.
We officially launched the Next Nature Movement in The Netherlands. To seal the beginning of the Next Nature Movement, director Koert van Mensvoort donated the first symbolic ECO coin.
A new laser surgery can permanently turn eyes from brown to blue.
English artist Imogen Heap, with an army of artists, musicians, scientists and technologists, developed the Mi.Mu gloves.
While a hipster-drink bacteria are hunting space organisms, robots are catching whale snot in the open ocean.
An inspiring TED talk by computational architect Skylar Tibbits about 4D printing, where the fourth dimension is time.
Plastic artist Agi Haines explores hypothetical scenarios for surgically implanted body enhancements in babies.
Nasa funded a program to turn astronauts’ poop into food.
A remote-controlled LED chip can make a mouse walk in circles.
Around 100 Polish teenagers aged between 12 and 18 agreed to withstand 72 hours totally offline: no phone, no computer, no TV. What were the results?
The Microsoft HoloLens is a holographic computer that enables you to interact with high-definition holograms through augmented reality.
It is the era of smart toys, but they certainly raise difficult questions for parents.
Swiss artist Dan Acher created a replica of the Northern Lights by way of high-powered lasers.
We have witnessed significant progresses in the field of real-time translation, and this new wearable translator, called ili, sums up perfectly this essence.
On the aftermath of such a historic day for Britain and the EU, it's easy to get swayed into the polarities of political discourse, particularly on social media and the Internet, where things heat up and move fast. The results of the referendum have just come out, and the Internet is already burning with tension. This is called "climate change" - just not the one you are used to hear about.
Google's PlaNet will be soon able to tell you where a photograph was taken by simply looking at its contents.
team of computer scientists at the universities of Germany and California has created what they call photoshoping videos in real time.
The coywolf: an animal that has the DNA of the wolves, coyotes and dogs.
Would you vote for an artificial intelligence to govern our society?
Researchers are creating accurate 3D models of living organisms to preserve the heritage of life on Earth.
Google Cardboard was used by a cardiologist to train for a very risky heart surgery on a four months baby.
How to monitor the effects of El Niño ? The Nature Conservancy wants to take advantage of the massive image production that can be collected using smartphones and drones. From …
This village is powered by building-integrated solar panels and provides shelter for 350 people, putting sunlight to better use.
Facebook had just fired their curatorial team for the ‘Trending’ news section over an algorithm, resulting in false stories attacking a news anchor, a writer, and Mac Donald’s.
This year, on April 6th, a baby was born with three genetic parents: two mothers and one father.
Scientists say they can reverse aging by reprogramming the genome.
We tend to believe that the fruit and the vegetables we eat today are "natural" and the same as they always were. It turns out that in the past this familiar food didn't look like this at all.
The Vaccinator Drone will provide you with the medicine you need.
Nigel Gifford is developing a drone that will be relatively inexpensive, disposable and edible.
It took less than 24 hours for Twitter to corrupt an innocent AI bot and teach it morally repugnant things.
Our online reputation is becoming a valuable currency that is hard to earn and easy to lose.
Utopian off-grid ReGen Village produces all of its own food and energy is being implemented in Almere.
Energy-backed money could help transition humanity to a more sustainable world, both environmentally and economically.
Today, we all have superpowers. It may not seem like it because we are attached to our physical devices to use our powers, but with a Neural Lace that may soon change.
This automated store in Sweden doesn’t have any human employees, only a smartphone app.
There is a new breakthrough coming from the operating room: an app, called MDLinking, that connects 8.5 million doctors world wide.
Meet the witch who casts viruses out of computers with magic.
Japanese architect Kazuyo Sejima is designing the world's first invisible train.
In 1896 Dr Couney incubated premature babies. He saved at least 6.500 premature infants from death by putting them on display in Coney Island.
In 1996, Yoshinori Kuwabara at Juntendo University in Tokyo incubated a premature goat fetus by using extrauterine fetal incubation.
In 2016 a team of biologists has successfully kept a human embryo alive in the lab for 13 days, breaking the previous record of nine days.
A lamb born at the equivalent of 23 weeks in a human gestational period was kept alive in an artificial womb and developed just as if it was in a normal womb.
Go world champion Ke Jie has lost two games of 'Go' against Google's DeepMind AI system AlphaGo.
Royal College of Art graduate Dani Clode reframed prosthetics as extensions of the body, rather than replacements for missing parts.
Sanctifying servers with knowledge and power from digital demons.
Danish company develops device to stimulate creativity.
Researchers have found a way to use our brainwave as a verification of our identity.
A Biomedical solutions company is developing a system for insects to wear, allowing engineers to steer it remotely.
Scientists develop engineered cells to be implanted in patients with diabetes to regulate blood sugar levels, controlled with a smartphone app.
We asked Sandra Rey, our third ECO Coin Award nominee, about her company Glowee and her hopes for illuminating the future in a more sustainable way.
Due to its digital citizenship program, something interesting is happening in Estonia. In July there were more new applications for e-citizenship than newborn babies. Are we …
The complicated system of a female menstruation cycle was reproduced on a computer chip for the first time.
Air New Zealand is equipping its flight attendants with AR headsets to explore in-flight optimization, giving its passengers a glimpse of what the future air travel service might look like.
When giving first aid, all kinds of emotions are in play. Thus it is important for the victim of an accident to receive emotional assistance and to be mentally supported during an …
Artist Lauren McCarthy launched a project called LAUREN in which she embodies a eponymous human smart home assistant.
A start-up company build a wind turbine inspired by the hummingbird.
Lyrebird is an AI model capable of synthesizing anyone’s voice from just a one-minute audio sample.
A new contraceptive has appeared on the horizon, bringing the prospect of an alternative form of male birth control one step closer.
In the next nature, many people spend as much time in the digital world of gaming as they do in the real world. We have covered video games before, but this year we thought it …
NNN is looking for a Managing Director to join our office in Amsterdam.
This group of 14 designers, engineers, builders and architects make a proposal of a wall for Trump's ambitious project.
A Japanese Start up brings Farmville back into real life by letting players grow physical food.
A video of a robotic bee pollinating a flower (looking more like Loopin' Louie spinning off the board game and hitting a flower) recently caught our attention. What at first sight …
Open-air tests of self-destructing moths mark a new frontier for GMOs.
Developers at Dutch-based company Arenar have designed a device that not only claims to improve the quality of sleep, but also induces lucid dreams.
The Smell of Data documentary will make its online debut on nextnature.net.
Exploring methods to better connect people to the natural world, Waag Society, in collaboration with the Dutch Botanical Gardens Association, have developed an app that allows visitors to talk with plants.
Wu Tzu-ning presents a posthuman reality from genetic engineering to digital afterlife.
Introducing world's first voice mask designed to protect your privacy.
The way we interact with the technology in our lives is getting progressively more seamless. If typing terms or addresses into your phone wasn’t easy enough, now you can just tell …
Augmented reality applications are a promising alternative to GPS. At least that is what Blippar’s AR City app claims to be.
In our ongoing battle against climate change, it's hard to transcend from our human position and ‘think’ like nature. Given, nature doesn't think the way humans do, but it does …
In Bali, volcanic danger looms large. Scientists are trying to use drones to forestall the danger and make the invisible workings of the volcano visible.
Scientists developed an e-skin that lets the wearer manipulate virtual objects without touching them, by using magnetic fields.
What to do about the plastic planet ? The seas are steadily filling up with plastic , and it's vital to find ways to address the problem . One way to do this is to move away from …
Tonight a flock of drones can be seen in the skies of Amsterdam.
Meet the Shiva Therapist fro HUBOT. She massages with her own hands, but for the heavy work, she has four additional robotic arms at her disposal.
Virtual reality has come a long way. Like most technological leaps, it’s had a huge push from the entertainment industry, but current applications span a wide range of social and …
Babies' needs aren't complex. And yet, they are. Over the years, parents have found some tricks to ease their babies as well as themselves. Taking a baby for a drive to make them …
Neuroscientists at the University of California Berkely are building a device that’ll hack our brains so we can ‘edit’ what we feel and remember. It looks like we’ve drawn “ Total …
Scientists have been hard at work searching for renewable energy sources. Now, a new breakthrough: the ability to produce hydrogen fuel from seawater.
As we showed with HUBOT , we can use new technologies and robotics to make our work more enjoyable, interesting and humane. Aside from our speculative jobs, a lot of robotic …
A large-scale asian food market serving in vitro meat, a transatlantic expo on the future of nature and a travelling exhibition that explores our relationship with AI. These five …
Leather is one of the oldest and most versatile materials in the world. It’s a supple, tough, relatively strong and durable material and it’s relatively impermeable, yet …
The world of design is in need of new materials that align with the urgency for sustainability. Issues such as climate change, plastic waste and harmful materials require us to …
Cube Design Museum in Kerkrade and Cooper Hewitt in New York present the comprehensive exhibition NATURE - in which internationally renowned designers, artists and inventors …
The new Next Nature book is here ! Next Nature fellows, ambassadors, members and newly interested people came together on the 4th of June to celebrate the book launch with a …
You’ve probably heard how Virtual Reality (VR) is going to change everything: the way we work, the way we live, the way we play. Still, for every truly transformative technology, …
We are a network of makers, thinkers, educators and supporters. With members in 44 countries, we are the international network for anyone interested in the debate on our future – …
Each year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honor them with our ECO Coin Award . We …
Are you a recent graduate or young maker who feels your work deserves a spotlight? Does your project seek to understand how technology becomes so omnipresent, complex, intimate …
Recently, Twitter announced it would be clearing all inactive accounts in an effort to free up dormant usernames and prevent the risk of old accounts being hacked. The new policy …
Loneliness is one of the silent serial killers during the pandemic. Therefore Next Nature provides you the tip to pick up your phone. Artists Danielle Baskin and Max Hawkin …
As the viral pandemic continues to spread, so too does the world’s collective uncertainty. As a result, people are turning to media for some levity. And can you blame them. …
Why memes might be the next tool to make sense of on our increasingly hybrid virtual and physical environment.
When Earth goes south, cowboys go all the way up. The Space Rush of 2020s has something to do with settler colonialism.
Uli Westphal's Seed Series is an ongoing attempt to document the seeds of all edible plants, one seed at a time.
What if an ancient mammoth found herself resurrected by humans into our modern age?
Every ecology needs balance. So that's also true for the ecology of the office. The office is a ecology that is highly regulated: temperature, light, humidity, distance to other …
AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …
I am sorry I couldn't be there— I had an important meeting with my bathtub that could not be rescheduled. This bathtub with an internal multicolour LED light fitting, creating a …
In the early days of digitalization many metaphors from the physical world were translated to the digital world; think desktop folders, trashcan and shopping cart. Now we have …
Written by Debbie Mollenhagen PART 1: FROM LINEAR TO CIRCULAR Designer living has become designing life. I often ask myself: did it taste like the real thing? But when I open my …
Instruction for the Birds: Land on perch->trigger sound file->observe human response-->behave accordingly. Instructions for People: Listen, you'll be able to understand. The sound …
A screen of water displays images by controlling drops of water falling down. Density creates light/dark shades that create the image— Project site
The pavilion is made of filtered lake water shot as a fine mist through 13,000 fog nozzles creating an artificial cloud that measures 300 feet wide by 200 feet deep by 65 feet …
NEC corporation is developping a "Childcare Robot PaPeRo" capable to play with and watch over children. The Childcare Robot is capable of recognizing and verbally communicating …
Crowd counter is a piece of software able to track moving features within a video clip. It works on the assumption that points that move together are most likely part of the same …
"In the morning paper, I can read the weather report as well as the stock quotes. But when I look out of my window I only get a weather update and no stock exchange info. Could …
Remember the datafountain ? Of course there are many other applications of information decoration: datawallpaper, datasounds, datafurniture and dataclimate. The picture above …
Skin conductivity sensors are used to deduce the emotional state of the sleeper. This information is brought to 3-D studio where a script is used to transform this into physical …
Will our mobile devices look like this in two years time? This is an example-application of the featherweight QVGA (320x240 pixels) active-matrix display: Phillips e-paper . (It …
Sushi made up of flavoured sheets printed out on an inkjet printer. Using ink-jet printers and lasers in the kitchen may seem like a futuristic vision but at Moto restaurant in …
This weekend is the last change to visit the Entry 2006 exhibition in the coalwashe building, Zollverein. Over 300 exhibits from more than 20 countries are on display. Next nature …
Die Natur verändert sich mit uns (English version: Exploring Next Nature ) by Koert van Mensvoort , published in Entry Paradise, Neue Welten des Designs, Gerhard Seltman, Werner …
Eternal Sunset endeavours to ensure you can enjoy the sunset live from any location, at any time. As the sunset moves westward, Eternal Sunset continuously tunes into different …
The 'tooth phone' consists of a tiny vibrator and a radio wave receiver implanted into a tooth during routine dental surgery. Sound, which comes into the tooth as a digital radio …
Now with Google smart look. Don't worry, it is science fiction (still). Created by Sean Hamilton Alexander.
Behold the featherless chicken, created by Scientists at the genetics faculty at the Rehovot Agronomy Institute near Tel Aviv, Israel. The idea behind the development of this …
A tropical fish that fluoresces bright red is set to become the first genetically modified pet to go on sale in the US. Alan Blake and colleagues at Yorktown Technologies …
More people than ever are asking to be buried or cremated with their mobile phones when they die. The trend, which began in South Africa, has now spread to a number of countries, …
Kenichi Nagahiro, Honda's chief engine designer, hated diesel engines. When asked to design Honda's first diesel he flatly refused - unless he was allowed to start completely from …
Hotspot Bloom is a wearable flower that glows and changes color to indicate the signal strength of a nearby wireless network (802.11b/g). With its mobile interface, Hotspot Bloom …
If you've ever wished for a "hand" to leave behind so that your baby would feel as if you've never left the room, your prayers have been answered with the Zaky Infant …
Toasted bread as an information display device (originally developed in 2001 but somehow still intruiging): a toaster that parses meteorological information from the web and then …
You know.. cells have feelings too... and friends.. Check the video here
ALLERCA has produced the world's first scientifically-proven hypoallergenic cats. These cats allow some of the millions of people with feline allergies to finally enjoy the love …
Metalosis Maligna is a documentary by Floris Kaayk about a disease which affects patients with medical implants. Sourcing from such implants a wild metal growth ultimately …
Think of this sonic vibe-technology inside any MP3 player ;)
The Stock market skirt Nancy Paterson made a blue taffeta & black velvet party dress that represents the real-time stock market situation by lowering or raising its hemline. …
There are people who think what makes a good wine comes from nature - factors like rain and soil and temperature. Then there are those who think it's a matter of second nature - …
There may even come a moment that our connection with an industrially manufactured coke bottle may be richer and more mythical that our relation with a genetically analysed and …
Amsterdam Weekly featured an article about the Natural Habitat exhibition (pdf) , currently on display at Montevideo/Timebased Arts. In the exhibition artists play with the …
Nature is not what it used to be. Or at least that is what we may think, when we look at the way humans and their technologies have treated nature. When we speak of "nature", …
A transformation of the big flashing arrows from the computer game Need for Speed Underground 2, NFSU 2 to physical space. Although computer games generally try to imitate the …
During the upcoming Amsterdam Museumnight, the Institute for Timebased Arts (Montevideo) will be hosting a show called Natural Habitat, in which artists play with the borders …
Finally! Some creative uses of cloning discovered. Photoshop technology makes flora and fauna join hands. www.worth1000.com
Jos de Mul (Erasmus University Rotterdam), published in Next Nature Paperback, 2005 For someone whose main instrument is a computer, the world becomes a gigantic database. We see …
The Power Aware Cord transports electrical power while simultaneously visualizing energy usage. Electrical transfer is represented through glowing pulses, flow, and intensity of …
At the edge of the woods along the motorway near the Dutch town of Bloemendaal, there stands a mobile telephone mast disguised as a pine tree. This mast is not nature: at best, it …
A group of computer researchers from Amsterdam have demonstrated that it is possible to insert a software virus into radio frequency identification tags, part of a microchip-based …
a purse that visually keeps track of valuable items such as keys, wallets, personal identification cards, & cellular phones through various sensors embedded in the bag. if …
The Sababa is the first real time lava visualiser kit of global city flows. It takes the lava lamp one step further by reconstructing it according to the language of the current …
Did you ever wonder where all that hard drive space went too? Sequoiaview generates organic-like views of the files and folders on your hard drives using cushion treemaps. …
Scientists have invented a plastic memory material that can change into three different shapes based on heat. Researchers demonstrated a plastic tube with three "programmed" …
The flower depicted in the image is a good example of Hypernature. While fake nature is always a flatter surrogate of old nature, hypernature is a simulation of an old nature that …
Luna Maurer has launched her long-expected website on december 18th 2006: From July 2005 a camera on the roof of De Balie (famous building in Amsterdam) is 'catching the sky' in a …
The pattern on the Animal Sweater suggests a new way to experience commercial imagery. The Animal sweater, designed by Karl Grandin, was first shown at The Biggest Visual Power …
A flower arcing from a frosted pane of glass. Rigged with a breath sensor and connected to an internet packet sniffer, the flower is cued in to the wireless network flowing in the …
I wonder what task this little fellow 's creators had in mind for him. Rescuing cats? Pruning branches? Picking coconuts? Found here. I'm glad there's a robot for every surface …
Funded and produced by the Public Art Commissions Agency. On roundabout just beyond the Canary Wharf estate there are three trees, two are London planes; the third is a traffic …
Mobile phone operators go to extraordinary lengths to conceal the masts that form their networks. They are being disguised as chimneys, clocks, drainpipes, telegraph poles, and …
A traditional textile heritage is celebrated with flocked wallpaper that comes to life as it reacts to ambient noise levels. The louder the space the brighter the wallpaper glows. …
A technique developed by the German Claus Winterfor an installation artist makes whatever word you type into a computer visible by a "water-curtain". The video shows the World …
An umbrella that provides information about the likelihood of rain so that users can make a simple, informed decision about whether to take the umbrella with them as they leave …
When I was a kid, I thought that people that could make smoke circles were really cool. Now I think machines that can do that are even cooler!Â? Made by Takeshi Ishiguro
You have the impression that the disasters of the world do not touch you anymore? You feel vaguely sorry for other people's misfortunes but you don't feel the inner urge which …
Mandy Meißner's "Wildgruen", a plant that can move and communicate. In her view, plants need to be freed from their isolation, both in the way that they can only lean towards the …
The Wind Shaped Pavilion is a design proposal for a large fabric structure that can be used as a public or private pavilion. As a lightweight fabric structure, the wind slowly and …
These crystalline 'nanoflowers' were developed by Cambridge University PhD student Ghim Wei Ho. The nanostructures of silicon carbide are grown from droplets of gallium on a …
In "A Hunt for High Tech", Bart Hess seeks to harness both nature and technology and create armoured skin and fur for a new human archetype incorporating animalistic and …
Silly inventions like these make me wonder why man continuously seeks interaction with the things surrounding him. Should buildings or offices be allowed to talk? "This door was …
Animals do not shape their living environment as radically as humans, but why don't we give them some help. James Auger envisions animals, birds, reptiles and even fish becoming …
Augmented Fish Reality is an interactive installation of five rolling robotic fish-bowl sculptures. These sculptures allow Siamese Fighting fish (Betta Splendons) to use …
Ball of Being is an online dance film featuring atoms, planets, footballs, globes, foam and molecules. It is uncertain whether we are entering a microscopic nanoworld, virtual …
First we had the internet. We stored all our texts and images in databases. Then came search engines to locate the data. Now is the time to interconnect it all; to share knowledge …
Where other trees grow their branches towards the light, willows seem to want to touch the surface. Tim Knowles creates drawings independent of his own hand and when he attaches …
Using electrodes positioned around a person's scalp, scientists from the Centre for Research and Technology Hellas in Greece are developping a method for electronic identification …
Made of electroluminescent (EL) sheets, Makoto Hirahara's Bright Blind simulates a window where none exists. In all other respects, the artificial blind functions in exactly the …
Just follow the yellow brick road ... thin red cable and you know where to go! Instead of looking at a small 6 inch screen, or listening to less than exact turn by turn …
Japanese researchers have developed head gear that lets people control devices such as an iPod using their teeth. Now that is not really new, except when you take in mind that …
Compubeaver by Kasey McMahon "I am interested in the way we interact with nature. As we become increasingly reliant on technology, we become disconnected from our natural …
Cory Arcangel hacked and modified a piece of hardware'the cartridge on which the game "Super Mario" is stored, or rather, was stored to produce "Super Mario Cloud" This is …
Many people get a kick out of a direct contact with AC power supply. To that end, people normally use U-shaped fragments of bare wire, paper clips or even usual metal forks. All …
This "printer" is all about creating, storing and recycling householdproducts on demand. link | video
Do you happen to know the Dutch Tomatoes? They look like Ferrari's and taste like shit. They are redder, rounder, larger, and maybe even healthier than the ones from our gardens. …
Inventors keep coming up with new ways to exploit RFID (Radio Frequency Identification) tags. Now Kodak wants to use them to probe a person's digestive system. RFID tags are tiny …
This must be the best worst software concept I've seen this year.. An email mailbox represented as a 3D, virtual LAX airport. in this world's coolest email program, based on the …
I have been conducting some attempts to backtrack the evolution of Gillette shaving razors appearing in my bathroom. Whereas older shavers were simple sticks with a blade on top, …
At the beginning of the digital era, several metaphors from the physical world were transferred to the digital environment in order to make, otherwise incomprehensible, technology …
For a long time in the history of painting, the landscape functioned merely as a backdrop for people, buildings or symbols. But in the 17th century, artists started making …
Did you ever wonder why the letters on the keyboard are in the order they are? The reason for QWERTY goes way back. This order was chosen to reduce the probability that mechanical …
Sunsets are loved by people all around the globe. Could this universal aesthetic preference be linked to a deeply rooted understanding of the sunset's importance? Life on earth …
Just like centipedes OLE can roll up into a ball when danger threatens and retract its six legs. Its heat-resistant shell is made of a ceramic-fibre compound which can withstand …
A Nike shoe stapled together with human flesh, created by Adam Brandejs .
Food is no food. Food is scent. Food is temporary experience. Food is message. Welcome to this magical gastronomy tour. You will enjoy the tasty (video)links below: Works by Chef …
TiWalkMe is a clock (still in conceptual stage) designed to track 1,000 years using a forest seeded along a ribbon of land to tell time. Annual tree plantings set the pace, …
By ALEX WRIGHT, Published in NY Times December 2, 2007 The growing popularity of social networking sites like Facebook , MySpace and Second Life has thrust many of us into a new …
I applaud any new display technique that isn't emitting light. A recent patent application by Philips for a new type of screen based on "furry" pixels , or physical pixels made …
If you've gotta run the wheel, you might as well do it in bare feet. Many of us are so busy being good little hamsters that we never have face time with green space. A group of …
Tom Ballhatchet introduces mice and hamsters into the officegarden. tomballhatchet.com
New media technology from South Korea: a gigantic human display compiled from supporters cheering their soccer teams . One pixel per supporter. See also: Skyscreen , A4 e-paper .
Global warming is "very likely" a human-caused problem that will last for centuries and require concerted international action to reduce its potentially devastating impacts, a …
In 1998 at the introduction of the iMac , Apple declared that the "i" stood for "internet". Apple later adopted the "i" prefix across its consumer hardware and software lines. …
Picture this: it's 40,000 years ago, and you are an early Homo sapiens. You are standing on the savanna. Look around you. What do you see? No billboards, no traffic signs, no …
IVY is an external hard disk which shows the content of the hard disk on its skin. When no data is stored on IVY, its skin will remain blank. When you purchase IVY, it appears to …
The world's first commercial merchant ship using a high-tech kite system will sail across oceans - and help fight climate change. "MV Beluga Skysails" cargo ship has been fitted …
Now here's a nice piece of dead old nature I would like to stick in my computer! Notice the beautiful micro-organism-patterns. Designed by Oooms.nl Related posts: Sunflower …
It looks like spiders are learning from the web and use peer-to-peer technology to build their web: "Entomologists are debating the origin and rarity of a sprawling spider web …
Eat the fruit. Kiss the Snake. Today 16:30-18:00: Paradise by the Laptop Light at STRP Festival .
Philips hits the shops with a product that aims to naturalize alarm clocks. The annoying buzzing machines were once invented to cultivate our day/night rhythms, formerly connected …
Phone, internet, television, photography, even books or music: today it is hard for the mind to escape from virtual worlds. A day without communication or interaction could make …
We are all born in a world that has been designed already. Cars, dishwashers, dildo's, remote controls, ATM machines. Although these products are supposed to make life better, …
Comedian Paul Merton went to China for Five.tv (early 2007) and near Beijing he reads the following headline: This farmer grows robots...
The mayor of Sao Paulo decided that he was tired of the wildgrowth of billboards in the city. So he decided to take them all down (not personally). This creates a very pre (or …
Alright, we can agree most of old nature has been altered by human activity. We're not just talking rain forest, icecaps and genetically modified fruit and kittens . Now you might …
The media are disappearing, Nature takes over. Our slogan of the week.
I first saw this statement on the Artvertising building . Let this be our slogan of the week.
15.000 Years ago we lived in caves, wore animal-fur and ate mammut- noodles !? Oh well, though our knowledge has grown a bit, the human nature hasn't changed that much: every …
By Karen Kaplan, Los Angeles Times , December 11, 2007 The pace of human evolution has been increasing at a stunning rate since our ancestors began spreading through Europe, Asia …
I couldn't believe the news? Scientist are working on a system that allows you to surf the web with nothing but brainwaves . I thought surfing was a rich physical experience of …
The MQ-9 Reaper is loaded, but there's no one on board. Its pilot, as it bombs targets in Iraq and Afghanistan, will sit at a video console 7,000 miles away in Nevada. Although …
The history of art through the ages reveals a constancy that, by conscious or unconscious applications, provides us with an omnipresent correlation dealing with the …
The Objectuals is a series of work by artist Hyung Koo Lee , it features an interesting mix of visual distortion apparatus for the human body. Lee says that he experienced …
The meat in the supermarket is abstract, square and habitually made from wickedly manufactured animals. A friend once told me he only eats meat if he "can not recognize the animal …
Genetic engineering isn't just for scientists in ivory towers or corporate R&D labs anymore. Researchers are still creating new mice and crops every week, but the tools and …
Another project by Oded Ezer, Typosperma is the second experimental typo project in his 'Biotypography' series. As a paraphrase on the biotechnology definition, 'Biotypography' is …
Aaron Larney made these urban camouflage printed hoodies, just in case you need to blend into your dorm's notice-board. See also: Urban Camouflage I .
For all you self-Googlers out there. And yes.. that means you too! Back in the old days (pre-next-nature) you used to wear gold rings and lots of bling you show off your wealth …
The Vin Memoriam concept introduces a new ritual in the mourning process after losing a loved one. When a person has passed away, a small amount of blood can be processed into a …
Atkin's Architecture Group recently won the first prize award for an international design competition with this hyperreal entry. Set in a spectacular water filled quarry in …
Everyone knows some foods have more calories than others. For many people eating turned into an information science, having to continuously read the amount of calories of the …
Imagine the impossible… a secret transatlantic tunnel running between New York and London, that has lain undisturbed for a hundred years. And imagine an extraordinary optical …
This summer researchers from technology firm QinetiQ and from Aberystwyth University flew an autonomous unmanned aerial vehicle (UAV) over fields in England and Wales to map the …
While time seems to flow in this one direction, some people just know how to walk straight through that fourth dimension; catch it in a videoclip and throw the message into …
Ambient Biomedia is an investigative project about using living beings, in particular plants, to display human lifestyle problems information. The working principle of our systems …
The Ambient Umbrella shows when rain or snow is in the forecast by illuminating its handle. Light patterns intuitively indicate rain, drizzle, snow, or thunderstorms. Local …
Art Directors Andreas Junus and Irawandhani Kamarga; copywriter Darrick Subrata and photographer Anton Ismael (Indonesia) went through some trouble , visualizing Photoshop's …
Integrating nature in our technology. There are four different laptops: Floral Blossom (pink), which has a tropical, flowery scent; Musky Black (black), which incorporates a waft …
Avatarian Graveyard supplies a service for virtual addicts – people who excessively or compulsively spend time in virtual environments – to help them reintegrate into everyday …
Now this is how you do it. First you take the meat of a hundred animals; chickens (19%), turkeys (17%). Secondly, you blend them in a large tank with water, mais, wheat, oil, fat, …
Famous street artist Banksy left his grafitti spraycans at home and sets to opening a pet store. The difference with this pet store is that instead of looking at pets, you look at …
Murata Boy, is a robot capable of riding bicycles unassisted. Balancing, pedaling and directing the bicyclee, turning the bike to avoid obstacles, etc. And this is his nephew, …
Blendie is an voice controlled blender with a mind of its own. Materials are a 1950’s Osterizer blender altered with custom made hardware and software for sound analysis and motor …
With his Waterboxx , Pieter Hoff (The Netherlands) won the Bèta Dragons Award 2008. It is an instrument that supports plants and trees in order to survive in difficult …
Proctor and Gamble, the maker of Pringles , has successfully argued in a British court that their product is ‘not a potato chip’. Pringles are also officially now, not potato …
Popping corn with your handheld? Pity this recently discovered cellphone feature is a hoax , created by a company to promote bluetooth headsets (thanks Teun ).
Who likes clouds anyway? Especially for the people still living in the suburbs of Venray (small town in the Netherlands), artist Helmut Smits made this billboard depicting a clear …
Always dreamed of creating your own clouds? You can now create them... from text. Wordle is a toy for generating 'word clouds' from any text, url or rss stream you provide. The …
Don't you just love that vanishing bioplastic bottle! It is our peculiar object of the week.
So you thought the 'consumption of illusions' was a typical digital world activity of second life residents and gaming addicts? Never underestimate virtuality in everyday life. …
Schwan Consumer Brands, a leading frozen pizzas brand, has launched a challenging brand: UGLY. The design embraces the rising trend for natural, honest food and the notion that …
What is that growing on my car dashboard? Is that a tree? Indeed, Ford and Honda's next-generation dashboard instrument clusters feature trees (a vine in Ford's case) that grow …
Some months ago we sent out a call for proposals asking for visions, statements & ideas on we how we can design, build and live in next nature. We received an overwhelming …
Green bubbles? Yes, they seem to be everywhere nowadays. But for a change we aren't talking about those greenish marketing bubbles of the flourishing sustainability cult. …
The Waterboard is an interactive installation by Mike Burton giving the user a chance to play with water without getting wet. By drawing lines on the whiteboard, the water will …
Some weeks ago we pondered over the oddity of a space race in cyberspace . Rockets and jet-packs –so cool in the previous century– don't make sense in a virtual environment. The …
So far, over-dependence on GPS devices has resulted in more inconvenience than actual danger, but earlier a U.K. woman sent her £96k Mercedes flying into a river, trusting the …
European biologists have constructed a genetic map of Europe showing the relations between its various populations. The right part of the map shows the location in Europe where …
Last year Google invested four million in 23andme , a commercial research center that maps out your DNA for 1000 bucks. Now Google also invested in Navigenics , a company that …
This weeks peculiar image gives gaming that "natural" touch: the Hemp–Mote by dhrek.com Made from 3 kinds of 100% natural hemp string on the outside, while remaining 100% …
A commercial by an orthopaedic reconstruction company introducing the next generation of joint replacements: " Highly advanced hips and knees. Engineered to meet the needs of your …
A future physical anthropologist who knows nothing about the human race and would dig up a contemporary desktop computer, might conclude homo desktopus must have been the user of …
This Honeycomb vase was made from a vase-shaped hive that 40.000 bees colonized for one week, building a hexagonal comb to encompass the existing form. Created by Studio Libertiny …
Controlling hurricanes could save lots of lives and dollars. According to a study published in by climate physicist Daniel Rosenfeld , adding dust to Hurricane Katrina's base …
Whoever you are, whatever you do, wherever you may be. You can’t beat the real thing. It really refreshes and brings real satisfaction in every glass. It was not until America’s …
"Do you know what it really reminds me of? ... Tasty Wheat . Did you ever eat Tasty Wheat ?" – from The Matrix. This is a project by pundo3000.com , in which 100 products were …
Somehow I feel there is some deeper meaning in this cheesy video. No? See also: Water in my Phone .
This Japanese Juice box is camouflaged from modern box designs and tries to convince consumers with its appealing 'natural' look. A schoolbook example of biomimicmarketing ; …
Rising supermarket prices are persuading hundreds of families to turn their back gardens into mini-ranches stocked with miniature cattle. For between £200 and £2,000, people can …
Mathieu Lehanneur created a plant-powered indoor filtration system, that pulls in filthy air to be processed through a plant's leaves, roots, and humidity, reintroducing purified …
Lightweeds is a project by Simon Heijdens and currently exhibited at the MoMA - part of the Design and the Elastic Mind exhibition . The organisms - plants, weeds, trees - exist …
I got this in my email from my uncle who lives in Australia. "After a short stay in America, David returns to Italy" . You know what's coming before you even open the picture. …
PETA –People for the Ethical Treatment of Animals– has posed a challenge to the world's scientific community: The first person to come up with a method to produce commercially …
A lot of dead books were used to make this piece of tree trunk. By Jacqueline Rush Lee | Related: Modernistic Tree | Modernistic Chair
Multicultural Gourmet Pack is a new meat package that contains a variety of butchered meat products based on different religions and believes. The pack contains a total of 4 …
Paradise by the Laptop Light is a next nature event with short films, speedlectures, special guests and one laptop. It will be held on 12 September 2008 16:30-17:30, as the …
Cochran’s sustainable design group, SMIT (Sustainably Minded Interactive Technology) came up with a project called GROW. It's an Ivy-like covering of a building that generates …
The video below is featuring a computer-generated replica of actress Emily O’Brien’s face at high-definition resolution. The Image Metrics process takes a captured video and …
An industrial robot has been given an unusual production task; writing out the full Martin Luther bible "by hand" in a calligraphic style. The robot arm appears to be a fairly …
With its 50 cm wing span and 80 grams of weight, this high tech bird is ready to infiltrate swift surveillance squads next summer. Aerospace engineering students at TU Delft , …
At a recent Yo-Yo Ma concert at the Detroit Opera House, Honda's ASIMO robot took the stage and conducted. Blame Honda when the robots take over. Thanks Paul .
Just because you're feeling paranoid, doesn't mean the fish aren't actually spying on you. Engineers at the University of Kitakyushu created an underwater survey robot that looks …
The struggle between the born and the made is being fought out in a wardrobe on Saturn. By: 1stavemachine.com | Related: Sixties Last
"Google has stationed approximately a million computers worldwide to be able to process the 40 billion searches per month. One search request uses as much energy as a low-energy …
Second Skin takes an intimate look at computer gamers whose lives have been transformed by the emerging genre of Massively Multiplayer Online games (MMOs). World of Warcraft, …
An installment in the series of: " Things I have learned in my life so far ". sagmeister.com These dividing pages for Austrian magazine .copy spell out:"Starting / a / charity / …
Welsh designer Ross Lovegrove ('Captain Organic') placed several glowing Solar Trees in the streets of Vienna (October 2007). These solar powered streetlights could save cities …
I used to hear voices in my head, but now they seem to be coming from the walls – am I back in to the womb? No wait.. it's a wall that reacts to the spectators voice (quicktime) . …
These two teenagers, Kate Stoeckle and Louisa Strauss, just found out many New York sushi restaurants and seafood markets are playing a game of bait and switch with their sushi. …
Meet midori-san , the first blogging houseplant! Through sensors connected to the leaves of this Sweetheart Hoya reads bioelectric currents through the plant, this gives …
Volkstuintjes (or peoples gardens) might be a typical Dutch / European tradition, offering gardening space in urban environments in which people don't have their own gardens. It's …
" Eat the View " is a campaign to plant healthy, edible landscapes in high-impact, high visibility places, whether it's the "First Lawn" or the lawn in front of your child's …
The Telepresence Frame is a domestic object which utilises the fact that one's bodily functions are digitised in order to create a new form of telepresence. Allowing loved ones to …
Long after Second Life servers have been shutdown, Augmented Reality is a common place . Thanks to our bioengineered eyes, or our electronic contact lenses , and years of data …
Beauty and the Geek jeans by Erik de Nijs. The trousers offer a full Querty keyboard layout as well as a mouse, speakers and a little joystick. As he calls it: "Beauty is skin …
Tru Blood is a synthetic nutrient for vampires that completely eliminates the need to seek sustenance from any living creature. Packaged as a consumer good at your local …
No animals were hurt or injured in the production of these vegetarian Nikes. Created by Paul van Barneveld . Thanks Floris . See also Flesh Nike .
A study by psychologists at Nottingham Trent University has found that 54 percent of all males and 68 percent of all females "gender swap" – or create online personas of their …
Now this is a spot on example of information decoration : a heat–sensitive wallpaper of which the printed flowers will be blooming when the radiator is on. Created by Shiyuan .
Get Wickd (props for the name boys – totally wicked!) is a tech-fashion brand that sells basic clothes with barcodes that can link your mobile phone to any page on the web, from a …
What would it be like if the communication on a social networking site like Facebook was actually played out in everyday life? Hilarious sketch by Idiots of Ants (thanks Martijn ).
"I think we are all "work in progress", this necklace is featuring a cool progress bar to indicate that." Nice work Irina!
19th century people needed some explanation to understand the difference between the regular candlelight and the electrically simulated candlelight. Note the disclaimer at the …
Using thermochromatic ink, which changes color when the temperature exceeds a specific degree, designer Josien Pieters created a prototype of a dynamic wallpaper that …
Tasty realization of the classic Apple rainbow logo, made entirely out of fresh fruit. The clever creation was made by Richard Thomas from sliced kiwis, bananas, oranges, …
This years edition of the Ars Electronica festival , which has been hangout for international experts from the arts and sciences for almost three decades, focuses on the nature …
The fabrication of forests with artificial trees is one of the best strategies to stop climate change, according to scientists of the Institution of Mechanical Engineers . The …
This video shows the first beta version of TwittARound – an augmented reality Twitter viewer on the iPhone 3Gs. It shows live tweets around your location on the horizon. Because …
Autimacy [aw-tih-muh-see] - noun, plural - cies. The term was coined by Simona Kicurovska .
Fish sticks are among the most wondrous modernistic inventions of the previous century. They are easy to eat, efficient in their packaging & transport and the greatest of all: …
Some say global biodiversity is decreasing. I am not entirely sure.
Peculiar object of the week. See also Banana Juice box , Modernistic Watermelon , Cubic Fruit , How to grow an Orangina Bottle .
At the start of the digital era, metaphors from everyday life were used – in what was then the new computer environment – in order to make otherwise incomprehensible technology …
The eye passes on more information to the brain than the brain will process. In that sense, the brain functions as a filter. But on the battlefield the risk of neglecting …
Coca-Cola© succeeds in what most NGO's try to achieve: getting the goods to the poor in the 3rd world Africa. For most people there, a Coke is easier to get and cheaper than a …
The ultimate personal hygiene product, feces odor tablets, is another Japanese innovation sold by the Takano Yori Beauty Clinic . These pills promise to make your excrement …
Engraved Hairy Crab: fake or real? ??? (Dazha crab), or more widely known as Shanghai Hairy Crab, is in season right now. This typical Shanghai delicacy is particularly sought …
Next Monday when your colleagues ask you what you have been doing for the weekend, you might answer you something default like you went out with friends, danced, biked to the …
Remember the days when the flavor of a fruity drink was simply connected to an apple, orange, strawberry, kiwi, or perhaps – if you felt really exotic – an acai berry? Nowadays we …
Scientists at the University of California created a neural implant for a beetle that gives them wireless control over the insect. Electrical signals delivered via the electrodes …
How to navigate the urban jungle? Adopting the metaphorical image of a dandelion in flight, Dandella is a GPS device that shows you the way. Inspired by how young sunflowers …
Apparently, camouflaging oneself with digital patterns rather than nature-imitated patterns functions as a better camouflage within "old-nature" situations. So the digital …
Drinkpeedrinkpeedrinkpee is a project by Britta Riley and Rebecca Bray about the role our bodies play in larger ecosystems. It's an installation about the Urine to Fertilzer DIY …
Since it is Sunday, let's have a genetically photoshopped egg with a handy integrated eggholder. Not sure if these should be mass produced (if possible): Too painful for the …
I deem you have to be over sixty to have an object with so many historical layers of media in your house. Let's analyze. We are looking at a chandelier in which the candle …
The world of tissue engineering is usually associated with medical applications . But how about some tissue engineered toys? The Epidermits toy is the Karten Design firm 's …
Exmovere Holdings , a biomedical engineering company, is focused on government and consumer applications for healthcare, security and mobility. This company developed Exmovere …
Daring talk by agriculture expert Louise Fresco , who has the guts to break the organic trance of the fashionably-natural-farmers-market people at TED . During her talk she is …
Parks are not nature. Parks are culture: man-made simulations of nature, carefully constructed to provide walkers, runners and mountain bikers with a recreational, yet confined – …
TED talk by Steward Brand – the man who helped usher in the environmental movement in the 1960s and '70s – has been rethinking his positions on cities, nuclear power, genetic …
"Paris, printemps 2019: Oh Darling, you look gorgeous." Nowadays we are so used to Hollywood hyperbodies – a simulation of a body that never existed – it is good to see a …
Fruit does wonders for your health. No doubt about it. It is recommended to consume two pieces of fruit each day. One.. Sorry, I've lost count? How convenient to have the two …
Chinese workers slaying monsters to earn gold for western consumers. It sounds surreal, but it is a far from virtual reality for the so-called 'gold farmers', who are working in …
Though the example product seems a little far-fetched; growth assembly could be quite revolutionary. Worldwide shipping of manufactured things is very inefficient. Why not ship …
We are unsure whether it is just an accidental evolutionary recombination, or that the hamburger sneaker was bound to happen – somehow, it feels natural. Our peculiar object of …
Talking about image consumption ... Via scaryideas.com | Related: Some Kids Don't Like Chicken | Banksy Pet Store | Featherless Chicken | Confetti Chicken | FFR Image Consumption
Now here is an experiment any one can do at home: Look around in your house and try to find a consumer product of which you know where it was made and by whom. Got any? Indeed, …
Imaginary advertizement for genetically engineered hybrid hyperfruits featuring an 'limwi', 'kiwange' and a 'strawblackberry'. Imagine a taste of things to come. Makes you want to …
Sometimes you just need to settle with the surrogate. Peculiar image of the week. See also (in the baby series): Infant pillow , We are all born in a world . Thanks Hendrik-Jan .
What you see is what you get – at least that is what you hope – with this biomimicked kiwinut juice packaging designed by Naoto Fukasawa. See also: Image consumption , Image …
With who or what do we have contact the most in our daily life routines? Our family, our bed pillow, doorknobs maybe? The answer is probably: Display. And now there is even a …
A Chinese farmer, Gao Xianzhang, has invented baby-shaped buddha pears and he is planning to export his idea. The produce became a success in his local province since people seem …
Fleshmap touch investigates the collective perception of erogenous zones. Hundreds of people ranked how good it would feel to touch or be touched by a lover in different points of …
What is genomics? How will it affect our lives? Serial entrepreneur Barry Schuler explains the genomics revolution. We are now not just reading genomes, we are writing them. …
This meat pig was reconstructed by Ton Meijdam . See also: Get vegetarian teeth and eat less meat , Million Dollar Burger , Back to where it came from ,
Remember the Gameboy Bricks by Gijs Gieskes? The same vibe must have been picked up by Christopher Locke (Chicago, US) as he opened his Modern Fossils Shop with many more peculiar …
This slightly uncanny piece of modernistic meat is actually not made from meat, but from wax, oil, paint polystyrene, stage blood & latex, by artist John Isaacs , who titled …
This snowman is 10 µm across, 1/5th the width of a human hair. The snowman was made from two tin beads used to calibrate electron microscope astigmatism. The eyes and smile were …
This week a Brazilian prosecutor asked a judge to nationally ban toys sold with meals in fast-food outlets like McDonald's and Burger King, because it can lead children to develop …
Recently were introduced, the OOMouse ... ...and the Magic Mouse . Both tools are developed to browse the ones and zeros more easily. It almost seems unfair to compare them, so I …
Following anorexia nervosa (under eating) and bulimia nervosa (overeating and compensating), orthorexia nervosa (obsessively healthy eating) is the latest eating disorder in the …
It is nature, but not like we know it when chairs biomimic the pelvis. This anatomic Ruby rockingchair was designed by Pouyan Mokhtarani , Tehran (Iran). Via b oingboing.net | …
After the plant that glows when thirsty , the plant that calls when thirsty , the dataplant , plantvertizing , the emphatic plant and the blogging houseplant , there is now a …
Today browsing and gaming is dominated by the shortcomings of machines, for machines simply do not know who is on the other end. Man needs to interact; therefore man needs to …
We are anxiously waiting for the robot that makes the sushi, but at Squse , they have created the hand that can carefully place the delicacies in a box without crushing them. …
Austrian designers Katharina Mischer and Thomas Traxler have created a solar powered machine that makes arrays of furnishings that vary based on how much sunlight it receives over …
Using ultrasound technology, researchers at the University of Tokyo have developed a holographic projector that displays three-dimensional virtual objects you can feel with your …
An earlier post on this blog already displayed the possible future of sight using augmented contact lenses. Researchers at MIT take this second sight to a next level by …
The American Chemical Society is holding a contest seeking short videos that answer the question: "What is nano ?" UC Berkeley graduate student Patrick Bennett and his colleagues …
Quote Eric Horvitz : "After finishing my doctoral work, I returned to Stanford Medical School to finish up the MD part of my MD/PhD. During one of my last clinical rotations, I …
"I think there is a world market for maybe five computers" , a remark made by Thomas J. Watson of IBM in 1943. But what if the number of computing devices connected to each other …
... a new McDonalds opens somewhere in the world. Via RebelArt , via Ekosystem . Related: post-apocalyptic religious artefact , hamburger sneaker , Image consumption .
The Triceracopter is half Triceratops, half helicopter. If dinosaurs and technology evolved at the same time, this is what the helicopter might have look like? Built as a …
Laurent La Gamba makes photographic installations dealing with camouflage. His work juggles with the idea of natural procrypsis in the urban space and deals with the relations …
No this isn't photoshopped. After a motor accident Finish hacker Jerry Jalava decided not to use a normal prosthesis and felt that a prosthesis usb memory stick would enhance his …
://nextnature.net I tend to think of the Philips Wake Up Light as a product of missed opportunity: Good concept, implementation too cheap and illustrative. Especially the crappy …
Designer Carlijn Compen upgraded her watertap with some LED's that shift color along with the heat of the water. A simple yet effective example of information decoration that will …
Though its exact definition has shifted over time, the term "wetware" and its fundamental reference to "the physical mind" has been around from the mid-1950s. In its original, …
These photos of disused newspaper racks in a San Francisco storage yard – taken March 13, 2009 by AP/Noah Berger – are pretty much all you need to know about the state of the …
It grows freshly in your windowsill; a lawn to linger. By hyock.com | Related: Grass Wheel | Office Grass | Caravan Garden | Parking
Looking at a banana from a design perspective, one immediately notices the fruit is highly ergonomic and sophisticated: Bananas fit perfectly in the human hand, they come with a …
Mark Menjivar created a series of portraits of people across the United States, by taking pictures of their refrigerators content. Quote: "For three years I traveled around the …
Behold "the world's first production model 3D bio-printer." A machine capable of arranging human cells and artificial scaffolds into complex three-dimensional structures, which …
With his speculative ‘acoustic garden’ David Benqué tries to explore our cultural and aesthetic relationship to nature. He states that the current debate around Genetic …
Once, we wore footwear to protect our feet from the hostile influences of our natural environment. But with the replacement of our natural environment by a world of design, the …
Since a few years the internet in combination with mobile phone technology brought us something that we refer to as augmented reality : A digital projection that is placed over …
This extraordinary concept model that came out of the batcave of BMW shows how textile might be the future of car design. By replacing metal bodywork with a strong but flexible …
A while ago a plan was proposed within the European Union to add a “Three Strikes, Out” law regarding to copyright infringement. After three accuses of copyright infringement by …
Our peculiar image of the week was created by artist Olaf Mooij . Seen at Discovery Festivals Cabinet of Curiosities .
Frequent readers of this website might be familiar with our claim that Next Nature emerges from a fusion between the Born and the Made. But now we can add another: the fusion of …
Everyone wants to be remembered after his or her death. Some choose to be buried, others to be cremated. The company Cremation Solutions has a new service which ensures you will …
The food printer seems to be one of those lustrous concepts that continues to pop-up in the fantasy of techno-connoisseurs. Some years ago James King already proposed a printed …
Scientists have developed a mosquito that spreads vaccine instead of disease. The researchers, led by molecular geneticist Shigeto Yoshida of Jichi Medical University in Tochigi …
Designer Guus Baggermans was quite annoyed by the clumsy impoliteness of current vending machines, that typically require you to enter some abstract number to select your drink or …
Professor Hiroshi Ishiguro ( Intelligent Robotics Laboratory at Osaska University) has done it again! This time in coöperation with robot-maker Kokoro Co. Ltd . Objective: to …
The US Food and Drug Administration is considering whether to approve the first genetically engineered animal that people would eat — salmon that can grow at twice the normal …
Talking about nature and nurture as separate, clear-cut forces is far adrift from the complexities of developmental science, says Evelyn Fox Keller in NewScientist . ONE of the …
It is a widespread belief that, contrary to people living in urban areas, farmers have a strong connection with 'nature'. One seriously starts to doubt that after watching this …
Following in the footsteps of a Marco Polo-esque spice trade, next nature explorers Jon Cohrs and Ryan Van Luit travel by canoe past massive cargo ships and factories in search of …
Could this 2.0-bird be suffering from Infobesity ? Then it must be the result of excessive infocalorie consumption. Following people and news-sources on microblogservices like …
The Bio Robot fridge is a speculative product that uses a non sticky, odourless gel to envelope stored food as individual pods. The idea is that the gel cools by absorbing heat …
Last week I opened a bag of potato crisps that read: "We know the origins of all our ingredients" . As some crisps had already disappeared down my throat, this made me suddenly …
Dusting furniture and floors should be history in forty years time, as special bacteria in a yet to develop cleaning product will be eating the dirt. The speculative cleaning …
The way down was slow and somehow greasy. Total darkness surrounded them. Gill turned on the car radio and the LED's lit up their faces in a green pulsating glow. 'Jovi Rocks!', …
Chinese designer Daizi Zheng created a conceptual mobile phone for Nokia that could be powered by cola. The idea is the phone could run on a battery that uses enzymes to generate …
Protection is the fundamental purpose of the helmet. This helmet, a conceptual design project by Seungjoo Lee , enables the storage and protection of memories. Plug in your USB to …
These pencils release allegedly mind-expanding aromas, letting you 'smell your way to smartness while you write'. According to the creators , the fragrance is encapsulated using …
As we are calling for debate-provoking nanotech products that might hit the shelves of the Supermarket in the next ten years , some products much crazier than the ones we could …
Last Saturday, our Nano Supermarket opened its doors in a pleasurably crowded atmosphere. Below are some snapshots of the opening event. If you happen to be in the neighborhood, …
Ten days left to submit your speculative product idea for the Nano Supermarket . The jury that will select the finest submissions – to be exhibited in the Nano Supermarket this …
Hippopotamus: a 2,5cm-long tablet-shaped nonliving chewable animal, member of a multi-species flock known as the Animal Parade, which tastes like fruit and is found in little pill …
As we are nearing the end of the year, and anticipate you might have some time to watch a film, we discus our top 10 Next Nature movies. Idiocracy (2006) is not a great film, …
The main character in ‘Being There’ (1979) is a simple-minded gardener named Chance, played brilliantly by Peter Sellars, who has spent all his life as a servant in the Washington …
Look around you and try to find the most natural thing in the room you are in now. It is you. Now, you wouldn’t be so sure in the apocalyptic Los Angeles of 2019 depicted in Blade …
While the spotting of old nature phenomena in our surroundings – birds, insects, trees, stars, etc – has a large tradition enjoyed by millions, the spotting of next nature …
Nomadic Plants are a species assembled from a group of robotic-electronic-biological organisms living in symbiosis in order to survive in habitats affected by human activity. The …
Since the intake of medicines has become a mundane ritual nowadays, why not naturalize the interface? French artist Mathieu Lehanneur is rethinking the pill-person interface in …
In 1977, NASA launched Voyager 1 and Voyager 2, two unmanned interplanetary space probes that were sent out to explore the outer space. Aboard each was a record which intended to …
Last week, the U.S. Navy announced that four of their “ REMUS 100 ” unmanned underwater vehicles sailed off-radar and stopped responding to commands. The ‘bots were part of a …
At the beach, I'm always on the look-out for seashells big enough to hold against my ear to hear the sound of the sea . This child-like behavior still resonates with me. But I got …
Researchers at the Marine Biological Laboratory at Wood's Hole, Massachusetts, are testing a plan to train fish to catch themselves by using a sound broadcast to attract them into …
Samsung has released the results of a consumer study that indicated nearly a third of Denver–area residents would sooner give up sex for a year that go without a cell phone for …
Skinpaper is a speculative work by Tommaso Lanza and Vanessa Harden that explores the cross section between a living specimen and paper. "Skin paper is made of breathable …
At Tokyo's Shinagawa Station visitors can now select beverages from a 47-inch touch panel. An embedded camera will recognize your gender and age, allowing the machine to …
Using energy is not a social activity. Every electrical device we use has its own carbon “foorpint” which, in excess, can harm other living beings. How and to what extent you’ve …
This sculpture of scientist Stephen Hawking – who is both highly intelligent as well as highly dependent on technology – is our peculiar image of the week. Created by by Dinos …
An earlier post on Next Nature learned that The Good People behind Webwill provide us with a service to extend our lives on social networks after our physical death. But what if …
In Next Nature, not only old nature is being idealized. Because of the rapidness of new emerging technologies, we have a tendency to dwell on earlier prototypes. To recall …
Is human activity altering the planet on a scale comparable to major geological events of the past? Scientists are now considering whether to officially designate a new …
Rayfish Footwear, a company based in Thailand, has recently produced what may be the world's first genetically modified stingray. This ray exhibits an unusual, colorful pattern …
If you happen to be in the neighborhood you might want to attend the Next Nature lecture I will be throwing at the Transnatural symposium this Saturday 13-03-2010 at the Trouw …
What to do when you have a small city with limited space, and you rather turn available space into parking lots instead of parks? You turn to DUS Architects for an unlimited …
So we know now that we can embed the traces of our every day lives in our clothes . Well, some might find this strategy unsatisfying and would like to embed the traces of their …
This video shows the design vision of Corning, a company that specializes in glass. Not just any glass, but glass incorporating technology, electronics and displays. And it sure …
Growing meat in the lab, rather than slaughtering animals, could become a viable alternative for people who want to cut the environmental impact of their food consumption, but …
Our peculiar image of the week presents us the lustrous uncannyness of a Beetle car in its embryonic stage. Rest assure: this is fiction, however, metaphorically the sculpture by …
The Belgian Blue is a unique cattle breed that was developed quite accidentally in the late 1800s. An chance mutation lead the cattle to develop 'double muscling,' which occurs …
Recent work of artist Jalila Essaïdi exemplifies of how science and art can meet and create meaningful inventions for society. Jalila Essaïdi used the spider silk produced by …
City rats, it seems, prefer the same foods that humans do: Greasy, fatty, sweet, and salty. Although rats are usually seen as the billy goats of city life, ready to chow down on …
Everywhere we go, we conquer the land and shape it to our preferences. The next place to build might as well be the clouds. Tiago Barros , designer and architect, has decided to …
Our historical snippet of the moment is a Canadian television fragment from 1968 featuring a debate between Norman Mailer and Marshall McLuhan on the implications of media …
Thinking about Next Nature can sometimes result in a feeling of vertigo. Normal standards are eroded and slowly replaced by next natural ones. A bewildering example can be found …
Our food production is much more technological than we typically realize. My appologies for disturbing your trance; I realize that sometimes you'd rather linger in the illusion. …
Bionic horror by designers James Auger and Jimmy Loizeau , who have created a clock that traps insects on flypaper before depositing them into a vat of bacteria. The resulting …
In a vivd example of the blur between culture and nature, players using an online game called Foldit have helped solve complex questions for researchers about enzyme models. The …
Maybe you still remember the tattoo which helps to monitor a diabetic’s glucose level. A permanent solution. Now Japanese scientists from the University of Tokyo created a new way …
At Cornell Creative Machines Lab they were curious to see how two "chatbots" would make conversation. Powered by Cleverbot , created by AI researcher Rollo Carpenter, the robots …
Remember the Information Decoration essay which argued our so-called information society barely employs our human bandwidth, as most of the data in our lives is presented in …
Mobile phones may be the most affective technology we own but researchers at the Design Research Lab in Berlin have taken this notion to its most outlandish limit. Their cellular …
Remember the movie Eternal Sunshine of the Spotless Mind, where Jim Carrey removes his memories of a relationship with Kate Winslet? According to researchers at the University of …
Manko blinked. Then blinked again, and again and again. While he did, he went through various layers at once and he was dazzled and amazed, his jaw dropped at all that he saw. He …
As they went down the elevator shaft, going deeper underground, neither Nada nor Manko spoke a word. To Manko it seemed to take forever. In his mind, he went over the long …
What do you think of lab-grown meat? "Yuck" might be your first reaction. One day, however, it could become the environmentally friendly alternative for breeding cows and pigs for …
Mediamatic is hosting a pop-up urban mushroom farm in the middle of Amsterdam. Rows and rows of shiitake, oyster, and the elusive almond-flavored Agaricus subrufescens are …
Along with a library and museum, Amsterdam's Schiphol Airport recently added a park to its list of attractions. Officially opened by Princess Irene, the first Airport Park in the …
Filed under Biomimicmarketing . Pleases your inner monkey. Peelable banana ice cream by Nesle . Thanks Jurrian.
Whereas lizards have the extraordinary ability to regenerate lost limbs – meaning that if the lizard loses a limb through conflict with a predator, it will grow back – people have …
In twenty years , the mobile phone has become man's closest utensil. Can you imagine living without this umbilical box? Too bad it's often still a box that we hold to our ears... …
We tend to think of plastic as a cheap, inferior and ugly material used to make children’s toys, garden furniture and throwaway bottles. But as an experiment, imagine for a moment …
This disposable aluminum barbecue on top of an original Weber barbecue nicely illustrates how people – time after time – employ technology to make life more convenient while …
A little girl gets angry at her father, and uses her index finger and thumb to make a pinching motion . No, she's not trying to hurt him. She's using iPad sign language to say, "I …
A panacea Yoghurt? Cures athlete’s foot, acne and dandruff! Triple irradiated Spinach? Three-week shelf life! Funa sushu? Asian carp fresh from Lake Superior! Minority Report …
You are what you eat, taken seriously. Shrink is a work by the artist Lawrence Malstaf . Visitors place themselves between two large, transparent plastic sheets. The air gets …
We've previously featured architecture that imitates nature by opening its walls like a flower , or drifting like a cloud . However, maybe this is not imitation enough. The next …
Last week, the young and talented designers of the Next Nature lab at the Eindhoven University of Technology presented their end of term works in an internal exhibition. There are …
MyMicrobes , interestingly dubbed "Fecesbook" by ABC News , is the new social network for your gastrointestinal bacteria. For only $2,100 and a bit of poo you can become a member …
Diego Stocco is sound designer and composer from Burbank CA/US. He plays a tree as a rhythmic musical instrument, recording its sounds using a custom stethoscope. I suggest him to …
While some of us might have heard of the humorous but fictional ' spider pig ,' spidergoats are the real deal. Although you might expect to see them lounging in giant webs or …
Steve Jobs , former Apple CEO, passed away on Wednesday October 5th after a long battle with pancreatic cancer. Technology conceived from his vision has changed the world …
Tweenbots are small robots that depend on the kindness of strangers. They are only able to move straight forward and do this constantly. Once they get stuck in a hole or at a …
What animal is so naive to come into this world as a naked and crying infant, completely vulnerable, helpless, and an easy prey for any predator? Newborn lamb or giraffe’s babies …
As a child you probably had one of those temporary tattoos that come packed with over-sweetened chewing gum. It was a nice decoration, and a way to stand out. Recently researchers …
Christien Meindertsma spent three years tracking down every product made from a single pig. Pork made a showing, but the more strange goods were "ammunition, medicine, photo …
Sometimes new technology has to bio-mimic old nature to be accepted. In the late 1960s and early 70s, Uniroyal Engineered Products invented the 'nauga' a beast that gives its name …
I've noticed DNA spray notices springing up around Amsterdam. I assumed it was a fairly standard anti-theft device: A crime is committed, a little nozzle is activated by the …
Thanksgiving is fake-for-real. While it's true that there was a minor harvest feast in 1621, held by English immigrants and Wampanoag Indians, the event was never celebrated …
Blue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …
Columbia professor Dickson Despommier imagines filling New Yorks skyscrapers with farms. As over 50% of the world population now lives in urban areas, this scenario could solve …
Scientists in China have created transgenic cows that produce 'human' milk. The researchers boosted the fat content of the milk and added three types of proteins, unique to …
The American Chemical Society has announced a new method of producing gelatin that sounds like good news for cannibals and the canni-curious. Researchers are able to create …
When watching a science fiction flick, it can be hard to determine what time in the future it is set, although this is a usually an integral part of the movie. However, it is …
Presumably the only place on Earth where burkas & protein supplements coincide in jolly harmony. Peculiar image of the week. Photo by me .
From the exhibit "What Machines Dream Of" in Berlin comes Life Writer , a work by Christa Sommerer and Laurent Mignonneau. As the participant types, letters are projected on a …
Artist Jaroslav Kyša has invented a novel form of social protest . By scattering seed in front of targets in London, he can attract droves of pigeons that disrupt shoppers and …
This project explores the invisible terrain of WiFi networks in urban spaces by light painting signal strength in long-exposure photographs. A four-metre long measuring rod with …
Industrial-scale in vitro meat may be a long way off, but for meat-lovers looking for a cheap, eco-friendly source of protein, there's no need to wait. We just have to swear off …
A new Dutch landscape with windmills up to 120 meters. Designed by NL Architects .
Earlier this year, Belgian surgeons successfully performed the country's first full-face transplant using 3D printing. The operation was conducted by a medical team of Ghent …
Ever wish you could express yourself better over Skype? Tired of being a disconnected head-in-a-box? A team at Stanford University has rigged a Mac computer screen to shake its …
The earth operates on a 24 hour cycle, and so do humans. For most of history, we didn't have much choice in the matter. However, in the absence of visual cues light sunlight, some …
After being denied permission to reproduce the famed Little Mermaid statue from Copenhagen, the authorities of Vancouver decided to go for something more realistic.
Elon Musk, the chief executive of spacecraft company SpaceX, believes we need to reinvigorate popular interest in space colonization, not just to boldly go where no man has gone …
As mentioned earlier , the world seems obsessed with algae. Not limited to producing light or energy , algae has also found its way to our plate as a new vegetable, and maybe …
Fat is what makes ice cream taste rich and creamy. It's called ice cream, after all, not ice skim milk. So how have some manufacturers managed to make reduced fat ice cream that …
Artist Arne Hendriks explores the possibilities and implications of downsizing the human species to better fit the earth.
Farmers have long made frugal use of their table scraps, feeding their leftovers to hogs, dogs and now, cows. In a bizarre sign of our cash-strapped and climate-changing …
Certain types of bacteria can navigate using magnetic nanoparticles as tiny compasses. Researchers at the University of Leeds have extracted the protein that controls this process …
In combining the classic feeling of handling a book with the interactivity of the computer, Waldek W?grzyn of the Academy of Fine Arts in Katowice, Poland, has created a new human-computer interface.
Having trouble getting the kids to eat their fruits and vegetables? Try turning their 5-a-day into a trendy, collectible toy. We've seen Buddha fruit and square watermelons …
With areas of New York still without electricity, BioLite recently came to the rescue of Brooklynites by setting up a charging station with camping stoves that convert excess …
This nice interactive map makes it clear what’s awaiting us in the near future. Presumably.
Researchers at Stanford and the J. Craig Venter Institute recently created the first complete computer model of an organism. The simulation models the genome and life processes …
Twenty-first century society draws from a world that is less determined by objects and increasingly shaped by connectivity. The clear either/or distinctions that formerly informed …
Could you imagine yourself having QR-code freckles, or a chlorophyl skin? Dutch artist Marcia Nolte visualises these kind of speculative scenarios in a very non-spectacular yet …
Just like corn, bananas , and essentially any other plant we cultivate, the Cutie mandarin is the result of a concerted effort to produce an ideal food. Mandarin oranges come from …
Same article , different example: Water Powered JetPack by Jetlev . (Thanks: Marlies Peeters)
Apple's recent work on iOS has been using as much references to "natural" elements as possible, making the digital as physical as possible. Doing how they do, they have been …
Cities have seen guerilla gardens, rooftop honey production, and fire escape chicken coops. Now, urban farmers may be adding aquaculture to the mix. Headed by ex-banker …
Wild salmon gets its robust pink color from a diet rich in red-hued krill. Farmed salmon are fed on fish meal, chicken byproducts, soybeans, wheat and a long list of other …
The Kitchen Meat Incubator does for home cooking what the electronic synthesizer did for the home musician. It provides its users with a set of pre-programmed samples that can be …
Rather than growing whole steaks in bio-reactors, Knitted Meat assumes that it is more feasible to create thin threads of protein. Supermarkets sell balls of meat fiber seasoned …
Magic Meatballs are designed to playfully familiarize children with lab-grown meat.
As the planet’s population speeds towards 9 billion, it’s becomes impossible to continue consuming meat like we do today. Will we all be eating rice and beans? Grasshoppers …
Many people still find in vitro meat too alien and artificial to put it in their mouths. With the Rustic In Vitro incubator, this outdated perception is about to change. Similar …
Remember Lucy McRay's swallowable perfume ? Well, now you can buy it. Annu Alpi has developed a piece of deodorant candy which presumable makes women smell like roses for up to …
Imaginary infomercial on the hypernatural udder cows, optimized for milk production
This promo video for the Google autonomous car is pretty exciting. I'm sure in a decade driving our own car will seem so old-fashioned,thinking how we ever trusted the physical …
Slowly but steadily the digital environment is becoming the primary living space where we interact and define ourselves. According to Gordan Savicic however, some things are still …
Improving on photosynthesis has long been a dream for scientists. The so-called artificial leaf – which wouldn't necessarily look like one – would run on only solar energy and …
Filmmaker Jesse Rosten shows his critical views on body standards by presenting the exclusive beauty breakthrough Fotoshop by Adobé. This revolutionary product features pro-pixel …
Whale sharks are great at filtering; plastic needs to be filtered. For now, however, whale sharks only have an appetite for plankton. Industrial designer Elie Ahovi has jumped …
Image consumption in the overdrive. Peculiar image of the week. Created by Erin Murphy, Victoria Bellavia, Yong Jun Lee & Sanggun Park . Thanks Jeroen van der Meij.
Artist Arne Hendriks gave a lustrous talk on the possibilities of downsizing humanity to better fit the earth.
If you've turned to plastic Christmas trees because the real ones leave piles of needles behind, science is working to bring live conifers back into your holidays. A $1.3 million …
Most corn has been selectively bred over the centuries to be a single color: yellow, white or blue. Glass gem corn, a varietal grown by Greg Schoen , harkens back to the days when …
In a twist on the classic " microbes that turn shit into petrol ", researchers at MIT have developed a bacterium that turns carbon dioxide into a direct substitute for gasoline. …
Brazilian ad agency AGE Isobar spent two years experimenting in order to grow fruits into the shape of Camp's juice boxes. Immature limes, guavas and passionfruit were packed …
While sunlight contains all colors, the dominant type of chlorophyll in plants only needs purple light to function. This simple fact has big implications for the future of …
Back to the natural future? A startup company in Oregon is manufacturing bike helmets made of wood and cork that should meet or surpass the impact performance of plastic and foam …
Originally herons are migratory birds, in the winter they leave to warmer habitats. In the city there is enough food to survive the winter. Some herons are even too lazy to find their own food and try to collect it from the local snack bar.
Humans and other hominids have a reputation for bringing about mass extinctions. Homo erectus has been blamed for the disappearance of many African carnivores, our ancestors …
On society's search to becoming a meatless one, several new kinds of 'meat' pop up in the food industry. From so called 'hybrid' meatballs, to 'the chicken that isn't', when will …
Body-mod enthusiast David Hurban has decided to make a lifelong commitment to his iPod Nano. By implanting magnets in his wrist, Hurban has created a permanent bracket to hold his …
Why does your food look different in advertising than it does in the store? A Canadian McDonald's marketing manager tries to answer this common question with a behind-the-scenes …
The number one argument for eating meat: it provides nutritious proteins that cannot be entirely supplied by vegetarian alternatives. Like it or not, humans are omnivores. Meat is …
The increasing ‘liveliness’ of machines and accessibility to the virtual world has raised questions about whether it is possible to uncouple the mind from the body in through a …
As advances in nanotechnology bring us increasingly energy efficient products, plant life such as algae could become attractive sources for tapping energy. The Latro lamp by …
Nothing wrong with a bit of juicy television on 'In Vitro' meat. We propose to lock this video in a time capsule so that our kids can watch it and be horrified in 30 years or so.
Using only plastic sheets and an irrigation-nutrient system, a Japanese researcher has found a way to change agriculture as we know it. Professor Yuichi Mori argues in his talk at …
According to professor Mark Post, lab-grown meat could become the environmentally friendly alternative for breeding cows and pigs for meat consumption. Watch his talk!
Last week, the young and talented designers of the Next Nature lab at the Eindhoven University of Technology presented their end of semester works in an internal exhibition. There …
This promotional video for in-vitro meat was brought to you by the bureau for in-vitro meat promotion students of the Beckmans College of Design .
Researchers have developed genetic manipulated mice, with extra smell receptors that make them highly sensitive to the smell of explosives. Scientists hope to use these mice in the future to discover land mines
Little over two weeks left to submit your speculative product idea for the Nano Supermarket . The jury that will select the finest submissions – to be exhibited in the Nano …
From sleek fashion to life-saving medicines. During the forthcoming Dutch Design Week , our lustrous NANO Supermarket debuts a new line of speculative nano products that might hit …
This week our NANO Supermarket will be visiting Milan as part of the Salone Internazionale del Mobile.
Growing up, I had a cockatiel that could mimic the bleeping cacophony of a dial-up connection with dead accuracy. I never stopped to think that my bird (still alive) preserves a …
Volvo cars is testing a new safety system that automatically hits the brakes once an animal is detected in the vehicles vicinity. The Animal Detection System expands the range and …
I didn't need to insert a coin before collecting my refreshment!
Should made-to-order babies become a reality in the near future, one piece of the design puzzle has been solved now Pantone has release their SkinTone system. Indexing 110 skin …
Besides children and pets , it turns out that pigs are also attracted to interactive interfaces. Pig Chase is a computer game in which pigs and people can play together. The aim …
Experience full data silence with the Faraday Bag. Made from electromagnetic shielding silver coated fabric, it prevents devices inside it from being contacted. Made by artist …
A while ago we wrote about the Pixelhead mask by artist Martin Backes . Now he informs us that the masks are for sale. Get one while they last!
What most gourmands would define as "real" and "natural" vanilla flavoring is simple: Vanilla beans steeped in alcohol. But vanillin, the chemical responsible for vanilla's taste …
Time to add another superpower to insect silk, which already includes bulletproof skin and implantable microelectronics . Recent research indicates that silk may be an ideal …
Feeling grumpy and hungry? Unfortunately, the University of Tokyo's Happiness Counter refrigerator won't open up until you give it a big smile. The concept is based on the fact …
Tokyo University of Electro-Communications , revealed SHIRI (? = "buttocks"), a "Buttocks Humanoid That Represents Emotions With Visual and Tactual Transformation of the Muscles." …
Once upon a time animism ruled people's beliefs: both organisms and objects were imbued with a conscience. Artist Ronald van Tienhoven states that as technology closes the gap …
For past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here. When a product imitates animal behavior, the strict social rules …
For doom-mongers delight, the Berlin-based design studio Bold Futures made a handy interactive graph of the fatal disasters that might snuff us.
Cake or death? Cake! The Slice cake is a (vegetarian) vision of the forms lab-grown meat may take in the future.
Convenience store chain 7/11 is serving up the latest in a line of futuristic near-foods: Instant mashed potatoes from a Slurpee-style spigot. The machine dispenses a stream of …
Now here is a product that should soon find its way into the NANO Supermarket soon. At least, if supermarkets are willing to put it on their shelves, as they currently make huge …
The same way Einstein assumes the speed of light to be a constant of reference for his Theory of Relativity, the philosophy of biomimicry assumes Nature as a constant of reference …
Plants have it tough. They're tasty, silent, and stuck to the spot. With Jurema Action Plant, artist Ivan Henriques has given plants the mobility they deserve . Henriques' pieces …
The Singularity , as popularized by Ray Kurtzweil, refers to a near term, theoretical time when machine intelligence greatly surpasses our own. At this point we will experience a …
We're used to seeing proposals for high-tech vertical farms that never seem to translate to real life, but the city of Linköping in Sweden has finally taken these buildings out of …
Created by Cary Huang, this interactive scale of the universe shows the relative sizes of everything from quarks to the Hoover Dam. Be prepared for some cosmic gee-whiz moments …
Privacy is a right. A right given to people by telecommunications companies and social networking websites. It can be described by multiple-choice lists of settings. And it seems …
What do blueberries have in common with sugar, corn cereal, modified food starch, partially hydrogenated vegetable oil, artificial flavor, cellulose gum, salt and and Blue …
A new study on the effects of cholesterol on the life span of Caenorhabditis elegans, a tiny worm often used in experimentation, resulted in some surprising finds. The life span …
You all probably know the ' Twitter implant ' from the Nano Supermarket . Scientist at the University of Princeton now created the first working prototype. The implant is actually …
Retailers have long known that certain smells get us into the buying mood – cinnamon or warm cookies around the holidays, for instance – even if we're shopping for completely …
At the Next Nature Power Show 2011 our master of ceremony, Koert van Mensvoort gave a mini lecture on our changing notion of Nature.
This stunning graphic, courtesy of Nature & More , shows the astonishing drop in food crop diversity from 1903 to 1983. Lettuces available from commercial seed houses now …
Remarkable infographic by pcrm.org . Via NY Times , via Consumerist.com .
Often cockroaches aren’t people's best friends, but maybe in a few years you will be relieved when you see a cockroach. Researchers of the North Carolina State University …
A new study from the marine conservation group Oceana reveals that a full one-third of seafood across the US is mislabeled. Not surprisingly, the most expensive fish is also the …
Printable pizza. The next big food innovation after sliced bread.
FabCafe in Tokyo offers a sweet new way to make self portraits.
An exploration of one way we might use 3D printed stem cells for body modification.
The boundary between humans and machines is slowly but steadily blurring. The Immortal is a machine which exists out of several life-support machines connected with wires and electric cords.
A new theory claims it wasn't human deforestation that caused the ecological collapse of Easter Island, but something smaller and squeakier.
How geology and humanity turn ancient algae into high-tech gadgets.
In what's probably the most fun form of environmental protest ever, Banksy has created a morose-looking dolphin ride to protest the BP oil spill. The ride is complete with fish …
A fundamental philosophical question, how do we know my blue isn't your yellow? The current human and "natural" understanding of color is fundamentally based on a …
Heather Dewey-Hagborg just needs a strand of your hair to know what you look like.
Living lamps like Latro Algea Lamp by Mike Thompson are nothing new. But design studio MADLAB has created Bacterioptica , a lamp that contains organisms and bacteria from the …
Taking a cue from the human brain, a new microchip can rewire itself after damage.
3D printer company MakerBot recently launched a contest inviting designers to create the birdhouse of the future. The winner is The American Craftsman Bungalow by Brent J. …
Illustrators from the 1800s to the 1950s offer strange prediction for the future of meat.
Trials for new drugs hold promise for a "cure" for female boredom in the sack.
Artificial lighting at night makes us fat, depressed and sick. What are the alternatives?
A Dutch artist designs a Utopian eco-socialist online society.
Big bugs make big bucks for Chinese farmers turning to roach ranching.
A 23-year-old in China was recently puzzled why his online avatars were being killed off at disproportionate rates. After asking around, the young man eventually discovered that …
A new device replicates the kicking and moving of a baby inside a mother's womb.
The food writer Bee Wilson, author of Consider the Fork , has put forth a surprising theory about forks and teeth that has received widespread online coverage. According to …
Fat rats with unrestricted access to high-calorie food still lose weight with the help of a genetic implant.
Biohacker Tim Cannon inserted a chip into his arm to monitor his bodily data and transmit it to an Android device.
Paint with meat! is a product for children of 5-10 years old. It allows them to prepare a meat dish on their own and in a very creative, fun and safe way: by painting with meat!
While Next Nature is hard at work normalizing the idea of eating lab-grown meat , a group of British design students are working to bring insect-eating into the mainstream. Though …
How "celebrity endorsements" transformed the potato from the devil's tuber into a global staple.
Scientists learn how to harvest electricity from radio waves.
The world's first – and hopefully last – whiskey aged with radioactivity.
Designer Michal Marko created a biodegradable food bowl. Can you imagine this bowl being used in fast-food restaurants?
Algae as the future alternative fuel for the human body.
What to do when earth is not enough? Thousands of people, tired of their life on Earth, are ready to emigrate to Mars. Since subscriptions opened on April 22, 80,000 people have …
Which candy bar you choose depends on the color of the packaging.
In vitro meat is creepy, unnatural and downright disgusting – and so is every other kind of food we eat.
You’ve heard about peak oil, but what about peak automobile?
Cheetos and other junk foods are more carefully engineered than the average bridge.
The rise of digital currencies reduces the need for physical interaction and communication between people. At the same time every payment method still leans on trust. But how can …
Last weekends edition of the Guardian featured some of the In-Vitro Meat Visions developed at Next Nature Lab.
Digestible Microchips are now approved by the US Food and Drug Administration.
Chef Bun Lai of Miya's Sushi in New Haven, Connecticut, has a cheeky solution to invasive species: he eats them. His menu regularly features lionfish and Asian shore crabs, …
Miss the soothing clacking of typewriter keys? Long for satisfying clang of a carriage return? Get iTypewriter for iPad.
$220 ice cream glows thanks to synthetic bioluminescent proteins derived from jellyfish.
While most children nowadays believe the woods smell of shampoo, there are still those critical young minds out there eager to question things.
For those who "eat meat, but don't like in-vitro meat, because it is so unnatural" . Please spend 5 min to watch this video and change your thinking. You were watching the …
Minsu Kim created a wonderful series of living dishes that wiggle and wave on your plate.
Two lights that behave like pets, acting and reacting like autonomous creatures.
How incredible would it be to imagine a thing and have it magically appear in concrete form? After food , organs and virtuality , here comes the thought printer! Thinkerthing , …
Tech experts are betting that they can make vegetarian eggs that outperform the real thing.
Food companies are hard at work inventing processes to make luncheon meat look "deli fresh".
Artist Maja Smrekar modified yeast with her own DNA to produce human lactic acid.
The oldest evidence of cold food storage dates back to 1700 BCE.
The story goes that in the 7th Century, Buddhist monks in China stumbled upon the product now known as "wheat gluten" while cooking. Noting that it looked, felt and tasted …
In 1995, the US FDA (Food and Drug Administration) approved the use of in-vitro techniques for commercial meat production, paving the way for lab-grown meat products to make their way to the market.
In 1876, the first cattle feedlot was established near Chicago.
By the turn of the century, some people began raising questions about our meat consumption habits.
In the 1950s, the transition towards what is now known as factory farming picked up speed with farmers.
The very first restaurant to typify the modern fast food genre was White Castle, who opened their first location in 1916 in Witchita, USA. Ironically, at the time fast food was …
Our traveling NANO Supermarket is nominated for a Dutch Design Award. Winners will be announced late October.
Roses are red, violets are blue. Nanoscale flowers are what some scientists grew.
The News Machine is a contraption that explains the news distortion that happens when a message is broadcast through different media. The starting point is a tweet sent from a …
London Real interviewed Koert Van Mensvoort on the concept of Next Nature and its implications on our planet.
Conservation workers ask synthetic biologists to help them save the world's endangered creatures and habitats.
Indulge in the Next Nature stump speech at TEDx from Dr. Van Mensvoort
An olfactory device for Smartphones that spreads the aroma of barbecue using an app.
An artist envisions our consumer electronics in a century, moss-covered and half-decayed.
An innovative workshop points out future directions for in-vitro meat products.
The self-repairing sole is a dynamic solution to an everyday problem.
A new strain of purple GM tomatoes last longer on shelves and help out cancer-prone mice.
Video testimonial for our Next Nature appzine, all the way from India!
Manipulations of the mind that were once the terrain of futuristic fantasy are now one step closer to becoming reality. Scientists at the Massachusetts Institute of Technology …
Imagine your home adapting itself to seasonal, meteorological and even astronomical conditions by changing its shape. D*Dynamic is based on the discovery of mathematician Henry …
Italian Designer discovers new material. A ideal throne for a vegan king.
The Sniffer – aka Google Nose – visualizes odors using a smell sensor, which is as good as a dog’s nose, and a glass in front of your eyes.
Space Farming: NASA plans to grow a vegetable garden 230 miles above the Earth.
3D printed organs are on the way. Could they be designed to be aesthetically appealing?
Many people don't know that growing and cooking in vitro meat is a decade old.
Designed by a dancer, a new wheelchair moves intuitively with the user's movements.
Researchers in Tokyo have developed an artificial womb (for goats).
Looking back on the first recorded attack on a human cyborg.
Scientists are using Twitter, blogs, and news sites to categorize the global psyche.
An astounding tangle of multi-colored water flowing throughout 18 arteries represents what happens every day in the pulsating heart of Tokyo. This is how Takatsugu Kuriyama , from …
A (very) short history of a century's worth of "disembodied" meat in fiction.
A "breathing" desk that reminds you to change positions throughout the day.
Advertisers have figured how how to induce auditory hallucinations into your morning commute.
Because date rape drugs are odorless, colorless and tasteless, victims don't normally realize they've been attacked until it's too late. In a clever, necessary bit of information …
While Next Nature was busy dreaming up new in vitro meat (IVM) foods, the mad scientists of Terreform ONE in New York went ahead and designed an entire dwelling made of IVM pig cells.
Beekeepers in France have been puzzled by their bees producing blue and green honey. Turned out the bees were eating waste from an M&Ms factory.
Our language preserves evidence of a type of food that's all but extinct.
Tired your ugly duds? Sick of surveillance drones? Does Adam Harvey have the clothing for you!
Workers are completely controlled by algorithms in Amazon's fulfillment center
Isaac Asimov predicts in 1964 what the world will look like today, in 2014.
Historian Yuval Noah Harari takes us on a journey through the whole human history.
JAXA developes a net that could collect debris from outer space.
British philosopher David Pearce believes we should to stop animals from hunting and killing other animals.
Yaybahar is an acoustic instrument that emits sounds like a music synthesizer.
The ambulance drone: an autonomously navigating mini aeroplane that can quickly deliver a defibrillator.
Project Loon by Google has the mission of providing Internet access to rural and remote areas, with a hot air balloon network.
The façade of an Indian temple constructed from a large-scale print of a Facebook Wall.
Floris Kaayk, artist and fictive documentaries maker, confronts us with the impossible.
4th of December Dr Van Mensvoort lectures in New York at the BIOFABRICA summit. Other speakers include Paola Antonelli and Andras Forgac.
Imagine you could drive your car using only your thoughts. It is now possible!
Inspired by the movement of spider webs in the wind, Dutch designer Jeroen Van Der Meij created Breathing Lights.
The Western Corn Rootworm has evolved to eat genetically engineered corn, designed to kill it.
The World View Experience offers an expensive journey to the edge of space.
Digital natives have trouble understanding life before 24/7 online connectivity.
Indian fragile DIY electronic infrastructure gives an insight into our complex electronic wire systems.
During a triathlon ace a drone operated by a local photographer hit one of the athletes.
An unsuccessful piece of video gaming history became an archeological record.
Buq are electronic life forms that shift the experience of the street scape from the primarily visual to a more auditory experience.
First 3D-printed skull has been implanted on a 22 years old dutch women.
In Japan, fake food industry represents a century of old crafting tradition and a multi billion business.
Daan Roosegaarde is exploring possibilities to replace streetlights with luminous trees.
Last month graffiti artist Katsu presented his graffiti drone called the ‘’spray copter’’.
A new artificial mineral made of technological artifacts, such as computers, tools and machinery.
Rubber band distortions lead to discovery of a new shape called hemihelix.
In the Ruriden cemetery, in Tokyo, over 2.000 Buddhas statues are illuminated by high-powered color changing LED lights.
A deceased scrollbar in a Church. What does it mean?
The home incubator does for cooking what the electronic synthesizer did for musicians.
Meat fruit combines the femininity of fruit with the masculine sensibilities of red meat in a hybrid celebration of our post-patriarchal, post-gender society.
If vegetarian products can mimic meat, then why not the other way around?
A novel process turns wood into tasty, edible starch
Drones are typically thought of as flying spying robots, or even worse flying spying shooting robots. But could we also employ drones for good? The people of …
Modern technologies give deaf people the ability to hear again, not only regular sounds but also the invisible Wi-Fi signals.
Portraits of people who live alone in the forest.
Tinder users beware: somewhere out there a mechanical finger is surfing the popular dating smartphone app. This could be your next match.
In this approaching era, what might be biologically possible for plants?
Healthy gut bacteria may hold the key to weight loss – but only isolated communities may preserve "natural" intestinal biomes.
On the 5th of August, one year after the lab grown hamburger, the In Vitro Meat Cookbook was launched.
Bioengineer Drew Endy shares his idea of biology as a precision manufacturer that could potentially transform civilization as we know it.
In 1930 Germans envisioned our Society of Simulations.
A robot that applies computer controlled motion to precisely decorate your Easter eggs.
For our new book "Save the Human" we invite you to submit quotes that question the autonomy of mankind in the digital computer era and study the future of the independent creative spirit.
The oPhone and oSnap allow you to send pictures with aromatic vocabularies.
A new way to project yourself against sharks while enjoying your favorite watersport!
Solaris gives participants the power to control a pool of magnetic fluids with their brainwaves.
What if we could drink from a giant drop of water? The bottle of the future has the shape of a soft, hygienic, biodegradable and edible blob.
From automobile to airplane: the flying car is built to travel as easily on the road as in the sky.
The Human Hamster Wheel Desk is the latest result of workspace evolution. Office work has domesticated us!
The Moodmetric ring measures the autonomous nervous system signals that can be used to understand emotional reactions and improve quality of life.
Seth Godin argues the Internet has ended mass marketing and that it brings us back to the tribe.
Buckle up for a new video from our favorite performance philosopher Jason Silva: To Be Human Is To Be Transhuman.
Thanks to 3D Babies and a mere $600,- you can now experience that excitement of holding your baby in your hands before he or she is born.
Heinz and Ford team up to use tomato skins in car parts.
Prof. Patrick Brown developed a meatless burger that look and taste like meat, made out of plant ingredients.
A virtual reality headset could give chickens the freedom to roam without the roaming.
A lightweight and mobile structural fabric based on ancient traditions of weaving fibers.
Many scientists believe that we will soon be able to preserve our consciousness indefinitely. This could be done by copying and transferring these contents into a computer, or by piecemeal replacement with parts of the brain gradually replaced by hardware.
Although there seems to be no effective drug in use to cure malaria, a scientist robot named Eve may have found a cure.
Super Mario is now able to learn and feel in the confines of his 8-bit universe.
The wind turbines of the future will look like post-modern tree sculptures.
Computer can already beat us in many tasks. Complicated calculation, processing speed and chess, to name a few. However, generally speaking, you’re still likely to be more …
Most VR concepts and products are coming from big tech companies. With their ad-driven business models they are likely to fill your Glass, Hololens or Oculus with ads at some …
Do you think you are made from bits and bytes? Stop playing video games and spend some more time offline! Both atoms and bits are basic parts of matter.
Is it analog, or is it digital? It’s a boomeranged metaphor!
The Analogue vs Digital Memory Game explores the different ways of seeing, thinking and experiencing across the digital divide.
Before global positioning systems, we all used maps. And they could be very annoying.
Remember these? If you are a digital native there is a chance you never noticed one of them.
Florian Mehnert, A German artist, has launched an experiment that will give internet users the power to shoot a rat with a single click on their keyboard or smartphone. A …
Emily Howell is an interactive interface able to compose and perform her own pieces of music.
An inspiring topic about recent developments in biomimicry, Janine Benyus gave a talk on how nature influenced our future.
Inspired by the award winning In Vitro Meat Cookbook , Next Nature Network and Submarine Channel present Bistro In Vitro : an online design fiction documentary about the future …
Studies suggest that Botox impairs the ability to process the emotional content of language, limiting the quality of emotional experiences.
Swimming salmon fillets confuse educate children about where dinner comes from.
Scientists think the laws governing the structure of galaxies in outer space are the same laws underlying the growth of cities.
The Federal Aviation Administration (FAA) picked six test sites throughout the US to experiment with drone-based cloud seeding.
The world’s largest indoor farm is not the only firm developing vertical agriculture. Japanese company Spread plans to grow more than ten million heads of lettuce a year by …
This modernist food makes the future of 3D printed food look pretty tasty!
Sixteen-year-old Japanese singer Hatsune Miku grew in short time to a worldwide popstar. With her colourful appearance she counts millions of followers on social media, she …
City of Drones puts you in a first person view of a drone drifting through an abstract futuristic cityscape.
The home incubator you can prepare a stew made with thirteen different sorts of meat, is heaven for carnivores.
America artist Mac Cauley created a new way to experience the painting in virtual reality.
Eyes of the Animal is an interactive project that invites the public to an uncommon virtual reality setting conceived especially for experiences in actual forests, giving the opportunity to see the world as an insect would.
To counter the sitting dogma, design firm RAAAF and artist Barbara Visser created a dynamic office concept, entirely based on movement and leaning.
The amount of fast food children eat may be linked to how well they do in school, a study suggests.
Our constant need of new, cleaner energy led a Michigan State University research group to conceive a fully transparent solar panel that could replace ordinary windows.
The acronym that keeps Europe awake at night is TTIP (Transatlantic Trade and Investment Partnership), a trade and investment deal that the EU is negotiating with the US. From …
Earlier this year, a group of Chinese scientists published a paper about the modification of the genome of human embryos with the cutting-edge powerful technique called CRISPRs. …
The Kitchen Insect Farm enables people to grow their own protein source (read: larvae) at home.
Time measurement tools are perhaps among the most inventive technologies mankind has produced, as it enables us to articulate ‘natural’ time (in the form of lunar years, sun …
This augmented reality helmet allows the wearers to see all around them without having to turn their head.
How would you feel if robots inherited ethical complications of existence?
"However, while 3D printers are becoming increasingly accessible and capable of rivalling the quality of professional equipment, they are still inherently limited by a small print …
Dutch researcher and entrepreneur, Willem van Eelen, has died in Amsterdam. For more than half a century, Van Eelen relentlessly researched and promoted In Vitro Meat.
The Knotty Object summit promises to be a paradise of anti-disciplinary delight. The event held at the renowned MIT Media Lab gathers designers, scientists, engineers and writers …
Japan city has launched an online street view map to introduce the view of the city by a cat's perspective.
Books allow you to fully explore a topic and immerse yourself in a deeper way than most media today.
A team of researchers recently developed a new method for 3D printing that can reduce the printing process down to minutes.
Google plans to connect more than 100 million people in a cheap, new and sustainable way, in a territory where only one person on three has access to the Internet.
Next Nature at "Mindfulness and Digital Detox: How to Tune Out to Tune In" Conference in Paris.
After it sold out, the Next Nature book has been reprinted with a brand new cover.
Koert van Mensvoort will take part in the Nature 3.x: Where is Nature Now? symposium at the University of Minnesota.
Going to the lustrous SXSW festival in Texas this year? Don't miss out on the Next Nature presentation!
Zackary Scholl developed a program to produce a poem that passed the Turing Test.
Waterlicht shows how the Netherlands would look without waterworks — a virtual flood.
The National University of Singapore released a group of robot swans in the Pandan Reservoir to swim around and keep an eye on water quality.
Sarah Parcak is a pioneering "satellite archaeologist" from University of Alabama, a sort of Indiana Jones with 21st century tech. She has been awarded the 2016 TED Prize for her …
We call upon you, dear readers, to participate in a new publication from the Next Nature Network: SAVE THE HUMANS!.
A new seaweed that tastes like bacon and is better for you than kale.
Time Ingot is a solid piece of lead alloy, its mass can slow down time in the immediate vicinity.
The Smithsonian’s National Air and Space museum has taken the sun observation to the next level with a giant public display of images and data that show the sun in hyper-real detail.
A microbiologist has developed a way to make the cracks in concrete structures heal themselves.
A tree, made with 3D printed leaves that contain solar cells.
Tired of drunk people peeing everywhere on the street, people of St. Pauli, Hamburg decided to take a smart step to prevent it.
Stewart is a tactile interface that mediates the communication between human and self-driving car.
These synthetic organisms from our In Vitro Aquarium are a hybrid between plants and animals. Would you eat them?
Grasshoppers are a sustainable and cost-effective alternative to meat protein. Could the ability to grow them in your kitchen make them more appealing? Watch the video below and …
Meet the anti-smartphone. It literally does nothing but make and answer calls.
The SkinBook is made of synthetic skin that allows beginner tattooists to practice their skills.
BeoSound Moment is an intelligence sound system that predicts the music the user is in the mood for.
A virtual reality theme park where visitors can explore the virtual world in a physical environment.
The world’s largest indoor farm in Japan is 100 times more productive than traditional agriculture.
Cyborg cockroaches might be used for search-and-rescue operations in the future.
Breaking the silence, vegetables in a Japanese supermarket start to talk to the customers.
Using immersive virtual reality and aromatics to make the brain believe we are enjoying a delicious dish.
Dystopian future scenarios filled with evil robots are everywhere. We are afraid of robots treating us badly, but what will happen if it'll be the other way around? According to …
The Bored and Brilliant project asks people to measure their smartphone use take some conscious steps to limit the digital interactions.
Adblock Plus, world’s most popular ad-blocking tool, just announced they are launching an advertising service for “acceptable” ads.
Agriculture today isn’t where it needs to be. Here’s how farmers are taking the next step for better agriculture tomorrow
Fitbit just released a new motivational feature that aims to trigger their users to go out and exercise more.
The entire continent of Australia has shifted and that's a problem for GPS, meteorologists, automated cars and even drones.
New study suggests that the real environmental problem is embodied in the things we buy.
The new Spectacles by Snap Inc. allow you to actually "make memories" (as their slogan claims) while capturing them.
Mark Post is planning to bring lab-grown meat on the market shelves within five years at a reasonable price.
A recent research reveals that the next extra nutritious ingredient may be the liquid produced by cockrach mothers to feed their offsprings. Are you willing to try it?
MIT researchers have developed a system of traffic control that will make traffic lights obsolete.
A road safety campaign in the Australian state of Victoria exposed an educational, yet confronting picture to raise awareness to the vulnerable human body on the road.
In the upcoming episode of Dutch youth education series Denktank (translated think tank) philosopher Stine Jensen and eight teenagers will explore the future of food and try our Bistro In Vitro ice cream.
Disney’s latest attraction? 300 drones flying in formation.
Open Bionics is helping children in need for bionic hands. With Iron Man, Frozen, or Star Wars-themed prosthetics, their fantasies become reality.
The new recyclable, foldable and affordable bike helmet can change city bike sharing for good.
Scientists at Wageningen University, The Netherlands, grew edible crops in Martian soil.
A report on the Empowered by Robots conference during DDW16, demonstrating fruitful collaboration between humans and robots.
This father in China hired some professional gamers to find his son on online games and kill his avatar.
Due to an algorithmic error, Facebook mistakenly "memorialized" vital user accounts with a banner announcing the user’s passing – turning their friend walls into memorial walls.
There is an artificial intelligent robot called ROSS that is taking over the work of thousands of lawyers. Working non-stop, reading faster then any human attorney can do.
The Octobot is the first of its kind made fully of soft materials and is aimed to pave the way towards a more safely interaction with humans.
Urban planners proposed a utopian superhighway for the up-and-coming organic smart city Bao’an.
Tracking your workout can help improve the safety and optimize routes for cyclists and pedestrians in your town.
Researchers are teaching drones to recognize and follow forest trails.
For years scientist and farmers are researching the possibilities of eating duckweed, shoveling it out of the ditches onto our plates. This proteinrich plants can be used in animal fodders or be eaten by humans.
CRISPRy cabbage has been served for the first time in the world.
These birdhouses in Amsterdam share free Internet whenever the air quality improves.
Ground Level Traffic Lights For Smartphone Zombies
The 5th largest airline in the United States, JetBlue, is growing potatoes at John F. Kennedy Airport in New York.
The Hyperloop is a future transportation means that is safer, faster, and cheaper than current forms of mass transit.
The eggplant emoji became a political weapon and gain cult status being the forbidden fruit of the web.
An Australian study has shown the use of lifelike robot babies increased teen pregnancy, rather than discouraging it.
We recently handed this year’s ECO Coin Award to Dutch designer Dave Hakkens, founder of the Precious Plastic movement. With his open sourced recycling machines, he provides people around the world the knowledge to start recycling plastic locally.
Facebook boss Mark Zuckerberg at the Mobile World Congress, in Barcelona.
A floating photovoltaic system will lie on the waters of a Japanese dam, representing the largest solar establishment in the world.
Our Bistro in Vitro Ice Cream Cart took off for the Spring/Summer season in Vondelpark, Amsterdam.
Lunar Insurrection is a group of architects that explores the creative possibilities of the moon as a potential territory for human activity and inhabitation. In Vol.2 , their …
Soon we won’t program computers anymore, we’ll train them like dogs.
On King's Day the water board of Amsterdam wants to collect urine and use it as fertilizer.
Researchers at the John Hopkins University School of Medicine succeeded in hooking up a prosthetic arm to the human brain.
If we'll ever get to go to Mars as tourists , we wouldn't get lost. Ordnance Survey , the official British mapping agency, recently released a new detailed map of the Red Planet. …
Exploring the surface of Mars at least 15 years before a human being in flesh and blood will be able to, this is the new ambitious idea of the people at NASA.
Grown in a laboratory in Wageningen and it is vegetarian too.
Using biology as a model for innovation and progress, Alyssa Stark embodies the essence of Biomimicry.
Meet the firefighter drone, she is the best at extinguishing fires and keep every species safe!
When an autonomous car has to make a decision, will self-interest or the public good predominate?
The Italian government just launched a campaign to raise awareness for falling birthrates and encourage family planning.
$1.3 million will be spent on dispersing clouds over Moscow for the May 1 holiday.
Researchers developed tiny, autonomous robots able to repair circuits.
Come and check out the NANO Supermarket at SAS Software's Forum BeLux 2016 on October 13 in The Egg Brussels!
Cinemas for Millennials will include special sections where texting is allowed.
Next Nature Habitat premiered at VR Days Europe in Amsterdam last weekend.
People with parkinson or other diseases that cause tremors or uncontrable muscular movements, eating is a major challenge. Liftware launches two smart spoons which corrects the unexpected movements of its eaters.
In their pursuit of mapping the physical world online, mapping services simultaneously shape our understanding of it too.
Designer Wataru Kobayashi created a picnic cutlery set to promote eating insects.
The Smell of Data alerts Internet users in any case of data leakage and communicates digital hazards by means of smell.
Why would you stick to an elbow, a wrist and five fingers if you could make anything? This guy got a game-inspired bionic arm.
Yearly 90 million metric tonnes of methane are burped and farted into the atmosphere by cattle with effects on climate change. Researchers are looking for ways to change the cow's diet, feeding it oregano, seaweed and super grass.
Additivism is a movement that calls for radical rethinking of new technologies, such as 3D printing, the plastification of the world and our human position within it.
A Bricklaying Robot builds low-cost houses in just two days.
FarmBot Genesis is humanity's first open-source CNC farming machine designed for at-home automated food production.
By way of reverse engineering and taking heart cells from a rat, researchers at Harvard University have designed a miniature robotic stingray that is alive.
An industrial robot just tattooed the first person ever in San Francisco.
The first time you switch on your self-driving car, punch in your coordinates and cruise off to the soulless thrum of an electric motor you’ve got to wonder: does this thing know what it’s doing?
A driverless convoy of trucks drove through Europe and safely arrived in Rotterdam yesterday.
Sunspring is a Sci-Fi short movie entrirely written by an artificial intelligence.
Special balloons able to catch the rays of the sun from above the clouds, producing clean energy day and night thanks to the help of a fuel cell.
Turkish shepherds are installing solar panels on their donkeys to stay connected.
Amazon's Echo smart speaker may have witnessed a murder. But will it talk?
Will a small step for Ramazzottius Varieornatus be a giant leap for mankind?
Where most researchers are focusing on keeping bees alive, researchers of Harvard are developing a bee replacement; the Robobee. The Robobee is only the size of half a paperclip, with ultra thin wings flapping 120 times per second. The main goal is to build a mechanic pollinator.
Jill Watson has been performing as teaching assistant for 5 months, but she is not a real person, and students didn't notice.
Last week The Hague hosted a festival dedicated to contemporary experiments in music, art and digital culture.
The Bird Sounds experiment, powered by Google Creative lab, is a visualization of thousands of bird songs organized by their similarities.
This art installation turning coke into water raise questions on what, at the end of the day, should be considered 'the real thing'.
Other than decompose and give nutrition to the soil, leaves can be used to store energy, becoming the raw material of batteries.
The elderly may toss their walkers for this robotic suit.
The experimental solar powered airplane Solar Impulse 2 succeeded its record-breaking journey over the Pacific. The Swiss team is now developing the next step of the project: solar drones.
The first uterus transplant in the United States raises the question: could uterus transplants allow men to get pregnant too?
Web 0.0 is sa project by street-artist Biancoshock where web apps are contextualized in real life.
The advent of digital communications media is bringing along some health conditions.
The concept of using our rooftops to produce green, renewable energy for our houses is already very common if we look at solar panels. Now an international team of scientists is …
Severely paralyzed woman controls a tablet with her brain.
The world's first 3D printed office building opens its doors in Dubai, paving the way for the building of the future.
In 16th and 17th centuries, some medical theory believed that a miniature human body can be produced in a flask by an alchemist.
In 1916 the artificial womb made its first appearance on the big screen in the movie "Homunculus" by Otto Rippert.
The term "ecotogenesis" was first coined in 1923 in "Daedalus".
A Swedish woman who had her uterus removed due to cancer in her twenties gave birth to her own child as the world's first person to undergo a uterus transplant. And the donor? Her own mother.
In 2015, a group of scientists from the University of Michigan claimed to have made the world's first artificial placenta.
Meet the commercial 3D pizza printer that takes your order via a smartphone app.
Danish design studio Kilo created an air pollution mask suitable for kids aged six and up.
A San Francisco-based start up discovered a way to "brew" milk that has zero hormones, antibiotics, steroid or lactose inside, and a longer shelf-life.
Animal Meditation uses meditation guiding sounds to to enable user to feel as if he is an animal.
Our peculiar object in these summer weeks is a sculpture by Aram Bartholl, made for the Odyssey expo in Arnsberg.
In year 400BCE in ancient Indian Sanskrit epics, 100 princes were created from a jar of ghee.
Aldous Huxley published Brave New World in 1932, bringing the idea of the artificial uterus to the big audience.
We know how it feels to catch a cold; how might it feel to catch malware?
The AI chef nows more than 10,000 recipes from all over the world and is capable of combining any ingredient while following your personal food preferences.
Chef Watson knows over 10.000 recipes. The highbrow robotic cook invited us over for dinner during the first Neo-Futurist Dinner at Mediamatic.
When life gives you digital lemons, make a virtual lemonade!
Mythology still surrounds us, we just relate to it differently. Games and movies have replaced pantheons and folk tales. Fairies and gnomes left the forests and the rivers and moved to virtual realities.
BladeRanger might have found the ultimate solution for solar panels cleaning putting drones and robots together at work.
The nominations for the ECO coin Award 2017 are now officially open. Let us know who you think deserves to earn the award.
We asked Shubhendu Sharm, our first ECO coin award nominee about his method, business and hopes for the future.
On July 21, 22 and 23 you are invited to join us at Welcome to the Village festival in the Friesland province of The Netherlands for our next iteration of the ECO coin!
In 1955 Emanuel M. Greenberg patented his Illustration of an artificial womb, his invention contains all the apparatus he thought would be required to grow a baby.
Scientists developed a device that converts polluted air into clean air while generating power.
Uber built a fake city called Almono to train self-driving cars. This town is full of fake houses, mannequins and chaotic intersections.
Farming is more than manual labor. The hard part is knowing how to get the best yield. Thankfully, there’s an app for that: growing crops in silico.
German company revealed fastest electric plane.
Offshore renewable energy resources, such as floating solar arrays, have begun to pop up around the world.
Airbus and Italdesign unveil modular urban land and air transport system.
As a focused assembly worker, you are a real go-getter thanks to your smart tools. Wearing smart factory goggles and using a transparent LED screen, these give you direct …
What the Internet would look like if all data were ephemeral?
Researchers from Arizona and NASA unveiled a plan to sustainably provide food in space, growing it in an inflatable greenhouse.
Norwegian researchers have succeeded to grow nori under laboratory conditions for the first time.
Scientists developed a procedure to repair your heart with a spinach leaf.
A horse can run faster than a human, yet nobody claims horses will make mankind dispensable. When a man rides a horse and the two work together, something new happens. Then, what …
A job from HUBOT: as an exoskeleton mover, you wear a motorized exoskeleton suit that gives you the muscular power of a gorilla.
The home healthcare professional is one of the 16 positions from HUBOT, the job agency for people and robots.
The robots are coming! They’re getting smarter, cheaper and more reliable. How long will I have my job before a robot steals it? The industrial revolution made muscular power …
As air traffic security you make sure that birds stay away from the airport using your eagle drone. With an accessory console, you fly the quadcopter from the sideline to scare …
A visual impairment does not have to be confining and futile when it comes to traffic control. As a blind traffic regulator, you wear a haptic suit that translates the traffic …
As a data waiter you are working at the Tinder restaurant. Upon arrival, visitors log in with their social media account. An intelligent algorithm matches the guests based on …
Games are often played to escape a boring daily reality, but they can also teach us to take control over the land as farmers do. As a farm director you work in a gamified …
Don’t worry, a handyman doesn’t have to be a bookworm. You rather work with your hands than sitting in the library. And yet, you often need to read the manuals of the broken …
Tokyo restaurant offers sustainable new dish - ramen noodles topped with crunchy insects and people love it
Meet Josh Tetrick, entrepreneur who wants to reinvent the food industry and plans to launch lab-grown meat on the market by the end of 2018.
We need to talk about the future of meat! Watch Next Nature Network director Koert van Mensvoort's TED talk on Meat the Future.
Scientists have found a way to bring back the lost flavor of tomatoes.
Craftsmanship is generally very appreciated, but it takes a lot of time to master a craft. Therefore, as a robot coach you train - you guessed it, a robot - to transfer your …
Nomophobia, no-mobile-phobia, is the fear of being separated from your smartphone.
With the rise of modernity, we have domesticated ourselves with new technology: discover how the world spends one minute on the Internet.
The robots have arrived! Yesterday we celebrated the launch of HUBOT , job agency for people and robots at MediaMarkt , as part of the Dutch Design Week in Eindhoven. Our virtual …
As an organ designer, you develop genetic algorithms from which organs are grown to perfectly fit the recipient’s body, but also to meet the personal wishes of the patient.
Pic2Recipe is an artificial intelligence system able to recognize ingredients, identify a dish and suggest recipes from a single image.
What if you could have the taste of a juicy, sizzling burger without the destructive impact of using animals for meat? That is what Impossible Foods wants to do with its new burger.
POP is an all-in-one solar energy system that hold visible benefits for humans.
The Punishment is an installation featuring a robotic arm that mimics a kid's handwriting perfectly, and repetitively writes "I must not hurt humans".
A Russian construction firm prints houses in 24 hours on site with their mobile 3D printer.
The Dutch province Gelderland-South uses two educational robots to increase kids' knowledge on such a technology.
A gadget called HumanCharger promises "the sun in your pocket" to give you energy, by beaming light through your ears.
Rent a rain room with simulated rain with a motion sensor to go through the rain without getting wet.
The first robotic officer will soon report for duty in Dubai.
This is post number five of our serie 'Robots at Work'. In this last episode we present you five jobs for the extraordinary, the ones who won't let themselves be categorized.
Passenger-carrying drones will hit the skies in Dubai this summer.
The Brazilian model Paola Antonini uses her Instagram to show off her prosthetic limb.
You did not make it to the Idols final, but you can sing very well and you love to make people happy. As a singing package deliverer, you deliver packages with a personal song. …
What if we rethink the system and instead of building from earth to sky, we do it the other way around?
This seven-minute video, titled 'Slaughterbots', shows a future in which palm-sized autonomous drones commit untraceable massacres.
The sun sustains our planetary system. Its energy fuels life. And in the future, the sun will also fuel our cars. That’s the premise of Dutch startup Lightyear, a startup specialized in solar powered electric cars.
A study shows that screen time for kids between six months and two years triggers expressive speech delay.
Dutch commercial telecom provider Ben recently launched an advertising campaign to sell smartphone plans by promoting disconnection.
Eco-friendly lasers might soon replace stick-on labels on fruits and veggies.
What if we could redesign the system to work for humanity and the planet we call home? What would the economy of ecology look like?
The Stedelijk Museum has added The In Vitro Meat Cookbook to its public art collection, turning the book into a piece of art!
The Apenheul primate park in Apeldoorn, the Netherlands, has launched a four-year experiment to study how the primates make their mating choices.
Toilet paper for smartphones now on offer at Japanese airport.
MIT Media Lab developed pasta programmed on a computer.
Scientists sent mango embryos to space lab in order to let them develop new genetic traits.
How do trees feel? A team of scientists have developed a network of twittering trees to monitor their feelings and raise awareness over climate change.
Drone made to rescue in bad weather condition in open waters.
Introducing nanobionic spinach plants that can detect explosives.
A rosy-cheeked kid learns her first words, cries when her babysitter leaves, smiles when she’s happy, but she’s not real. BabyX is an AI research-in-progress by a company named Soul Machines.
Discover the Next Nature Habitat VR and explore four future environments we might live in someday.
Have you already visited our Meat the Future exhibition? Consider this three course meal an introduction to what you may expect.
Memphis Meats reveals world’s first lab-grown chicken.
In various parts of the world, access to education is, or risks becoming, a huge crisis. UNESCO estimates that around 20 million new teachers are needed worldwide - and that's not …
The debate on the future of artificial biological reproduction is moving to Mexico. C Minds, an impact innovation agency that believes in ‘a 4th Industrial Revolution that brings …
Calling all bloggers! We’d love to have you on board for the 2018 Border Sessions festival in The Hague (NL). Join our team for behind-the-scenes access to festival events. To …
To some extent, it's a chicken-and-egg question: Are you unable to think about things you don't have words for, or do you lack words for them because you don't think about them? …
It’s clear that driverless cars will revolutionize the way we get from Point A to Point B. Perhaps less obvious is how it’ll change our sex lives. According to a new study by the …
Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
On January 17 1803, a young man named George Forster was hanged for murder at Newgate prison in London. After his execution, as often happened, his body was carried ceremoniously …
FrenchDreamTowers is an eco-friendly high-rise complex imagined by Paris-based architect studio XTU , for the city of Hangzhou in Southern China. Currently under study, the …
As a cybercrime detective, you search for suspicious patterns that indicate crime in the digital domain.
While many people consider a rollator as a sign of decay, you as a rollator inspector are just part of the headway! The walker inspector measures air quality, particulate matter …
Bricklayer, a physically heavy occupation, becomes a lot more bearable with the street-knitting robot. The street knitter is a job from HUBOT.
Under the title Human Nature, designing the equilibrium, eleven designers will answer questions about a future in which Humankind and Nature enter into a new relationship. An …
To all in vitro meat optimists, hear hear! In May 2018 we launched the petition ' In vitro meat is here. Let us taste it. ' We proudly announce that this petition led to …
People across the world have been eating insects for thousands of years. We know that approximately 2,000 species are edible and that these insects are eaten in many different …
In 2017, two years after her father died , Ira van Eelen decided to call the Dutch Arable Farming Union. She couldn't help but wonder how come the Netherlands was still not …
Writing is recognised as one of mankind’s foremost inventions and the mechanization of writing is one of these developments that typify what is commonly regarded as the work of …
Previously we predicted that we would be eating in vitro meat by 2028. But as it turns out... In vitro meat is already here! And we are not allowed to eat it. The meat has been …
Not only does this phone case conceal your engagement ring in preparation for the big moment, but it’ll then take a video of your partner as you go down on one knee.
Rayfish Footwear was a fictional company that offered personalized sneakers crafted from genetically modified stingray leather. This online science fiction story allowed customers …
This year we are proud to announce that, with her ambitious work within the field of bioluminescence for Glowee, Sandra Rey is the ECO Coin Award 2017 winner.
Well, we finally made it. After a long, cold, dark winter, spring has officially started today. And guess what it's bringing with it? Nope, not spring flowers: Love flowers! …
Tonight, Studio Drift is launching their debut museum solo exhibition at the Stedelijk Museum in Amsterdam: Coded Nature . As NNN Fellows , this Dutch duo is showcasing a …
The Ocean Cleanup claims its device could cut the size of the Great Pacific Garbage Patch in half in five years.
Would you like a dog snout, cat eyes or fluffy bunny ears? The choice is yours. Virtual selfie filters have become a widespread phenomenon on social media platforms such as …
Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …
Submarines feature a special device called a periscope that allows people inside the submarine to see what's going on above water. Controlling such an eye requires hours of …
A team of researchers from Tel-Aviv University developed a neural network capable of reading a recipe and generating an image of what the finished, cooked product would look like. …
Not only is air pollution bad for our lungs and heart , it turns out it could actually be making us less intelligent, too. A recent study found that in elderly people living in …
Earth’s oceans have seen better days. They’re inundated with plastic waste, both whole single-use plastics and tons of plastic microparticles that find their way back into our …
In response to the nitrogen crisis, the Dutch cabinet is planning to reduce the speed limit during the day to 100 kph. In itself a sensible decision. But it is strange that this …
Lining up plans for Dutch Design Week ? Once more, 2600 designers gather in over 120 locations during 450 events. So whether you're a local, new in town, or just passing through, …
The way people get around is starting to change, and as a professor of transport strategy I do rather wonder if the modes of transport we use today will still be around by the …
What will you be having for breakfast, lunch or dinner in 2050? Where will this food be sourced? And how will it be prepared? Edible insects? A hamburger made from cultured meat? …
Welcome to the conversation! Every week, we’ll open up a new conversation among members of the network about next nature topics we've encountered around the globe. We hope …
Look around you and try to find the most natural thing in the room you are in now. It is you. But for how long? Welcome to the wonderful world of bio design ; a world full of …
Rooftops covered with grass, vegetable gardens and lush foliage are now a common sight in many cities around the world. More and more private companies and city authorities are …
Around the world thousands of people are on organ donor waiting lists. While some of those people will receive the organ transplants they need in time, the sad reality is that …
In configuring our next nature, artists and scientists explore new languages that move beyond the Anthropocene - the era of human beings. These semantics would bridge the gap …
Delve into the science and fiction of robots at V&A Dundee’s latest exhibition: Hello, Robot . Contemplate the existence of robots and how they have both shaped, and been …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …
Summer is here and the sun is out, and yes, this is awesome. After a long day in the sizzling summer sun, you get a group of people together to share some delicious food, …
There has been a surge in awareness of the damage that plastic pollution does to our planet in recent years. It has spurred a number of campaigns to remove single-use plastics …
Ibis, A popular European hotel chain, just introduced the world to the “social media sitter.” It’s the answer to a problem few knew existed, and even fewer though we needed …
Berlin is kicking off its cultural season with the not-to-miss 23th installment of Transmediale . This year the digital art/culture festival focuses on how feelings are made into …
In anticipation of the forthcoming Next Nature Magazine, we call upon you, dearest creatives, to submit a fictitious editorial advertisement: The Infotizement. The infotizement is …
Humanity has an insatiable hunger for meat. Since 2013 we have been researching, developing and campaigning for a humane and eco-friendly way to get our protein fix. Since day one …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here? Get in touch …
The Singapore Food Agency has approved “chicken bites” containing meat made from real chicken cells that were grown outside of a chicken’s body. Alongside similar news from Israel …
At just a millimeter wide, Xenobots are “neither a traditional robot nor a known species of animal", they are "a new class of artifact: a living, programmable organism”, says …
Dinner for two, please! Well we didn't expect to say that in a while. Luckily our friends at Mediamatic are working on an innovative solution. Their 'Serres Séparées' dinner dates …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here? Get in touch and …
During these challenging times, we have tried to find happy moments together where we could find them. From weekly Zoom lunches to having online wine tastings, still, it doesn't …
"Absence makes the heart grow fonder" is a common phrase people associate with romance that has been forced apart by distance. But for long-distance couples (as many of us can …
Current social distancing measures are all about keeping a physical distance from each other in order to flatten the curve. But this does not mean we have to keep a distance from …
' Team Human ' is a manifesto—a fiery distillation of media theorist Douglas Rushkoff’s most urgent thoughts on civilization and human nature. In one hundred lean and incisive …
Our deficiencies have always driven us, even among our distant ancestors, back in the last Ice Age. Having neither the speed and strength to hunt large prey, nor sharp teeth and …
At first glance, the premise of the film 'The Iron Giant' (1999) seems to be a total failure. An animation film set in the United States in 1957; while the Russian satellite …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Today we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …
We live in turbulent times. Thanks to science and technology, we are able to perceive our environment down to the atomic level. We can read DNA, manipulate cells, cut and paste …
Play is a core part of a healthy childhood , through which children develop social, communication, cognitive and physical skills. Children’s play adapts to its circumstances. …
In conversation with Canadian researcher Suzanne Simard, inventor of the Wood Wide Web.
Although it’s seductive to think of human beings as the dominant species on earth, many others play important roles too. Bacteria, insects, algae colonies, rocks and the …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
'Big History' is a multidisciplinary study that seeks to put the human story into the context of a 13.8 billion-year story from the Big Bang to now.
While aviation accounts for 2.4% of all emissions from fossil fuel use globally, two-thirds of the sector’s warming effect depends on something other than its CO₂ emissions. And …
In the past few years, scientists have hatched some pretty crazy-sounding schemes in the name of protecting Earth and its inhabitants. From building an underwater wall 120 …
The rapid technological advancement of the human race has led to many consequences, especially regarding the integrity of the atmosphere that protects all life on Earth. Although …
Dig a teaspoon into your nearest clump of soil, and what you’ll emerge with will contain more microorganisms than there are people on Earth. We know this from lab studies that …
While Elon Musk may be trying to initiate efforts to colonize Mars, scientists on Earth are attempting to build an accurate digital twin of the planet to simulate in the future. …
The skies in Beijing turned orange recently, thanks to what was widely reported as a massive sandstorm . The problem, at least in terms of public health, is that it was not …
At the bottom of the Earth’s oceans lies an intricate network of over a million kilometres of fibre optic cables. These cables were laid on the seabed by telecommunication …
Imagine you’re in a hot air balloon flying over an African savanna in the late growing season. Below, herds of elephants, zebras, wildebeests and rhinos roam a mosaic landscape …
The deepest regions of the oceans still remain one of the least explored areas on Earth, despite their considerable scientific interest and the richness of lifeforms inhabiting …
Humans often claim to be at the top of the food chain, but is that really the case? We are experiencing – now more than ever – our own fragility: an increase in natural disasters, …
Travel to big future in our VR timemachine at the Evoluon in Eindhoven
Now here's a perspective: a pooping cow is like a living 3D printer
Dune offers a useful allegorical narrative of the “scramble for Africa”, which saw European empires carve up the continent into colonized powers.
Lately it seems that every movie, book and video game we see is about future apocalypses. Science articles are also painting a grim future for Earth and its inhabitants. If it’s …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Utopianism and dystopianism are themes often found in today’s movies, especially considering the increased awareness of the damage done to the Earth by human activities. Often …
Don’t get fooled by the colourful, unsuspecting demeanour and size of the mantis shrimp. Known as “death incarnate” to its prey on the seafloor, the crustacean hides two …
Did you know that we owe every second breath we take to the algae in the sea? And that minerals have been absorbing CO2 for billions of years while converting it into important …
As winter arrives, so does the season of giving. Good gift giving is an art and can be quite the endeavor at times. But don’t worry, Next Nature is here to help! We present to you …
Every piece of plastic that’s ever made, still exists. It results in a floating garbage dump in the ocean, full of life. While this (geo)design was never intentional, humans …
Soon it will be possible to grow flowers with your phone. Niantic and Nintendo joined forces to create a new mobile game connected to the Pikmin franchise. In this augmented …
If we are to build a greener, fairer and more equal society in the wake of COVID-19, it’s time for rich countries to end their practice of dumping plastic waste in developing …
Is it possible to imagine other earthly stories? Can we conceive of other ways of living among different species? This exhibition explores these issues with the help of a …
Global warming is a big challenge for warm-blooded animals, which must maintain a constant internal body temperature. As anyone who’s experienced heatstroke can tell you, our …
Memories are often considered very personal and private. Yet, in the past few years, people have got used to notifications from social media or phone galleries telling them they …
Can we create a new biosphere on another planet? Documentary "Spaceship Earth" shows how - in the Arizona desert.
For multispecies feminist theorist Donna J. Haraway, “it matters what stories make worlds, what worlds make stories.” She studies the current age as the Chthulucene (chthon, …
A living lamp that you need to feed, a tapestry made of animal waste streams and tableware made from algae. Welcome to the wonderful world of biodesign.
A lot of the ground we live on is polluted. More than a third of our soils are moderately or heavily degraded; heavy metals such as lead are increasingly found in urban soils, …
The times where memes were geeky and funny, somewhat disturbing images have been over for years. Even a simple frog such as Pepe is not innocent anymore. Memes were hijacked by …
Humans have been changing the composition of the atmosphere for years, resulting in concerns such as air pollution and extreme climate events. According to Filips Stanislavskis , …
Tiny houses have been heralded as a radical and creative way to address a lack of affordable housing, as well as reducing living costs and shrinking our carbon footprint. My PhD …
Phytoplankton are microscopic algae living throughout the ocean’s surface waters. They can’t swim and are at the mercy of the currents and tides. Despite their small size, …
Art not for people, but for insects. That is the goal of the Pollinator Pathway project by Alexandra Daisy Ginsberg. With her concept she wants to change the way we perceive our …
If you were to stack up all the electronic waste produced annually around the world it would weigh as much as all the commercial aircrafts ever produced, or 5,000 Eiffel towers. …
Most people think of mammoths as the iconic woolly species from the last Ice Age, which ended around 12,000 years ago. But mammoths originated in Africa around 5 million years …
Architect Rachel Armstrong establishes an alternative approach to sustainability. Through a close reading of computational properties of the natural world, Armstrong develops a …
As humans have industrialised farming to feed a growing global population, pollinators – animals vital for plant reproduction – have seen their food supply decline. In the UK, …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch: magazine@nextnature.net. …
Sofia Crespo and Feileacan McCormick have made an AI-generated endangered species installation on Times Square.
The ‘Beneath the Surface’ exhibition organized by Taiwan Designers’ Web at the Chiayi Art Museum teaches us about unconventional connections, past and future.
Next time you are taking a walk to work, have a look around you. You will probably notice that most of your fellow pedestrians are glued to their phones, rather than enjoying the …
The three winners of the Bio, Art & Design (BAD) awards have been announced.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Using the waste streams from the chemical industry and urine to make biocement.
Scientists have discovered the effect of sunscreen on corals. We need to understand our impact on the world to understand its problems.
Benedikt Peirotén has started a project called ‘From the Ashes’ proposing using waste streams to replace the energy-intensive ingredients in glass.
Some 10,000 years ago humans began to domesticate plants and animals. The birth of agriculture, one of the earliest technologies available.
Spoiler alert: this article explains a key plot point, but we don’t give away anything you won’t see in trailers. At the beginning of the new Disney Pixar film, Lightyear, Buzz …
Regeneration of extinct flavor families via microalgae
Imagine driving along in your car, powered by the same solar energy that nourishes the landscapes around it. Lightyear 0 is the world's first solar powered car, charging itself …
The Earth BioGenome Project is aiming to create a database of genomes of all organic life on earth within 10 years.
What if we can use tattoos to measure the concentration of certain components in your blood? Scientists developed a film that can detect the amount of oxygen.
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
The most wonderful time of the year can turn stressful quite easily when you run out of exciting gift-ideas. Don't worry, we got you covered.
Hello upcoming bio artists and designers! We invite designers and artists interested in bio art & design to propose projects for collaborative work across disciplines. The Bio …
So you missed your flight to the Big Future? Or do you have withdrawal symptoms from your previous trip? Not to worry, we have news for you. Schedule a new flight from 12 March—1 …
What is the meaning of art on the moon? Artist on the Moon is the latest project from Icelandic visual artist Borghildur Indriðadóttir , who aims to perform for the stars and …
The commercial race to get tourists to space is heating up between Virgin Group founder Sir Richard Branson and former Amazon CEO Jeff Bezos. On Sunday 11 July, Branson ascended …
Thijs Biersteker has designed an art installation that shows the carbon dioxide emission of the internet.
There seems to be a green shift happening in Dutch Design, where the traditional vision is slowly sprouting into a newer, more refreshing one. The biodesigners are emerging from …
What if living objects could re-connect humans with their menstrual cycle and change the way we perceive it?
This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your …
Living Carbon enhances natural traits in plants as a solution for stabilizing the climate by increasing the efficiency of the photosynthesis process.
Most radiation is natural and life on Earth wouldn’t be possible without it.
Demand for life-saving organ transplantation is at an all-time high. In 2021, a record 41,000-plus organ transplants were performed in the U.S., with top numbers for kidney, liver …
AI sure knows how to throw a banger of a dinner party. One that guests will never forget - or outlive. When New Zealand grocery store chain PAK’nSAVE introduced their new …
In 1912, the RMS Titanic met a fateful demise as it crashed into the depths of the North Atlantic Ocean, leaving a mark on the world's collective memory, and igniting a lasting …
Fishfarming , or aquaculture has been the fastest growing food-sector for decades. This is nothing to be surprised about: fishing as a practice has been in existence since the …
AI language model ChatGPT has hit the mainstream last year when it became widely accessible to everyone. Next to doing our (home)work, it became also a D&D Dungeon Master , …
In the evolving scenery of self-driving taxis in San Francisco, passengers are getting frisky in the backseat of driverless taxis.
A floating sustainable city where humans can live, work and study while supporting aquatic ecosystems. Soon this will become a reality in Dubai, as sustainable real estate company …
There is a banana crisis happening right now. Our beloved yellow fruits are being threatened with extinction due to a fungal infection called Panama disease, which can wipe out …
Danish fashion brand Ganni proposed a post-leather future: they grew imitation leather with bacteria.
Nowadays mechanical intelligence is often chosen over that of our own human capabilities. But there was a time where our computers were still not always a match against our own …
William Eliot designs chairs while collaborating with mealworms.
Cleaning up ships' pollution is making the ocean warmer than expected. Less pollution means less cooling clouds, heating up the Atlantic.
Paco Rabanne already positioned himself as a cutting-edge designer by establishing his reputation as one of the trailblazers during the space age movement of the 1960s. With his …
Imagine helping nature restore itself simply by going for a run. In a fusion of fashion and conservation, London-based designer Kiki Grammatopoulos has introduced her concept …
Sunshine, cocktails, and the lap of luxury; a yacht usually doesn’t seem to symbolize sustainability or charity. But this one might save the ocean.
Lo and behold the new Lotus Eletre Hyper SUV car. It shouldn't be allowed to exist, yet you may meet it in traffic soon.
As the world is trying to keep carbon emissions under control, humans are also looking for viable carbon-neutral transportation options. The people from French rolling stock …
Designer Arianna Pezzano creates prosthetic nipples using keratine coming from the hair that cancer patients lose during chemotherapy.
Your biggest wealth is health, but what it the costs you your anonymity? This vending machine gives you nutritional advice based on the information you give it.
The ancient Egyptians and Greeks saw water as the source of life, the "origin of everything". Today that role is reserved for money.
In a ground-breaking discovery, researchers at the University of Pennsylvania have achieved to produce insulin out of lettuce. There's no need for needles and injections anymore, …
Reduce, reuse, recycle. We know the drill. But how do we cope with a junkyard in space?
In the 1970s, NASA and the ASI launched a giant disco ball into space. Its purpose? Teaching the humans of today and the civilizations of tomorrow about Earth.
Researchers hope that 3D-printed, biodegradable mussel reefs help the growth of mussel banks.
Thanks to the European Space Agency (ESA) and a team of enthusiastic researchers from the University of Thessaloniki we now know for certain: we can fry potatoes in space. …
Get ready to take your dining experience to literal new heights, soon we are able to enjoy high cuisine at the edge of space. French company Zephalto is introducing extravagant …
What if we could clean our water with magnets? Wageningen University & Research, introduces the Magnetic Adsorption-Desorption (MAD) project.
As sea levels climb, coastal communities brace for floods and erosion. Artist Allie Wist asked herself: what will we eat in a flood-filled future?
A team of researchers are currently investigating the fusion of human brain cells with artificial intelligence. Creepy or innovative?
Bye-bye gym membership, hello losing pounds. Scientists have found a new drug that helped obese mice lose weight.
Luke Talbot has developed a solution to assist people experiencing homelessness in charging their phones for free by hacking rental bicycles.
Heartsync is an interactive art installation crafted by artist Nino Basilashvili that syncs up your heartbeat with others.
Eddie Corwin studies beaver dams and ponds from satellite images in order to restore watercourses and wetlands, and establish nature reserves.
What if we would use the idea of symbiosis as the basis for the next period of Earth’s history?
As the year is coming to a close, many of us are preparing our homes and dinner tables for a festive meal.
The annual Bio Art & Design (BAD) Award encourages new artists and designers to explore the world of bio art and design. Let's have a look at the three winning projects of this year.
Seven examples of how design will help us built the farm of tomorrow.
Sushi designed in Japan, printed in Texas. This might sound like a wild dream, but actually became a reality during interactive media festival South by Southwest (SXSW) that took …
Technology can help us to connect with our surroundings. Think about the microscope: it revealed ecosystems beyond our visual reach allowing us to look at the smallest inhabitants …
In conversation with film director Joshua Ashish Dawson about the future of wellness, climate anxiety and healthy cynicism India-born, Los Angeles-based film director Joshua …