Search results for Human Planet

Visual of Talking non-human nonsense with Nonhuman Nonsense

Talking non-human nonsense with Nonhuman Nonsense

Nonhuman Nonsense is a research-driven design and art studio existing somewhere between utopia and dystopia. They wonder upon our relationship with the non-human, embracing …

Visual of I'm not a robot: AI better at proving to be human than humans

I'm not a robot: AI better at proving to be human than humans

Researchers at the University of California discovered that bots now excel at solving CAPTCHAs faster and more accurately than humans.

Visual of Video Game-Playing Robot Acts More

Video Game-Playing Robot Acts More "Human" than Humans

Computer-controlled players in video games can usually be spotted for their repetitive, illogical or unemotional behavior. Unlike humans, non-player characters (NPCs) don't get …

Visual of Team Human is a manifesto for humankind

Team Human is a manifesto for humankind

' Team Human ' is a manifesto—a fiery distillation of media theorist Douglas Rushkoff’s most urgent thoughts on civilization and human nature. In one hundred lean and incisive …

Visual of Humane Technology #4: Resonate with human senses

Humane Technology #4: Resonate with human senses

Principle number four: Humane technology should resonate with the human senses, rather than numbing them. If you're an office worker or a video game fanatic , you may spend most …

Visual of Humans Caused Mass Extinctions Before There Were Even Humans

Humans Caused Mass Extinctions Before There Were Even Humans

Humans and other hominids have a reputation for bringing about mass extinctions. Homo erectus  has been blamed for the disappearance of many African carnivores, our ancestors …

Visual of To Be Human Is To Be Transhuman

To Be Human Is To Be Transhuman

Buckle up for a new video from our favorite performance philosopher Jason Silva: To Be Human Is To Be Transhuman.

Visual of Earth is so strongly impacted by its human inhabitants that it's now a “hybrid planet”

Earth is so strongly impacted by its human inhabitants that it's now a “hybrid planet”

Humanity has for a long time considered itself the most important species on the planet. We are quite happy to share the world with other species, but we think we know who's in …

Visual of Letter to Humanity

Letter to Humanity

NNN director Koert van Mensvoort writes a letter to humanity.

Visual of NASA's 'Human Computers' helped land the first human on the moon

NASA's 'Human Computers' helped land the first human on the moon

Nowadays mechanical intelligence is often chosen over that of our own human capabilities. But there was a time where our computers were still not always a match against our own …

Visual of Humane Technology #6: Improve the Human Condition

Humane Technology #6: Improve the Human Condition

And now for the sixth and final principle: Humane technology improves the human condition and helps people realize the dreams they have of themselves. No matter what your …

Visual of AI meal planner suggests humans to cook with human flesh and bleach

AI meal planner suggests humans to cook with human flesh and bleach

AI sure knows how to throw a banger of a dinner party. One that guests will never forget - or outlive. When New Zealand grocery store chain PAK’nSAVE introduced their new …

Visual of Humane Technology #2: Revive Human Intuitions

Humane Technology #2: Revive Human Intuitions

Our second principle: Humane technology revives human intuitions, in particular those we might have forgotten about. 'Conventional' technology aims to overcome our hominid …

Visual of Humane Technology #3: Take Human Values as a Cornerstone

Humane Technology #3: Take Human Values as a Cornerstone

The third principle of humane technology: It should take human values as a cornerstone of its development. Technology doesn't have to be expensive or electronic to be humane. …

Visual of Why superhuman technologies will affect us all

Why superhuman technologies will affect us all

When you look through a super-telescope, you can still see the planet Earth. Once called the blue planet, she now looks red and parched. We had no choice but to abandon her… On a …

Visual of Why human enhancement requires technological citizenship

Why human enhancement requires technological citizenship

New technologies – from artificial intelligence to synthetic biology – are set to alter the world, the human condition, and our very being in ways that are hard to imagine. The …

Visual of Can technology be humane?

Can technology be humane?

We must be mindful about how we engage with technology: what we use it for, why, and whether it helps us or hinders us. Sometimes our tech seems to be flowing in inhumane …

Visual of Human-animal hybrids could be used for growing organs

Human-animal hybrids could be used for growing organs

Around the world thousands of people are on organ donor waiting lists. While some of those people will receive the organ transplants they need in time, the sad reality is that …

Visual of On inhumane technology

On inhumane technology

Stick-on shoes, wakeup lights, bionic limbs: these are examples of humane technology. But what exactly does this mean? It can best be explained in contrast with its opposite. …

Visual of The six principles of humane technology

The six principles of humane technology

We must be mindful about how we engage with technology: what we use it for, why, and whether it helps or hinders us. Sometimes our tech seems to be flowing in inhumane directions, …

Visual of Next Generation: Moving towards the plastic human with Max Ahluwalia

Next Generation: Moving towards the plastic human with Max Ahluwalia

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of A path to humane technology

A path to humane technology

In 1486, six years before Columbus dropped anchor in the New World, the 23-year-old Italian nobleman Giovanni Pico della Mirandola penned a passionate discourse on the unique …

Visual of Sonograms of planet earth

Sonograms of planet earth

Technology can help us to connect with our surroundings. Think about the microscope: it revealed ecosystems beyond our visual reach allowing us to look at the smallest inhabitants …

Visual of Discussing non-human centered design with Kelvin Godee and Simon Wijrdeman

Discussing non-human centered design with Kelvin Godee and Simon Wijrdeman

What if design began to put everything but the human first? The needs of the human not paramount to the design process, but instead the other entities that we cohabit planet earth …

Visual of Humans could recolonize Earth after mass extinctions with ectogenesis

Humans could recolonize Earth after mass extinctions with ectogenesis

Lately it seems that every movie, book and video game we see is about future apocalypses. Science articles are also painting a grim future for Earth and its inhabitants. If it’s …

Visual of This machine makes human clouds

This machine makes human clouds

Humans have been changing the composition of the atmosphere for years, resulting in concerns such as air pollution and extreme climate events. According to Filips Stanislavskis , …

Visual of The Ecological Human

The Ecological Human

The nature of humanity in the twenty-first century is, according to sociologist Steve Fuller, a ‘bipolar disorder’ beset with dualisms of identification such as divine/animal, …

Visual of The No(nhuman) Consent Form

The No(nhuman) Consent Form

There seems to be a green shift happening in Dutch Design, where the traditional vision is slowly sprouting into a newer, more refreshing one. The biodesigners are emerging from …

Visual of Meet Humanity beyond Race, it's Beautiful

Meet Humanity beyond Race, it's Beautiful

Meet Humanity beyond Race, it's Beautiful

Visual of Fly like a Bird? Get Human Birdwings

Fly like a Bird? Get Human Birdwings

Dutch mechanical-engineer Jarnos Smeets dreams of flying like bird. Nothing new really, many people have had this dream for ages. Yet being an engineer and all, Jarnos is seriously propelling his dream towards a reality.

Visual of This exhibition investigates how humans will live tomorrow

This exhibition investigates how humans will live tomorrow

Occupying the 52nd floor of Tokyo’s Mori Tower, Mori Art Museum is internationally renowned for its visionary approach and highly original curation of contemporary art. The …

Visual of Ectogenesis, Artificial Womb, Human Egg?

Ectogenesis, Artificial Womb, Human Egg?

The artificial womb is on the verge of becoming a reality, but how it will affect our culture is for us to decide.

Visual of 3 exhibitions that explore the relationship between humans and the environment

3 exhibitions that explore the relationship between humans and the environment

As we go about our daily activities, we may lose sight of our connections with nonhuman life. Here are three exhibitions to encourage you to step outside of your everyday and …

Visual of Humans Are the Sex Organs of Technology

Humans Are the Sex Organs of Technology

Written by Kevin Kelly , published in The Technium .  I claim that technology has its own agenda. What is the evidence that technology as a whole, or the technium as I call it, is …

Visual of Knitting sweaters from human hair

Knitting sweaters from human hair

The textile industry is the second largest polluter in the world that leads to a chain reaction of nasty results: loss of biodiversity, water pollution and soil erosion are just a …

Visual of An MRI of Planet Earth

An MRI of Planet Earth

Heartbeat of the Earth aims to make the climate change crisis more relatable and visually striking to spark public reactions and attention.

Visual of Did Monogamy Make Us Human?

Did Monogamy Make Us Human?

Pair-bonding sets humans apart from our relatives. But where did it come from?

Visual of OUT NOW: Save the Humans! Book

OUT NOW: Save the Humans! Book

The SAVE THE HUMANS! book is now available on our web shop.

Visual of Glowing Planet T-Shirt

Glowing Planet T-Shirt

Featuring different cities at night, the Next Nature Glowing Planet T-shirt highlights the enchanting beauty of our glimmering world.

Visual of Longest Lived Human Embryo in a Lab

Longest Lived Human Embryo in a Lab

Scientists keeping a human embryo alive in lab for 13 days for the first time.

Visual of Merging AI with human brain cells

Merging AI with human brain cells

A team of researchers are currently investigating the fusion of human brain cells with artificial intelligence. Creepy or innovative?

Visual of The Anthropocene Debate: Marking Humanity’s Impact

The Anthropocene Debate: Marking Humanity’s Impact

  Is human activity altering the planet on a scale comparable to major geological events of the past? Scientists are now considering whether to officially designate a new …

Visual of Neither Warfare nor Dumplings Are Innate to Human Nature

Neither Warfare nor Dumplings Are Innate to Human Nature

In Ngogo, Gombe and elsewhere in Africa, bands of male chimpanzees regularly make organized raids on neighboring troops and batter their enemies to death. These grim, warring …

Visual of The Non-Human Noosphere

The Non-Human Noosphere

The definition of the noosphere as "the sphere of human thought on earth" is woefully anthropocentric. It ignores that fact that our fellow sentient organisms have noospheres of …

Visual of The Posthuman Farm

The Posthuman Farm

Wu Tzu-ning presents a posthuman reality from genetic engineering to digital afterlife.

Visual of We Feel Empathy for Robots (Even if They Don't Look Human)

We Feel Empathy for Robots (Even if They Don't Look Human)

Human test subjects felt empathy for dinosaur robots being cuddled or abused.

Visual of 2016 - Human Embryo Lives 13 Days in Lab

2016 - Human Embryo Lives 13 Days in Lab

In 2016 a team of biologists has successfully kept a human embryo alive in the lab for 13 days, breaking the previous record of nine days.

Visual of Human Nature Forecast

Human Nature Forecast

Interview witth TEDx on how people are technological by nature, yet how we also need humane technology to remain human, or become even more human than we are today.

Visual of Plastic Planet

Plastic Planet

We tend to think of plastic as a cheap, inferior and ugly material used to make children’s toys, garden furniture and throwaway bottles. But as an experiment, imagine for a moment …

Visual of Meat-Eating Made Us Humans

Meat-Eating Made Us Humans

Eating meat has made us who we are today: evolved, intelligent humans, able to use a verbal language.

Visual of Letter to Humanity in 25 Languages, Plus One!

Letter to Humanity in 25 Languages, Plus One!

Read the Letter to Humanity in Morse Code.

Visual of Van Mensvoort Writes a Letter to Humanity

Van Mensvoort Writes a Letter to Humanity

On the occasion of the Earth Day, 22 April 2017, philosopher Koert van Mensvoort wrote his Letter to Humanity.

Visual of Humans to Blame for Global Warming

Humans to Blame for Global Warming

Global warming is "very likely" a human-caused problem that will last for centuries and require concerted international action to reduce its potentially devastating impacts, a …

Visual of Save The Humans – Submit your Quote

Save The Humans – Submit your Quote

We call upon you, dear readers, to participate in a new publication from the Next Nature Network: SAVE THE HUMANS!.

Visual of Study finds humans still evolving and quickly

Study finds humans still evolving and quickly

By Karen Kaplan, Los Angeles Times , December 11, 2007 The pace of human evolution has been increasing at a stunning rate since our ancestors began spreading through Europe, Asia …

Visual of Animals Give Leadership Lesson to Humans

Animals Give Leadership Lesson to Humans

What are the characteristics of the perfect leader? The answer could be found looking at nature.

Visual of Save The Humans @ The Hoxton Hotel

Save The Humans @ The Hoxton Hotel

Next Thursday, February 11, the Hoxton Hotel in Amsterdam dedicates an evening to our newest publication: 'Save the Humans!'

Visual of 3 future farms that can feed the planet and heal it too

3 future farms that can feed the planet and heal it too

Intensive agriculture may be nourishing most of the Earth’s inhabitants, but it’s doing the opposite to earth itself. Its dependence on singular crops, heavy ploughing machinery, …

Visual of Scientists want to create human-cow hybrid

Scientists want to create human-cow hybrid

Scientists in the UK applied for permission to create part-cow, part-human embryos for research aimed at treating diseases such as Parkinson's and Alzheimer's. The embryos created …

Visual of Apes Like Cooked Food, and What that Means for Human Evolution

Apes Like Cooked Food, and What that Means for Human Evolution

Humans are the only species on earth that cooks its food. Not only do we cook our food, but we usually find the flavor of cooked foods preferable to the raw version. Compare the …

Visual of Humane Technology #1: Feels Natural

Humane Technology #1: Feels Natural

All too often, technology frustrates us. It forces our behavior into constrained pathways. Even more insidious, technology can knock us out of alignment with our values, goals or …

Visual of Humane Technology #5: Empower People

Humane Technology #5: Empower People

Principle number five: Humane technology doesn't outsource people, but instead empowers them. How healthy or humane is it to have an escalator to the gym? Humane technology should …

Visual of Humanthesizer

Humanthesizer

The human body as an instrument is a cool example of how culture and nature are merging. Calvin Harris used a giant human synthesizer to perform his single. The material used is …

Visual of Is the Human Body Redundant?

Is the Human Body Redundant?

The increasing ‘liveliness’ of machines and accessibility to the virtual world has raised questions about whether it is possible to uncouple the mind from the body in through a …

Visual of The Soft Touch of a Human Hand

The Soft Touch of a Human Hand

Nissan’s Engineers Are Creepily Trying To Replicate Human Skin

Visual of Save the Humans - Call for Quotes

Save the Humans - Call for Quotes

For our new book "Save the Human" we invite you to submit quotes that question the autonomy of mankind in the digital computer era and study the future of the independent creative spirit.

Visual of Living on Water for a Sustainable Planet

Living on Water for a Sustainable Planet

Company Blue Frontiers wants to build 7.500 square meters of floating city made up of linked platforms, starting 2018. They hope to complete it by 2020.

Visual of Robotization Makes Work More Human

Robotization Makes Work More Human

Imagine being 16 and studying for a job that soon won't exist. What kind of future is that? New occupations will come thanks to robotization.

Visual of The Pyramid of Technology: How will a technology enter the human habitat?

The Pyramid of Technology: How will a technology enter the human habitat?

This question is an excerpt from the Pyramid of Technology toolkit In the late nineties, the Tamagotchi egg was released. A small egg-shaped device that contained a digital …

Visual of Fight climate change: Hack the Planet

Fight climate change: Hack the Planet

Lots of clouds this week. The peculiar picture above shows the eruption of mount Pinatubo in 1991, which apparently resulted in a certain amount of global cooling (next to some …

Visual of Incredibly Shrinking Humanity

Incredibly Shrinking Humanity

Arne Hendricks thinks we can solve the ecological crisis by shrinking every human on earth to 50cm tall: http://bit.ly/sxxNr1 #powershow

Visual of Transgenic Jell-O, more human than ever!

Transgenic Jell-O, more human than ever!

The American Chemical Society has announced a new method of producing gelatin that sounds like good news for cannibals and the canni-curious. Researchers are able to create …

Visual of Internet Traffic is now 51% Non-Human

Internet Traffic is now 51% Non-Human

So you thought the Internet was made by and for people? Think again. A study by Incapsula , a provider of cloud-based security for web sites (mind you where this data comes from), …

Visual of Watch Out Whales, Humans Want Your Krill

Watch Out Whales, Humans Want Your Krill

Krill, those tiny members of the ocean's planktonic community, have an importance disproportionate to their size. They are a vital food for whales, penguins and increasingly, …

Visual of A Brief History of Humankind

A Brief History of Humankind

Historian Yuval Noah Harari takes us on a journey through the whole human history.

Visual of GM Pigs for Animal-to-Human Organ Transplant

GM Pigs for Animal-to-Human Organ Transplant

Scientists have been trying to develop GM pigs that could be used to solve the shortage of organs for transplant patients.

Visual of What if Humans Disappeared?

What if Humans Disappeared?

What could happen if humans would just disappear?

Visual of A Map of Mars for Regular Humans

A Map of Mars for Regular Humans

If we'll ever get to go to Mars as tourists , we wouldn't get lost. Ordnance Survey , the official British mapping agency, recently released a new detailed map of the Red Planet. …

Visual of 1537 - Homunculus: the Semi-Human

1537 - Homunculus: the Semi-Human

In 16th and 17th centuries, some medical theory believed that a miniature human body can be produced in a flask by an alchemist.

Visual of Tooth fairy alert: Japanese company tests drug that can regrow human teeth

Tooth fairy alert: Japanese company tests drug that can regrow human teeth

Toregem Biopharma designed an antibody drug that can possibly regenerate teeth using the body's own tissues.

Visual of Hybrid Carp with human face

Hybrid Carp with human face

I never expected anthropomorphobia to be evoked by a fish! This hybrid species fish was born between a carp and a leather carp in the pond of a personal house in Chongju. Each of …

Visual of Pimp My Planet

Pimp My Planet

"We live in a time where everything or everyone can be upgraded or ‘pimped'. After the worldwide acceptance of plastic surgery, it was time to subject our worldly possessions …

Visual of The Human LED screen

The Human LED screen

All living creates produce light by default, so do humans . Now researchers from US, China, Korea and Singapore collaborated have collaborated in order to create ultra-thin …

Visual of Chrysler Looks to Human Lungs for a Better Gas Tank

Chrysler Looks to Human Lungs for a Better Gas Tank

Alveoli in human lungs serve as the inspiration for designing better, stronger ways of storing compressed natural gas.

Visual of Did Forks Really Give Modern Humans an Overbite?

Did Forks Really Give Modern Humans an Overbite?

The food writer Bee Wilson, author of Consider the Fork , has put forth a surprising theory about forks and teeth that has received widespread online coverage. According to …

Visual of All Humans Piled Together Are So Tiny

All Humans Piled Together Are So Tiny

All humans on Earth put together are not enough to fill the Grand Canyon. We are so small yet so present.

Visual of Human Workers Get Increasingly Obsolete

Human Workers Get Increasingly Obsolete

Robots are coming to replace humans at work, are they a real threat to the world’s unemployed?

Visual of A Modest Future for Humanity

A Modest Future for Humanity

Three minutes in the mind of Juan Enriquez, director of Synthetic Genomics.

Visual of Jazz-Playing Robot Challenges Human-Computer Interactions

Jazz-Playing Robot Challenges Human-Computer Interactions

A musical robot able to improvise a jazz solo in response to an actual person performing jazz.

Visual of Human Cloning Now Possible in China

Human Cloning Now Possible in China

Is human cloning here? Chinese scientist is ready to clone people at his ‘replication factory’.

Visual of AI Defeats Human at Go

AI Defeats Human at Go

Go world champion Ke Jie has lost two games of 'Go' against Google's DeepMind AI system AlphaGo.

Visual of Making prosthetic nipples out of human hair

Making prosthetic nipples out of human hair

Designer Arianna Pezzano creates prosthetic nipples using keratine coming from the hair that cancer patients lose during chemotherapy.

Visual of Biopresence - Human DNA Trees

Biopresence - Human DNA Trees

Imagine a graveyard without tombstones, instead there are growing trees that contain genetic material of the deceased people burried there. Biopresence creates Human DNA trees by …

Visual of Radio controlled human

Radio controlled human

Think of this sonic vibe-technology inside any MP3 player ;)

Visual of Next humans

Next humans

What will the human race look like in 1, 2, 3, 4 million years? Will it be one human race? Will there be a human race? Impressions of future scenario's must come from scientists, …

Visual of Pencils made from cremated humans

Pencils made from cremated humans

Artist Nadine Jarvis fabricates pencils from carbon left over of cremated humans -- it's part of a larger "research project into post mortem." She notes that "240 pencils can be …

Visual of Human genome sequencing soon child play?

Human genome sequencing soon child play?

Starting next spring, a complete human-genome sequence can be ordered the Californian startup Complete Genomics for just $5,000, Techreview reports. Currently sequencing still …

Visual of Human Nature as Pathology

Human Nature as Pathology

Modern society seems to have transformed human nature into a pathology. Our emotions are controlled by drugs. We are forced to operate within a narrow bandwith of what are …

Visual of Human garbage can

Human garbage can

Anthropomorphobic object of the week. Created by Sarah Hatch .

Visual of The Human Printer

The Human Printer

For a while now printer ink is probably the most expensive liquid per litre on earth. Still we need our images so badly that we accept this fact. The Human Printer manages to make …

Visual of Web Access Is A Basic Human Right

Web Access Is A Basic Human Right

"It's time to recognize the Internet as a basic human right" its inventor Sir Tim Berners-Lee has said.

Visual of 20k human chip

20k human chip

AAAGCTCGGTTATAACCATCATTTTCCGAAGACCAGCTACAGCTCACTGCAATTT Gene expression technology is used to evaluate changes in genes being visualised in normal and transformed cells. Changes …

Visual of Fractalary: Fractals from Planet to Atoms

Fractalary: Fractals from Planet to Atoms

I think all Nature has a fractal structure, from Planet to Atoms. Website: Fractalary: Fractals from Planet to Atoms

Visual of Human animal hybrid

Human animal hybrid

This peculiar, half-human creature could be your cousin. No really; it is a sculpture by Patricia Piccinini entitled The Young Family , which, in turn, is part of a larger …

Visual of Mapping the human desire to be touched

Mapping the human desire to be touched

Fleshmap touch investigates the collective perception of erogenous zones. Hundreds of people ranked how good it would feel to touch or be touched by a lover in different points of …

Visual of Human Augmentation™

Human Augmentation™

As a gamer, I come across many visions of possible futures. But this trailer from the upcoming video game Deus Ex: Human Revolution , the third part in the Deus Ex series shocked …

Visual of Trading Humans for Trading Algorithms

Trading Humans for Trading Algorithms

The economic system and profit motive has been a driving force that steers and even dictates social change. Investors and stockbrokers have been a major influence to these social …

Visual of Who Needs Real Humans? Not H&M

Who Needs Real Humans? Not H&M

Clothing giant H&M no longer uses real humans in its online catalog. The company has admitted that it pastes real models' heads on computer-generated bodies. At least there's …

Visual of #10: Enhance Human Experience, Don’t Replace it

#10: Enhance Human Experience, Don’t Replace it

Part 10 in the 11 part series Anthropomorphism and Design . The hidden danger with interactive products is that they will become so good at fulfilling our needs that they start to …

Visual of Beluga Whale makes Human-like Sounds

Beluga Whale makes Human-like Sounds

Researchers in the US have been shocked to discover a beluga whale whose vocalisations were remarkably close to human speech.

Visual of Human Barbie

Human Barbie

Just when you thought the  Second Life  hype was long gone, meet Ukrainian body artist Valerie Lukyanova who aims to turn Second Life into First Life. They call her the Human …

Visual of Lego Minifigs Will Take Over The Planet By 2019

Lego Minifigs Will Take Over The Planet By 2019

Imagine the devastation when there are more Lego minifigs on Earth than humans...

Visual of The Human Hamster Wheel Desk

The Human Hamster Wheel Desk

The Human Hamster Wheel Desk is the latest result of workspace evolution. Office work has domesticated us!

Visual of Hacking Human Cells to Use Solar Power

Hacking Human Cells to Use Solar Power

A new biotech startup seeks to hack our cells to use solar energy instead of carbon and oxygen.

Visual of Human-Like Robot Makes Freaky Joke About the Future of Mankind

Human-Like Robot Makes Freaky Joke About the Future of Mankind

To thread the uncanny valley is a conscious choice for many artists and enthusiasts, as a means to evoke, through their work, powerful emotions, thoughts and everything in between.

Visual of Musical Journey Through the Human Body

Musical Journey Through the Human Body

De Motu is an interactive music app that let you experience your body through music and influence the sound with your own body.

Visual of The Complex Networks of Our Planet

The Complex Networks of Our Planet

This video by Nature explains the complexity of networks on our planet.

Visual of The Human Smart Home Assistant

The Human Smart Home Assistant

Artist Lauren McCarthy launched a project called LAUREN in which she embodies a eponymous human smart home assistant.

Visual of Human Nature, designing the equilibrium with Koert van Mensvoort

Human Nature, designing the equilibrium with Koert van Mensvoort

Under the title Human Nature, designing the equilibrium, eleven designers will answer questions about a future in which Humankind and Nature enter into a new relationship. An …

Visual of The first human CRISPR trial in the US aims to cure inherited blindness

The first human CRISPR trial in the US aims to cure inherited blindness

Gene editing is advancing at a faster pace than most of us can keep up with. One significant recent announcement was gene editing tool CRISPR’s application to non-genetic diseases …

Visual of Five ways AI could make your car as smart as a human passenger

Five ways AI could make your car as smart as a human passenger

Driving long distances without a passenger can be lonely. If you’ve ever done it, you might have wished for a companion to talk to – someone emotionally intelligent who can …

Visual of NOT (Natural) AND NOT (mechanical) = human

NOT (Natural) AND NOT (mechanical) = human

Eric Hoffer (1902-1983) You dehumanize a man as much by returning him to nature - by making him one with rocks, vegetation, and animals - as by turning him into a machine. Both …

Visual of Human Tetris

Human Tetris

A tribute to the virtual world boomeranging back to the physical world by Mega64 . Or do you rather prefer the corny japanese gameshow version? Via Engadget ,

Visual of Human body farm

Human body farm

Why not use the human body to grow products for the medical industry? The designer Michael Burton envisions Future Farm where the body is used as a farm to cultivate clinical and …

Visual of Human Landscape

Human Landscape

Our peculiar image of the week was created by artist Levi van Veluw , who reinvents the classical fine art of landscape painting, by moving from the traditional 'oil on canvas' to …

Visual of Mirror Neurons – Simulation at the basis of Human Civilization

Mirror Neurons – Simulation at the basis of Human Civilization

Within our society, imitation and simulation are typically seen as inferior symbols of a distorted mediated culture – think of fake Rolexes, plastic Christmas trees, silicone …

Visual of The Human Construction of Gay Animal Culture

The Human Construction of Gay Animal Culture

Much attention has recently been devoted to 'gay' animals. It's not the fact that many species have enthusiastic homosexual lives that should be surprising – there are convincing …

Visual of Hi, a Real Human Interface

Hi, a Real Human Interface

By Multitouch Barcelona , via Trendbeheer .

Visual of Rule #8: Use Human Ethics

Rule #8: Use Human Ethics

Part 8 of the 11 part series Anthropomorphism and Design .  Anthropomorphic products blur the boundaries between products and people. Ethical norms for people don’t usually apply …

Visual of Book as Human-Computer Interface

Book as Human-Computer Interface

In combining the classic feeling of handling a book with the interactivity of the computer, Waldek W?grzyn of the Academy of Fine Arts in Katowice, Poland, has created a new human-computer interface.

Visual of Computer Algorithms Are Already Replacing Human Journalists

Computer Algorithms Are Already Replacing Human Journalists

Will writing software eventually replace journalists?

Visual of Maya YogHurt: Fermented Drink Made with Human Lactic Acid

Maya YogHurt: Fermented Drink Made with Human Lactic Acid

Artist Maja Smrekar modified yeast with her own DNA to produce human lactic acid.

Visual of World's Worst Job? Being a Human Robot at Amazon's Fulfillment Center

World's Worst Job? Being a Human Robot at Amazon's Fulfillment Center

Workers are completely controlled by algorithms in Amazon's fulfillment center

Visual of Humans Need Not Apply

Humans Need Not Apply

Warning, this video on the impact of automation on human labor might cause you to re-plot you professional career.

Visual of Human LCD

Human LCD

New media technology from South Korea: a gigantic human display compiled from supporters cheering their soccer teams . One pixel per supporter. See also: Skyscreen , A4 e-paper .

Visual of 1 Whole human

1 Whole human

Peculiar product of the week. Found at.

Visual of Planet Earth - Inversed

Planet Earth - Inversed

Peculiar image of the week. By Vladstudio

Visual of One Generation in, Dolphins Still Transmit Human Tricks

One Generation in, Dolphins Still Transmit Human Tricks

Dolphins in Port Adelaide, Australia, have been observed performing a remarkable trick : tail-walking, a trait so rare it has only been seen in the wild one other time. More …

Visual of Cake Made from Human Skin

Cake Made from Human Skin

Cake or death? Cake! The Slice cake is a (vegetarian) vision of the forms lab-grown meat may take in the future.

Visual of If Barbie Had Human Proportions

If Barbie Had Human Proportions

What does Barbie look like when she has the proportions of a normal 19-year-old?

Visual of Technology Made us Human

Technology Made us Human

Buckle up for a cinematic espresso shot from performance philosopher and NNN ambassador Jason Silva.

Visual of Human Artist Hatches Ten Chicken Eggs

Human Artist Hatches Ten Chicken Eggs

French performance artist hatches 10 hen's eggs in Palais de Tokyo.

Visual of New AI Model Can Mimic Any Human Voice

New AI Model Can Mimic Any Human Voice

Lyrebird is an AI model capable of synthesizing anyone’s voice from just a one-minute audio sample.

Visual of Human Furniture

Human Furniture

This unpractical yet not less pretty anthropomorphic furniture piece was created by photographer David Blazques . We are clueless on whether it is in permanent use, yet it serves …

Visual of Human-Shaped Power Lines

Human-Shaped Power Lines

Just a project for now, but a far more creative way to deal with unsightly public works than tree-shaped antennas.

Visual of Lucas Foglia's photography explores the uneasy relationship between humans and nature

Lucas Foglia's photography explores the uneasy relationship between humans and nature

There’s no place on earth untouched by human activity: This was clear as Lucas Foglia whizzed across the vast, white expanse of Alaska's Juneau Ice Field last summer. He was …

Visual of Interview Mark Wigley:

Interview Mark Wigley: "We are living in an ecology of antenna"

With the invention of the radio antenna in the late 19th century, we became a different species: Introducing the human insect. A species, able to communicate across oceans using …

Visual of Explore your relationship with AI

Explore your relationship with AI

What makes us human? And why do we sometimes fear artificial intelligence? And what about technological singularity - the moment in time when artificial intelligence outperforms …

Visual of Colonizing Mars with plants, not humans

Colonizing Mars with plants, not humans

The idea of colonizing Mars has become the big speculative future of humanity on Earth. But, artist Alexandra Daisy Ginsberg has radically different ideas to contribute to the …

Visual of Anthropomorphobia

Anthropomorphobia

Are you familiar with the affliction? Anthropomorphobia is the fear of recognizing human characteristics in non-human objects. The term is a hybrid of two Greek-derived words: …

Visual of Making an AI supermarket with Nonhuman Nonsense

Making an AI supermarket with Nonhuman Nonsense

What does the supermarket of the future look like? The Embassy of Food at Dutch Design week.

Visual of Gène Bertrand on design for human needs

Gène Bertrand on design for human needs

Nature has always been a source of inspiration for many artists and designers, yet the urgency to connect to nature is more pressing than ever. Environmental issues such as …

Visual of I Want Wings!!!!!!!!!!!!!!

I Want Wings!!!!!!!!!!!!!!

Read Nicholas Carr's essay on the transhumanist dream of having wings.

Visual of Interview: Bruce Sterling on the Convergence of Humans and Machines

Interview: Bruce Sterling on the Convergence of Humans and Machines

We had the honor of hosting Bruce Sterling in our Next Nature Network headquarters to talk to him about the concept of the convergence of humans and machines.

Visual of Next Generation: Demonstrating non-human narratives with Lindsey Bundel

Next Generation: Demonstrating non-human narratives with Lindsey Bundel

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Interview: Agi Haines, Speculative Artist Who Wants to Redesign the Human Body

Interview: Agi Haines, Speculative Artist Who Wants to Redesign the Human Body

Speculative designer Agi Haines' work focuses on (re)designing the human body, and speculates upon future scenarios.

Visual of Next Generation: Combining AI with human creativity with Sofia Crespo

Next Generation: Combining AI with human creativity with Sofia Crespo

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here?  Get in touch …

Visual of Interview: Floris Kaayk, the Visionary Creative Mind Behind Human Birdwings

Interview: Floris Kaayk, the Visionary Creative Mind Behind Human Birdwings

Floris Kayak discusses online hoaxes and the future of technology.

Visual of Bio-Printer Creates Living Body Parts

Bio-Printer Creates Living Body Parts

Bioprinter creates bespoke lab-grown body parts for transplant.

Visual of Why we need space janitors

Why we need space janitors

Reduce, reuse, recycle. We know the drill. But how do we cope with a junkyard in space?

Visual of Did Booze Make Us Modern?

Did Booze Make Us Modern?

A psychiatrist argues that beer gave us civilization - but do intoxicants play a deeper evolutionary role than that?

Visual of This book explains why cooking food was essential to human evolution

This book explains why cooking food was essential to human evolution

A must-read to the Next Nature fan: Catching Fire: How Cooking Made Us Human (2009). Written by British primatologist Richard Wrangham, the author shares his hypothesis that …

Visual of Cyborgnest: redefining human senses

Cyborgnest: redefining human senses

Nature provided humans with an extensive set of sensory modalities, allowing our brain to constantly gather sundry inputs from the outer world. These sensory inputs help us …

Visual of The future infrastructure of the blockchain might be green and humane

The future infrastructure of the blockchain might be green and humane

The connection we share through the Internet has laid the foundation for a whole new digital infrastructure, in which blockchain technology is heralded by many believers for being …

Visual of This exhibition confronts a planet in a state of emergency

This exhibition confronts a planet in a state of emergency

Meet the 'Eco-Visionaries' , these are the architects, artists and designers who respond to some of the most urgent ecological issues of our times. This exhibition reveals how …

Visual of Reconnecting with wildlife through biodiverse meditations

Reconnecting with wildlife through biodiverse meditations

Sleep and dream like a koala, relax under biodiversity and feel the meditative effect of artificial wildlife.

Visual of Browse the Catalog For The Post-Human

Browse the Catalog For The Post-Human

Augment your physiology. Enhance your prospects. From neuro-electronics, to robotic-prosthetics and mind-altering pharmaceuticals.

Visual of Space Television Network

Space Television Network

Sen is a space television network that provides visuals from other planets in order to prepare us for our multi-planetary life.

Visual of The Biggest Impact on the Planet Comes from Household Consumption

The Biggest Impact on the Planet Comes from Household Consumption

New study suggests that the real environmental problem is embodied in the things we buy.

Visual of Technology: Intrusive or Supportive?

Technology: Intrusive or Supportive?

Is the use of personal devices becoming a replacement for the spectrum of emotions that make us all humans?

Visual of A digital twin of the Earth could make the planet climate-neutral

A digital twin of the Earth could make the planet climate-neutral

While Elon Musk may be trying to initiate efforts to colonize Mars, scientists on Earth are attempting to build an accurate digital twin of the planet to simulate in the future. …

Visual of We Are more Bacteria than Human

We Are more Bacteria than Human

Our bodies are microbiomes, suffering from our habit of cleanliness.

Visual of Beijing's dust storm: part human, part nature

Beijing's dust storm: part human, part nature

The skies in Beijing turned orange recently, thanks to what was widely reported as a massive sandstorm . The problem, at least in terms of public health, is that it was not …

Visual of Enter the symbiocene

Enter the symbiocene

What if we would use the idea of symbiosis as the basis for the next period of Earth’s history?

Visual of An Edible Drone for Humanitarian Aid

An Edible Drone for Humanitarian Aid

Nigel Gifford is developing a drone that will be relatively inexpensive, disposable and edible.

Visual of The Ouroboros Steak is a steak made out of human cells

The Ouroboros Steak is a steak made out of human cells

You are what you eat; a quite common message in the midst of our self-growth society. We have to eat well to become the best version of ourselves - more productive, healthier …

Visual of Controlling Human Odour

Controlling Human Odour

The ultimate personal hygiene product, feces odor tablets, is another Japanese innovation sold by the Takano Yori Beauty Clinic . These pills promise to make your excrement …

Visual of More People Are Too Fat Than Too Thin

More People Are Too Fat Than Too Thin

For the first time in history the world population counts more people who are too fat than too thin.

Visual of Human Swarms

Human Swarms

A video showing a small intersection in India. It's hypnotic .

Visual of The World Without Technology

The World Without Technology

I remember the smoke the most. That pungent smell permeating the camps of tribal people. Everything they touch is infused with the lingering perfume of smoke – their food, …

Visual of Should we clone Neanderthals?

Should we clone Neanderthals?

If Neanderthals ever walk the earth again, the primordial ooze from which they will rise is an emulsion of oil, water, and DNA capture beads engineered in the laboratory of 454 …

Visual of Time Between Emergence and Design

Time Between Emergence and Design

Previously, experiences of time emerged from nature as given – offering seasons, the rhythm of humans, plants and animals. Nowadays, people integrate nature-time, body-time, inner-time, clock-time, and global 24/7 systems-time. Human beings, in past, current and next natures, have to deal with emergence and design of time in order to survive.

Visual of An Ecstatic Dialogue with Richard Doyle

An Ecstatic Dialogue with Richard Doyle

When techno–optimist and fellow at the Hybrid Reality Institute , Jason Silva, meets with Richard Doyle, author of Darwin's Pharmacy: Sex, Plants and the Evolution of the …

Visual of The Moon Gallery: the first museum in space

The Moon Gallery: the first museum in space

The Moon Gallery aims to set up the first permanent museum on the Moon. Soon launching to the International Space Station, full of ideas worth sending to the Moon. The gallery is …

Visual of A Stroll Through the Bubbles of Chemicals and Men

A Stroll Through the Bubbles of Chemicals and Men

A stunning pre-history of the anthropocene

Visual of Billionaire space race: the ultimate symbol of capitalism's obsession with growth

Billionaire space race: the ultimate symbol of capitalism's obsession with growth

Mars ain’t the kind of place to raise your kids, laments the Rocket Man in Elton John’s timeless classic. In fact, it’s cold as hell. But that doesn’t seem to worry a new …

Visual of Next Generation: Shaping intimacy through objects with Pleun van Dijk

Next Generation: Shaping intimacy through objects with Pleun van Dijk

Pleun van Dijk is a speculative artist/designer who investigates the intimate relationship between human and technology.

Visual of Next Generation: Exploring the vegetal cyborg with Marie Declerfayt

Next Generation: Exploring the vegetal cyborg with Marie Declerfayt

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here?  Get in touch  and …

Visual of Hello, superorganism

Hello, superorganism

When I was a kid, my parents took me to the beach every summer. We’d swim in the ocean and play on our inflatable raft in the surf. When the tide was low, I’d build a sand castle …

Visual of Can AI become addicted?

Can AI become addicted?

In 1953, a Harvard psychologist thought he discovered pleasure – accidentally – within the cranium of a rat. With an electrode inserted into a specific area of its brain, the rat …

Visual of Next Generation: Experiencing neo-robophilia with Hye Hyun Song

Next Generation: Experiencing neo-robophilia with Hye Hyun Song

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of From Eco-Apartheid to Earth Democracy

From Eco-Apartheid to Earth Democracy

Do humans exist merely to make money and use resources? Vandana Shiva believes humans have a higher purpose.

Visual of Ecology – A New Opium for the Masses

Ecology – A New Opium for the Masses

Marxist philosopher Slavoj Žižek discusses the 'naturalization' of capitalism and how ecology became a new field of capitalist investment. He also argues that the ultimate …

Visual of Towards a global society as a superorganism

Towards a global society as a superorganism

Today we hold the ability to gather a lot of knowledge, thanks to science. We are able to watch, analyze, manipulate and change matter to the nano-level. This makes it tempting to …

Visual of Next Generation: Sensing the critical zone with Menno Brouwer

Next Generation: Sensing the critical zone with Menno Brouwer

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of Intimate Technology: the Battle for Our Body and Behaviour

Intimate Technology: the Battle for Our Body and Behaviour

Technology is nestling itself within us and between us, has knowledge about us and can act just like us.

Visual of Next Nature Interview

Next Nature Interview

For the Venezuelan Magazine Platanoverde , Gabriela Valdivieso y Lope Gutiarrez-Ruiz interviewed artist/scientist Koert van Mensvoort and discussed some of the idea's behind Next …

Visual of Pyramid of Technology: How technology becomes nature in seven steps

Pyramid of Technology: How technology becomes nature in seven steps

How technology becomes nature in seven steps

Visual of The Anthropocene Explosion

The Anthropocene Explosion

We have entered the Anthropocene epoch, in which humanity and its instrumentalities are the most potent and influential geological force.

Visual of Next Nature Introduction

Next Nature Introduction

This project - the Next Nature Network - is about Nature's brand image. One might surmise that "Nature," being 100 percent all-natural, can't have any brand image.  The facts …

Visual of It could be time to start thinking about a cybernetic Bill of Rights

It could be time to start thinking about a cybernetic Bill of Rights

Like it or loathe it, the robot revolution is now well underway and the futures described by writers such as Isaac Asimov , Frederik Pohl and Philip K. Dick are fast turning from …

Visual of Inverting the energy paradigm with Charles Eisenstein

Inverting the energy paradigm with Charles Eisenstein

Energy policy blah blah blah, life cycle analysis blah blah blah, energy return on energy invested, peak oil, carbon footprint, renewables, hydro, nuclear, blah blah blah blah …

Visual of Yes, Naturally

Yes, Naturally

The introductory essay from the Yes, Naturally book - available in our store!

Visual of How can Big History help us think about the future?

How can Big History help us think about the future?

'Big History' is a multidisciplinary study that seeks to put the human story into the context of a 13.8 billion-year story from the Big Bang to now.

Visual of Why Borghildur Indriðadóttir wishes to perform on the Moon

Why Borghildur Indriðadóttir wishes to perform on the Moon

What is the meaning of art on the moon? Artist on the Moon is the latest project from Icelandic visual artist Borghildur Indriðadóttir , who aims to perform for the stars and …

Visual of Interview: Curator Ilari Laamanen on Momentum9, the Nordic Biennial

Interview: Curator Ilari Laamanen on Momentum9, the Nordic Biennial

We recently spoke to Ilari Laamanen, to peel the outcrops of Momemtum9, and unveil the overlapping themes to the next nature philosophy.

Visual of The technosphere is outweighing the biosphere

The technosphere is outweighing the biosphere

Our deficiencies have always driven us, even among our distant ancestors, back in the last Ice Age. Having neither the speed and strength to hunt large prey, nor sharp teeth and …

Visual of The Coronation

The Coronation

For years, normality has been stretched nearly to its breaking point, a rope pulled tighter and tighter, waiting for a nip of the black swan’s beak to snap it in two. Now that the …

Visual of The Uncanny Valley of the Pussycat Dolls

The Uncanny Valley of the Pussycat Dolls

Make no mistake, you're not looking at the latest Barbie line: These are the The Pussycat Dolls. Formerly an LA stripper show burlesque show, now upgraded to be pop music …

Visual of Microbiocene: the microbiological archeology of the future

Microbiocene: the microbiological archeology of the future

In configuring our next nature, artists and scientists explore new languages that move beyond the Anthropocene - the era of human beings. These semantics would bridge the gap …

Visual of In conversation with cyborg musician Kai Landre

In conversation with cyborg musician Kai Landre

What does the merge of bodies and technology mean for the human? For cyborg Kai Landre, cybernetic extensions become body parts and not technology. Kai began his transition to a …

Visual of Nurturing architecture

Nurturing architecture

The way we currently build is not sustainable. We will have to develop a sustainable living environment that matches our human needs, intuitions and potential.

Visual of ‘Optimism is our duty’: in conversation with Koert van Mensvoort

‘Optimism is our duty’: in conversation with Koert van Mensvoort

We live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …

Visual of In conversation with cyborg choreographer Moon Ribas

In conversation with cyborg choreographer Moon Ribas

If we could extend our senses in order to perceive the planet in a deeper way, would our understanding and our behavior towards it be different? We caught up with cyborg …

Visual of Organs from genetically engineered pigs may help shorten the transplant wait list

Organs from genetically engineered pigs may help shorten the transplant wait list

Demand for life-saving organ transplantation is at an all-time high. In 2021, a record 41,000-plus organ transplants were performed in the U.S., with top numbers for kidney, liver …

Visual of Next Nature's must reads

Next Nature's must reads

Ten books that continue to inspire the next nature philosophy—gathered for you to read this summer.

Visual of The Playboy Interview

The Playboy Interview

In 1961, the name of Marshall McLuhan was unknown to everyone but his English students at the University of Toronto – and a coterie of academic admirers who followed his abstruse …

Visual of Love your monsters

Love your monsters

Why we must care for our technologies as we do our children.

Visual of Could Biomimicry Help us Solve the Refugee Crisis?

Could Biomimicry Help us Solve the Refugee Crisis?

From nutrients within an organism, to organisms within collectives, to populations within a territory and so on - nature offers models on how to deal with highly complex systems.

Visual of Can microbes communicate with alien species?

Can microbes communicate with alien species?

Are we alone in the universe? The famous Seti (Search for Extraterrestrial Intelligence) programme has been trying to answer this question since 1959. American astronomer Carl …

Visual of Understanding the ocean's metabolism

Understanding the ocean's metabolism

Scientists have discovered the effect of sunscreen on corals. We need to understand our impact on the world to understand its problems.

Visual of Totem Animals for the Anthropocene

Totem Animals for the Anthropocene

Invasive species become the animal symbols for a man-made world.

Visual of Next Generation: Visualising the diversity of microbial species with Valerie Daude

Next Generation: Visualising the diversity of microbial species with Valerie Daude

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of Moral Shortcomings in the Technology Debate

Moral Shortcomings in the Technology Debate

Digital and genetic techniques increasingly influence life. Our belief in progress through technology stands in the way of a moral debate on this development. By Rinie van Est We …

Visual of The Biosphere Code Manifesto

The Biosphere Code Manifesto

During the event The Biosphere Code, Stockholm University researcher Victor Galaz and colleagues outlined a manifesto for algorithms in the environment.

Visual of To decarbonize flying, we need biofuels

To decarbonize flying, we need biofuels

While aviation accounts for 2.4% of all emissions from fossil fuel use globally, two-thirds of the sector’s warming effect depends on something other than its CO₂ emissions. And …

Visual of Meet the lungs of the sea: phytoplankton

Meet the lungs of the sea: phytoplankton

Phytoplankton are microscopic algae living throughout the ocean’s surface waters. They can’t swim and are at the mercy of the currents and tides. Despite their small size, …

Visual of Growth is not the problem, but the solution

Growth is not the problem, but the solution

If we want to bring down global CO2 emissions to zero, we will need technological innovation and massive infrastructure projects.

Visual of The information age is starting to transform fishing worldwide

The information age is starting to transform fishing worldwide

People in the world’s developed nations live in a post-industrial era, working mainly in service or knowledge industries. Manufacturers increasingly rely on sensors, robots, …

Visual of Seeking Symbiosis

Seeking Symbiosis

Visual artist Heleen Blanken explores the complex relationship between people, nature and technology.

Visual of Can This Virtual World Save the Real One?

Can This Virtual World Save the Real One?

A Dutch artist designs a Utopian eco-socialist online society.

Visual of Next Nature and the Curse of Oil

Next Nature and the Curse of Oil

The next step is to embrace and celebrate how cultural artifacts are escaping control, becoming autonomous, and forming the “next nature”.

Visual of Interview: Liam Young on Speculative Architecture and Engineering the Future

Interview: Liam Young on Speculative Architecture and Engineering the Future

Interview with Liam Young on his work in speculative architecture, the future, and our role in nature as humans.

Visual of Getting rid of that bit of unspoiled green

Getting rid of that bit of unspoiled green

There it is. A hefty hen, with its head up high and its beak out. And a gigantic VR headset over its beady little eyes. What does this battery hen see? ‘An experience of a free …

Visual of An introduction to biomimicry

An introduction to biomimicry

The first time I explained biomimicry to a stranger was not in a talk or a workshop but in a big-box bookstore just after Biomimicry: Innovation Inspired by Nature had come out. I …

Visual of Next Generation: Hearing the first breath of Earth with Dora Lionstone

Next Generation: Hearing the first breath of Earth with Dora Lionstone

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Why I'm turning my son into a cyborg

Why I'm turning my son into a cyborg

Imagine if everyone spoke a language that you don’t understand. It’s not a foreign language–it’s been spoken around you since the day you were born–but where as everyone else …

Visual of On the prehistoric origins of modern sexuality

On the prehistoric origins of modern sexuality

Let’s talk about the most controversial of "m words"—monogamy. And let’s have this conversation with in mind its prehistoric origins. Our modern picture of prehistoric societies …

Visual of It's been fifty years since we took the first full photo of Earth from space

It's been fifty years since we took the first full photo of Earth from space

The image of the whole Earth as seen from space has become a symbol of the environmental movement. Time for an update?

Visual of How plastic waste is hurting women in developing countries

How plastic waste is hurting women in developing countries

If we are to build a greener, fairer and more equal society in the wake of COVID-19, it’s time for rich countries to end their practice of dumping plastic waste in developing …

Visual of We could power households from the scraps in our food waste bins

We could power households from the scraps in our food waste bins

Imagine if you could power your kettle using the energy generated from the vegetable cuttings quietly breaking down in your kitchen’s compost bin. That reality might not be so far …

Visual of Animals are shapeshifting to cope with climate change

Animals are shapeshifting to cope with climate change

Global warming is a big challenge for warm-blooded animals, which must maintain a constant internal body temperature. As anyone who’s experienced heatstroke can tell you, our …

Visual of This year's electronic waste weighs more than the Great Wall of China

This year's electronic waste weighs more than the Great Wall of China

It’s widely known that the world has a plastics problem. What’s less widely known is that we have a similar problem with another kind of waste: electronics

Visual of Building with biocement

Building with biocement

Using the waste streams from the chemical industry and urine to make biocement.

Visual of Real Nature is not Green

Real Nature is not Green

At the edge of the woods along the motorway near the Dutch town of Bloemendaal, there stands a mobile telephone mast disguised as a pine tree. This mast is not nature: at best, it …

Visual of The 21th Century Paradigm

The 21th Century Paradigm

The history of art through the ages reveals a constancy that, by conscious or unconscious applications, provides us with an omnipresent correlation dealing with the …

Visual of Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture

Interview: Rachel Armstrong, Innovative Scientist Who Wants to Grow Architecture

Rachel Armstrong discusses living buildings, Venice's foundations, millennial nature and how to improve our future.

Visual of How climate fiction novels allow us to imagine possible futures

How climate fiction novels allow us to imagine possible futures

Every day brings fresh and ever more alarming news about the state of the global environment. To speak of mere “climate change” is inadequate now, for we are in a “ climate …

Visual of Next Generation: Exploring cybernetic ecologies with Marie Walker-Smith

Next Generation: Exploring cybernetic ecologies with Marie Walker-Smith

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of The prehistoric importance of trading technology

The prehistoric importance of trading technology

Then, as now, one person could literally change the course of history, with nothing more than an idea.

Visual of Next Nature is ancient

Next Nature is ancient

Uli Westphal's Seed Series is an ongoing attempt to document the seeds of all edible plants, one seed at a time.

Visual of You Can Never Go Back To Nature

You Can Never Go Back To Nature

One of the arguments that environmentalists use against factory farming and burning fossil fuels is that these activities are "unnatural" or that they "go against nature." But …

Visual of Happy Earth Day!

Happy Earth Day!

Today we celebrate Earth day, here is why.

Visual of Counteracting Climate Change with Geoengineering

Counteracting Climate Change with Geoengineering

A respected astrobiologist argues that a radical new process called geoengineering might be the only way to save us from climate change.

Visual of How a museum encourages its visitors to examine their relationship with their environment

How a museum encourages its visitors to examine their relationship with their environment

Last month I had the opportunity to immerse myself in Tokyo’s newly opened digital art landscape, the Mori Digital Art Museum. The museum stands out for it enables virtual …

Visual of Next Generation: Cooking with viruses with Pei-Ying Lin

Next Generation: Cooking with viruses with Pei-Ying Lin

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here?  Get in touch  and …

Visual of Exploring assisted evolution with Prof. Dr. John van der Oost

Exploring assisted evolution with Prof. Dr. John van der Oost

Assisted evolution raises complex questions. The practice involves human intervention to increase the rate of natural evolutionary processes. A technique that inevitably …

Visual of Next Generation: Writing a design manifesto with Pleun Wilting

Next Generation: Writing a design manifesto with Pleun Wilting

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of We Domesticated Ourselves

We Domesticated Ourselves

Our bodies are maps of our ancestor's social lives.  We evolved, physically and behaviorally, in incredibly complex social groups.  Such intense sociability may have favored the …

Visual of The Enlightenment Is Dead, Long Live the Entanglement

The Enlightenment Is Dead, Long Live the Entanglement

We humans are changing. We have become so intertwined with what we have created that we are no longer separate from it. We have outgrown the distinction between the natural and the artificial. We are what we make.

Visual of How AI is reshaping electronic music

How AI is reshaping electronic music

The idea that AI can compose electronic music may sound a little off to people. It raises essential questions about creativity as a product exclusive to humans: can an AI be …

Visual of In conversation with Jalila Essaïdi

In conversation with Jalila Essaïdi

What do in-vitro human skin, spider silk and cow manure have in common? They are all unlikely materials that can cloth, protect and inspire humans, as realized by award-winning …

Visual of The Embassy of Health is designing a chronically healthy society

The Embassy of Health is designing a chronically healthy society

How will we stay healthy in the future? Can we utilize the power of design to move towards a more healthy society?

Visual of Are we living in a superorganism?

Are we living in a superorganism?

The coverstory of Next Nature Magazine investigates how the rise of virtual influencers on social media reveals a superorganism.

Visual of Wild wild space

Wild wild space

When Earth goes south, cowboys go all the way up. The Space Rush of 2020s has something to do with settler colonialism.

Visual of The AI Revolution Is On

The AI Revolution Is On

Steven Levy writes in Wired on the unexpected turn of the Artificial Intelligence revolution: rather than whole artificial minds, it consists of a rich bestiary of digital fauna, …

Visual of A.I. Can Guess Exact Locations of Images

A.I. Can Guess Exact Locations of Images

Google's PlaNet will be soon able to tell you where a photograph was taken by simply looking at its contents.

Visual of Conversation with Dutch Philosopher Bas Haring: Robot, Colleague or Foe?

Conversation with Dutch Philosopher Bas Haring: Robot, Colleague or Foe?

We talked with Bas Haring to discuss the conception, image and will of the robot. Read our conversation with him and update your ideas about robots.

Visual of 5 must-see exhibitions before the end of the year

5 must-see exhibitions before the end of the year

A large-scale asian food market serving in vitro meat, a transatlantic expo on the future of nature and a travelling exhibition that explores our relationship with AI. These five …

Visual of What we can learn from The Social Dilemma

What we can learn from The Social Dilemma

Is social media ruining the world? Dramatic political polarization. Rising anxiety and depression. An uptick in teen suicide rates. Misinformation that spreads like wildfire. The …

Visual of Next Generation: Unlearning botanical narratives with Nina Škerjanc

Next Generation: Unlearning botanical narratives with Nina Škerjanc

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Bacteria

Bacteria "R" Us

There is a domain of creatures that diffusively encircles an entire planet. There are so many of them that they occupy every conceivable ecological niche. Yet, despite their …

Visual of Further Incredibly Shrinking Man

Further Incredibly Shrinking Man

Artist Arne Hendriks gave a lustrous talk on the possibilities of downsizing humanity to better fit the earth.

Visual of Next What?

Next What?

In this essay, anti-civilization, anarchist philosopher John Zerzan critiques the concept of 'next nature.' He argues that rather than freeing us, our self-domestication through …

Visual of The Carnery - A Cultured Future with In Vitro Meat

The Carnery - A Cultured Future with In Vitro Meat

In vitro meat has the capacity to transform meat production as we know it, introducing an entirely new way of thinking about and interacting with food.

Visual of How AI and genomics will impact the future of making babies

How AI and genomics will impact the future of making babies

As if stand-alone technologies weren’t advancing fast enough, we’re in age where we must study the intersection points of these technologies. How is what’s happening in robotics …

Visual of Explore the future of nature at IDFA Festival

Explore the future of nature at IDFA Festival

Humans often claim to be at the top of the food chain, but is that really the case? We are experiencing – now more than ever – our own fragility: an increase in natural disasters, …

Visual of When will the first baby be born in space?

When will the first baby be born in space?

When the first baby is born off-Earth, it will be a milestone as momentous as humanity’s first steps out of Africa . Such a birth would mark the beginning of a multi–planet …

Visual of Next Generation: Designing ecological webs with Miriam Lellek

Next Generation: Designing ecological webs with Miriam Lellek

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Next Senses

Next Senses

Next Senses explores the unchartered territory of how we could experience the world with technology

Visual of Entryparadise

Entryparadise

Written by Werner Lippert & Peter Wippermann, Curators of the Entryparadise exhibition (26/8 until 3/12, 2006, at Kohlenwäsche, Zollverein) Design is about to undergo a …

Visual of The NBIC Convergence: When Machines and Matter ‘Have Sex’

The NBIC Convergence: When Machines and Matter ‘Have Sex’

The Singularity , as popularized by Ray Kurtzweil, refers to a near term, theoretical time when machine intelligence greatly surpasses our own. At this point we will experience a …

Visual of Anthropo-scene #9: Sense, Sensors, Sensitivity

Anthropo-scene #9: Sense, Sensors, Sensitivity

Technology helps us understand the unfolding of the Anthropocene.

Visual of Artificial Light Threatens Pollination

Artificial Light Threatens Pollination

A recent study demonstrated how artificial light is a serious threat to plant pollination. It puts plant reproduction in danger, as well as the whole ecosystem.

Visual of Heart Repair with Spinach Leaves

Heart Repair with Spinach Leaves

Scientists developed a procedure to repair your heart with a spinach leaf.

Visual of Recharge! Sun for Your Brain Cells

Recharge! Sun for Your Brain Cells

A gadget called HumanCharger promises "the sun in your pocket" to give you energy, by beaming light through your ears.

Visual of People are less likely to turn a robot off if it asks them not to

People are less likely to turn a robot off if it asks them not to

A team of German researchers published  a study  earlier this week indicating people can be duped into leaving a robot turned on just because it “asks” them to. The …

Visual of Suzanne Lee wants to live in a world that uses only sustainable materials

Suzanne Lee wants to live in a world that uses only sustainable materials

Biotechnology is nearly as old as humanity itself. The food you eat and the pets you love? You can thank our ancestors for kickstarting the agricultural revolution, using …

Visual of What will COVID-19 teach us about life?

What will COVID-19 teach us about life?

We live in turbulent times. Thanks to science and technology, we are able to perceive our environment down to the atomic level. We can read DNA, manipulate cells, cut and paste …

Visual of The GeneSprout Initiative: cultivating new plant breeding techniques

The GeneSprout Initiative: cultivating new plant breeding techniques

Some 10,000 years ago humans began to domesticate plants and animals. The birth of agriculture, one of the earliest technologies available.

Visual of Breaking Point?

Breaking Point?

John Zerzan, published in Green Anarchy issue #24 - Spring/Summer 2007 The rapidly mounting toll of modern life is worse than we could have imagined. A metamorphosis rushes …

Visual of Out of Control

Out of Control

The Made and the Born: Neo-Biological civillization, written by Kevin Kelly, excerpt from Out of Control : The New Biology of Machines, Social Systems and the Economic World, …

Visual of Robot’s Best Friend

Robot’s Best Friend

From chef, to nurse, and also lover. Get ready, a new generation of robots is going to invade our lives!

Visual of Designed to Survive Our Roads

Designed to Survive Our Roads

A road safety campaign in the Australian state of Victoria exposed an educational, yet confronting picture to raise awareness to the vulnerable human body on the road.

Visual of Interview: Mike Thompson and Susana Cámara Leret, Designers Exploring Alternative Ways of Thinking & Doing

Interview: Mike Thompson and Susana Cámara Leret, Designers Exploring Alternative Ways of Thinking & Doing

Interview with Mike Thompson and Susana Cámara Leret.

Visual of The Robots Are Coming!

The Robots Are Coming!

Robots are getting stronger and smarter every day. They are taking over our whole lives. How long will I have my job before a robot steals it?

Visual of Virtual Baby Acts and Looks Impossibly Real

Virtual Baby Acts and Looks Impossibly Real

A rosy-cheeked kid learns her first words, cries when her babysitter leaves, smiles when she’s happy, but she’s not real. BabyX is an AI research-in-progress by a company named Soul Machines.

Visual of Your Next Nature guide to Dutch Design Week 2018

Your Next Nature guide to Dutch Design Week 2018

Over time, our bodies, our food and our environment have become more and more subject to design. As designers, we hold the responsibility and have the unique chance to envision …

Visual of How animal filters unmask the estranged relation to our wild self

How animal filters unmask the estranged relation to our wild self

Would you like a dog snout, cat eyes or fluffy bunny ears? The choice is yours. Virtual selfie filters have become a widespread phenomenon on social media platforms such as …

Visual of Next Generation: Delving into biophilic design with Daniel Elkayam

Next Generation: Delving into biophilic design with Daniel Elkayam

This story is part of Next Generation, a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of The Coming World: ecology as the new politics

The Coming World: ecology as the new politics

In science fiction and popular science, 2030 is often suggested as the year in which our planet will run out of oil. Similarly, 2100 will be the year that, according to …

Visual of Next Generation: illustrating the remains of the anthropocene with Louise Silfversparre

Next Generation: illustrating the remains of the anthropocene with Louise Silfversparre

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of The next generation xenobots are here

The next generation xenobots are here

In 2020, scientists made global headlines by creating “ xenobots ” – tiny “ programmable ” living things made of several thousand frog stem cells. These pioneer xenobots could …

Visual of Next Generation: Wandering through the post wilderness with Melissa Schwarz

Next Generation: Wandering through the post wilderness with Melissa Schwarz

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of A new mythology of technology

A new mythology of technology

In conversation with architect Julia Watson, a leading expert on Indigenous technologies and author of 'Lo-TEK, Design by Radical Indigenism'.

Visual of Geodesign

Geodesign

We have identified eight key defining moments that tell the story of geodesign, from ancient insight to artificial intelligence.

Visual of Interview with a cyborg

Interview with a cyborg

Erich Berger has a 96 year old grandmother who is a cyborg. She features dentures, hearing aids, glasses, pace maker, a metal implant on the pinkie toe, and more. Quotes from the …

Visual of Innovative Nostalgia

Innovative Nostalgia

We humans simply feel more comfortable with technological change when it comes in a familiar form that refers to an existing and accepted object, habit, value, tradition or intuition.

Visual of Robots Taking Government Jobs

Robots Taking Government Jobs

Meet Amelia, the first robot to work along with human coworkers in a council job.

Visual of Untouched Nature Is Entirely Gone

Untouched Nature Is Entirely Gone

Researchers prove that pristine landscapes haven’t existed for thousands of years, therefore we should change or mindset before trying to save the planet.

Visual of Ecosexuality: Make the Biosphere Your Lover

Ecosexuality: Make the Biosphere Your Lover

Ecosexuality reconceptualizes our perspective on the biosphere by having consensual experiences with it.

Visual of The future of the ECO Coin

The future of the ECO Coin

How can we design a cryptocurrency for the better of humanity and ecology? In this last chapter of the crypto deep dive series , we will dissect two kinds of blockchain …

Visual of Welcome to the CRISPR baby world—here’s what you should know

Welcome to the CRISPR baby world—here’s what you should know

Last week, the gene editing world was hit by news the equivalent of a nuclear bomb. In a video on YouTube , Dr. Jiankui He at Southern University of Science and Technology in …

Visual of Maurizio Montalti talks about the cycle of life

Maurizio Montalti talks about the cycle of life

As modern humans, we are out of balance with our natural environment. With use of technology, we try to prolong our human lifespan and create materials that live longer than we …

Visual of How biotechnology could shape the future of product design

How biotechnology could shape the future of product design

Humans have been manipulating living things for thousands of years. Examples of early biotechnologies include domesticating plants and animals and then selectively breeding them …

Visual of Why there is a new urgency for speculative design

Why there is a new urgency for speculative design

Pink chickens, synthesized tiger penises and salads grown from bodily fluids - how could they shape our future? In a Next Nature collaboration with the Gogbot Festival, the …

Visual of How China is enjoying blue skies thanks to COVID-19

How China is enjoying blue skies thanks to COVID-19

Surrounded by greyness and with the air around you having a dusty, burnt taste; for a long time this is what it has been like to live in many of the world’s highly polluted …

Visual of Next Nature announces their 2021-2024 plans

Next Nature announces their 2021-2024 plans

With great pleasure we announce our plans for 2021-2024: ‘Hello, Superorganism’ . Our human presence has a huge impact on the planet; plastic in the oceans, climate change, mass …

Visual of Why physical distancing feels so unnatural to us

Why physical distancing feels so unnatural to us

For many people, the most distressing part of the coronavirus pandemic is the idea of social isolation. If we get ill, we quarantine ourselves for the protection of others. But …

Visual of A message from volcanic rocks

A message from volcanic rocks

Although it’s seductive to think of human beings as the dominant species on earth, many others play important roles too. Bacteria, insects, algae colonies, rocks and the …

Visual of An artificial skin to breathe underwater

An artificial skin to breathe underwater

The human world often sees itself as separate from the rest of the natural world. Because we have deemed ourselves, ironically, as higher functioning beings over all others on …

Visual of Dune explores the geopolitics behind resource extraction

Dune explores the geopolitics behind resource extraction

Dune offers a useful allegorical narrative of the “scramble for Africa”, which saw European empires carve up the continent into colonized powers.

Visual of La Belle Verte imagines a world of harmonious existence

La Belle Verte imagines a world of harmonious existence

Utopianism and dystopianism are themes often found in today’s movies, especially considering the increased awareness of the damage done to the Earth by human activities. Often …

Visual of Exploring Next Nature (2004)

Exploring Next Nature (2004)

The first essay ever written on Next Nature, published in Next Nature Pocket and in Entry Paradise, New Design Worlds . ( download pdf ) (German version: Erkundungen im Nächste …

Visual of A Society of Simulations

A Society of Simulations

An interviewer once asked Pablo Picasso why he paints such strange pictures instead of painting things the way they are. Picasso asks the man what he means. The man then takes out …

Visual of Ars Electronica Festival goes Next Nature

Ars Electronica Festival goes Next Nature

This years edition of the Ars Electronica festival , which has been hangout for international experts from the arts and sciences for almost three decades, focuses on the nature …

Visual of The Monsters We Deserve

The Monsters We Deserve

Recently, a video clip has been circulating the web that  purportedly shows a rabbit born earless due to the radiation at Fukushima. BoingBoing has a convincing take-down of the …

Visual of Interview: Arne Hendriks, Researcher and

Interview: Arne Hendriks, Researcher and "Father" of The Incredible Shrinking Man

Hendriks’s activity explores the positive transformative power of creative impulses and the importance of fundamental free scientific research.

Visual of The

The "Actroid" Lives in the Uncanny Valley

The Actroid robot holds clues for climbing out of the uncanny valley.

Visual of Personhood Status for Robots

Personhood Status for Robots

An "electronic personhood" for robots has been discussed in the European Parliament recently, raising big questions about equality, citizenship, legal and ironically, human rights for artificial intelligent machines.

Visual of Solar Powered Electric Cars

Solar Powered Electric Cars

The sun sustains our planetary system. Its energy fuels life. And in the future, the sun will also fuel our cars. That’s the premise of Dutch startup Lightyear, a startup specialized in solar powered electric cars.

Visual of Sophia: World's First Robot with a Citizenship

Sophia: World's First Robot with a Citizenship

Sophia the Humanoid, a human-like robot in appearance and mannerisms, was granted citizenship by Saudi Arabia and became the first robot with citizenship.

Visual of ReTuna: the Shopping Mall Selling Nothing but Recycled Products

ReTuna: the Shopping Mall Selling Nothing but Recycled Products

A Swedish shopping center is bucking the trend of mindless consumption. At the ReTuna Återbruksgalleria every product is made of recycled materials.

Visual of Recap of the Next Nature book launch

Recap of the Next Nature book launch

The new Next Nature book is here ! Next Nature fellows, ambassadors, members and newly interested people came together on the 4th of June to celebrate the book launch with a …

Visual of How a 6.000-year-old fruit fly gave us cheese

How a 6.000-year-old fruit fly gave us cheese

Historians often trace the dawn of human civilisation back 10,000 years, when Neolithic tribes first settled and began farming in the Fertile Crescent, which stretches through …

Visual of How future fashion could help us cope with isolation

How future fashion could help us cope with isolation

Today we cannot meet, touch or hug our loved ones. And while we all like the feeling of the touch of another human being, physical contact does not just feel nice, it is crucial …

Visual of Embracing the Future with Patricia Piccinini

Embracing the Future with Patricia Piccinini

Patricia Piccinini is an artist interested in the relationship between humans and non-humans, the natural and the artificial, science and storytelling. Working with silicone, …

Visual of Next Generation: listening to ultrasound waves with Sheng-Wen Lo

Next Generation: listening to ultrasound waves with Sheng-Wen Lo

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here?  Get in touch …

Visual of Why your pets can't spread the coronavirus

Why your pets can't spread the coronavirus

A Pomeranian dog in Hong Kong grabbed the international media’s attention this week after scientists found traces of coronavirus in the canine. Following confirmation that the …

Visual of Check your technoprivilege!

Check your technoprivilege!

Technology is not neutral; the same tech might empower some and disempower others. It is time to check our Technoprivilege, argues author Hendrik-Jan Grievink.

Visual of This documentary tells the story of Biosphere 2

This documentary tells the story of Biosphere 2

Can we create a new biosphere on another planet? Documentary "Spaceship Earth" shows how - in the Arizona desert.

Visual of The sense of privacy

The sense of privacy

Humans’ natural sense of privacy helps them regulate the boundaries of public and private, but fail when trying to identify privacy risks in the online world.

Visual of How to design your future family

How to design your future family

Imagine a place called Reprodutopia. How would such a place look like?

Visual of Information Decoration: Our Environment as an Information Carrier

Information Decoration: Our Environment as an Information Carrier

Picture this: it's 40,000 years ago, and you are an early Homo sapiens. You are standing on the savanna. Look around you. What do you see? No billboards, no traffic signs, no …

Visual of Next Nature Movie #4: Blade Runner

Next Nature Movie #4: Blade Runner

Look around you and try to find the most natural thing in the room you are in now. It is you. Now, you wouldn’t be so sure in the apocalyptic Los Angeles of 2019 depicted in Blade …

Visual of Bulletproof Skin

Bulletproof Skin

Recent work of artist Jalila Essaïdi exemplifies of how science and art can meet and create meaningful inventions for society. Jalila Essaïdi used the spider silk produced by …

Visual of Can Life Be a Technology?

Can Life Be a Technology?

In 2009 the Initiative for Science, Society and Policy coined the phrase ‘living technology’ [1] to draw attention to a group of emerging technologies that are useful because they …

Visual of Man Flies Like a Bird

Man Flies Like a Bird

Some months ago we wrote about the dream of mechanical-engineer Jarno Smeets to fly like bird . Over the last few months Jarno worked steadily to materialize his dream. Today …

Visual of Post Natural Organisms of the EU

Post Natural Organisms of the EU

If you happen to be in the neighborhood you might want to drop by at the exhibition Post Natural Organisms of the European Union in Amsterdam. The small but delicate expo, curated …

Visual of Walter Benjamin on Film and the Senses

Walter Benjamin on Film and the Senses

During the late 1930’s the philosopher Walter Benjamin wrote its widely influential essay ‘The work of Art in the Age of Its Technical Reproducibility’. While describing a general …

Visual of Will Eugenics Become an Acceptable Strategy to Avoid Climate Change?

Will Eugenics Become an Acceptable Strategy to Avoid Climate Change?

Climate change is one of the biggest challenges of today and various scenarios, ranging from artificial trees , pollution trading , co2 capturing to geo-engineering, have been …

Visual of A Plan to Eliminate Predators

A Plan to Eliminate Predators

British philosopher David Pearce believes we should to stop animals from hunting and killing other animals.

Visual of Get Infrared Sight with a Vitamine Diet

Get Infrared Sight with a Vitamine Diet

Bio-hackers developed a protocol to augment human sight to see into the near infrared range.

Visual of Anthropo-scene #7: Anthropocene Bird

Anthropo-scene #7: Anthropocene Bird

Due to human action, 1300 bird species are seriously in decline. Other birds have learned to live with humans and profit from their presence.

Visual of Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society

Interview: Nadine Bongaerts, Synthetic Biologist Bridging Science with Society

We recently talk to Nadine Bongaerts about the role and impact of synthetic biology, the gap between bio­sciences and society and the importance of communication to overcome the fear of new technologies.

Visual of Watch out for Bullied Robots

Watch out for Bullied Robots

Dystopian future scenarios filled with evil robots are everywhere. We are afraid of robots treating us badly, but what will happen if it'll be the other way around? According to …

Visual of Interview: Leanne Wijnsma, Designer for the Instinct Who Uses Smell as Medium

Interview: Leanne Wijnsma, Designer for the Instinct Who Uses Smell as Medium

Dutch experience designer Leanne Wijnsma designs for the human instinct and puts the sense of smell back to where it belongs, as modern hazards have shifted to the digital realm.

Visual of ECO Coin Award Interviews: Shubhendu Sharma

ECO Coin Award Interviews: Shubhendu Sharma

We asked Shubhendu Sharm, our first ECO coin award nominee about his method, business and hopes for the future.

Visual of If you could have another sense, which sense would you choose?

If you could have another sense, which sense would you choose?

Color-blind artist Neil Harbisson designed a brain-implanted antenna that converts colors into sound. This enables him to hear colors he cannot see, and extends his vision to …

Visual of The world’s plastic problem is bigger than the ocean

The world’s plastic problem is bigger than the ocean

As you read this, a strange object that looks like a 2,000-foot floating pool noodle is drifting slowly through the central north Pacific Ocean. This object is designed to solve …

Visual of Exploring body architecture with Lucy McRae

Exploring body architecture with Lucy McRae

As evolution goes on, the human body is evolving too. What does it mean to be human in times of advanced biotechnology and genetic engineering? Are our bodies ready for our …

Visual of Next Generation: Thinking about the future of food with Annie Larkins

Next Generation: Thinking about the future of food with Annie Larkins

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of Next Generation: Creating utopian and dystopian futures with Bas Jansen

Next Generation: Creating utopian and dystopian futures with Bas Jansen

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Want to see your work here?  Get in touch  and …

Visual of Living robots made from frog stem cells may revolutionize medicine

Living robots made from frog stem cells may revolutionize medicine

At just a millimeter wide, Xenobots are “neither a traditional robot nor a known species of animal", they are "a new class of artifact: a living, programmable organism”, says …

Visual of Next Generation: Speculating about the future with Deborah Rhyner

Next Generation: Speculating about the future with Deborah Rhyner

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of The new Next Nature book is here!

The new Next Nature book is here!

We live in a world in which we control the biology of a tomato at such precision, you could think of it as a product of technology, instead of a product of nature. Think about it, …

Visual of 5 Dutch exhibitions you cannot miss this summer

5 Dutch exhibitions you cannot miss this summer

Interior based on bacteria, spaces morphing perception and the merging of man, animal and machine. These five must see exhibitions in the Netherlands explore the intersection of …

Visual of Notes on the plastisphere

Notes on the plastisphere

Every piece of plastic that’s ever made, still exists. It results in a floating garbage dump in the ocean, full of life. While this (geo)design was never intentional, humans …

Visual of Next Generation: Designing chairs with mealworms and Will Eliot

Next Generation: Designing chairs with mealworms and Will Eliot

William Eliot designs chairs while collaborating with mealworms.

Visual of With this sound recognition technology scientists can eavesdrop on nature

With this sound recognition technology scientists can eavesdrop on nature

What if humans would be able to listen to what nature has to say? Conservationists are trying to grasp non-human sounds , which might help us to better understand environmental …

Visual of What food design can do

What food design can do

Food design gives us a taste of innovation. It visualizes, speculates, challenges and problem-solves.

Visual of The Museum of Edible Earth

The Museum of Edible Earth

We spoke with the Museum of Edible Earth, a travelling museum dedicated to the prosperous amount of soil samples.

Visual of Deadline to save the World: 30th August

Deadline to save the World: 30th August

Picnic Green Challenge calls upon people like you to invent a product or service that can help to save the world. Restore the planet's harmony and lets you win 500.000 Euro on the …

Visual of Gel Remote

Gel Remote

Human-product relationships increasingly play out in a realm which was previously considered exclusive for human-human and human-animal relationships. Panasonic now redesigned one …

Visual of The Evolution of the Richer

The Evolution of the Richer

Are we on the verge of a future human evolution, one that isn’t, at least in it’s very core, “the survival of the fittest”, but rather “the evolution of the richer”? Think about …

Visual of How biotech will drive our evolution

How biotech will drive our evolution

Are you ready for some techno-optimism? Buckle up and enjoy the ride with bio-tech evangelist Gregory Stock . Some quotes from his prophetic TED talk : "We are seizing control of …

Visual of Suffering from Anthropomorphobia?

Suffering from Anthropomorphobia?

Anthropomorphobia is the fear of acknowledging qualities we wish to consider only human in non-human things. Sufferers from the condition used to have trouble mostly at fairs or …

Visual of Having Invented the Gods, Perhaps we can Turn into Them

Having Invented the Gods, Perhaps we can Turn into Them

My name is Jason Silva. I've spent the last 5 years hosting and producing a tv show on Al Gore's Emmy-winning Current TV network and I'm a fellow at the Hybrid Realities …

Visual of Disaster Edens: The Anti-Tourist Attraction

Disaster Edens: The Anti-Tourist Attraction

Imagine your cruise to the Galapagos came with a ghoulish warning: "Your hair will fall out, your skin will blister, you'll probably get cancer and your children's children might …

Visual of The Earth on Loan

The Earth on Loan

Christian Schwägerl is a correspondent for Der Spiegel and the author of Menschenzeit (The Age of Man). He will be presenting his views on the Anthropocene at the  Next Nature …

Visual of Lions Relocate to the Suburbs

Lions Relocate to the Suburbs

As cities push to the edges of the wilderness, wild animals are increasingly com

Visual of End of Life Care Machine

End of Life Care Machine

Designer, artist and engineer  Dan Chen has developed the ' End of Life Care Machine ', a machine designed to guide and comfort dying patients with a carefully scripted message. …

Visual of Nature is Dead, Long live Nature

Nature is Dead, Long live Nature

Like we did to old nature before, we must now cultivate our technological environment.

Visual of Anthropo-scene #1: From Rocks to Thoughts

Anthropo-scene #1: From Rocks to Thoughts

How geology and humanity turn ancient algae into high-tech gadgets.

Visual of Anthropo-scene #3: Morphing Earth, Piece by Piece

Anthropo-scene #3: Morphing Earth, Piece by Piece

Humans act as bio-excavators that literally move mountains.

Visual of GM Mosquitoes: No Olfaction, No Sting

GM Mosquitoes: No Olfaction, No Sting

Engineering mosquitoes to ignore the scent of human flesh.

Visual of Moments in Meat History Part I - Origins of Meat-eating and Hunting

Moments in Meat History Part I - Origins of Meat-eating and Hunting

About 4 or 5 million years ago, major changes in the Earth's climate brought about grassland regions where giant mammals could graze.

Visual of Diseases Of The Future

Diseases Of The Future

Nowadays humans suffer from diseases that didn't exist in the past, a trend that will probably continue into the future. A wide range of new disorders, especially related to the …

Visual of Electronic Skin can Detect Magnetic Fields

Electronic Skin can Detect Magnetic Fields

There is a new artificial skin technology that could give humans magnetoception in the future.

Visual of The Golden Quarter

The Golden Quarter

Some of our greatest cultural and technological achievements took place between 1945 and 1971. Why has progress stalled?

Visual of But will lab-grown meat be kosher?

But will lab-grown meat be kosher?

Read Benjamin Aldes Wurgaft's essay on judaism in relation to the production of laboratory-grown meat.

Visual of “Everything Is Already Invented”

“Everything Is Already Invented”

Robert Gordon says all the major inventions have been made, but that's only true for our limited knowledge of future possibilities.

Visual of From Homo Sapiens to Homo Optimus

From Homo Sapiens to Homo Optimus

We are entering an age of technological singularity, in which artificial intelligence and biological enhancement are combined in order to construct the next stages of human evolution.

Visual of Interview: Pauline Van Dongen, Designer Merging Fashion and Technology

Interview: Pauline Van Dongen, Designer Merging Fashion and Technology

Dutch fashion designer specialized in wearable technology, Pauline van Dongen researches the human body in relation to its surroundings.

Visual of Lunar Insurrection Vol.2: Harvest Moon

Lunar Insurrection Vol.2: Harvest Moon

Lunar Insurrection  is a group of architects that explores the creative possibilities of the moon as a potential territory for human activity and inhabitation. In  Vol.2 , their …

Visual of Fellow Day: Next Senses

Fellow Day: Next Senses

On June 17th a NNN Fellow Day was organized to explore the future project: Next Senses.

Visual of Racist Robots and Bloodthirsty Crowds

Racist Robots and Bloodthirsty Crowds

It took less than 24 hours for Twitter to corrupt an innocent AI bot and teach it morally repugnant things.

Visual of The Digital Mythology of... Super Mario

The Digital Mythology of... Super Mario

Mythology still surrounds us, we just relate to it differently. Games and movies have replaced pantheons and folk tales. Fairies and gnomes left the forests and the rivers and moved to virtual realities.

Visual of A Robot Will Spark the Next Avant-Garde

A Robot Will Spark the Next Avant-Garde

­­ “An illegal theme park exposing the ideology of the aesthetics of hacking”. “A hybrid drone targeting technological domination”. “A psychedelic fridge to raise doubt about fake …

Visual of Jobs for Creators - Robots at Work #2

Jobs for Creators - Robots at Work #2

Have a look at our series Robots at Work! In this episode we present you five jobs for creators, the ones that build with their hands.

Visual of Technosphere Weighs 30 Trillion Tons

Technosphere Weighs 30 Trillion Tons

If humans would disappear from the face of the Earth today, we would still leave 30 trillion tons of mass in the geological record. Certainly, "we were here" is written all over.

Visual of The Economy of Ecology

The Economy of Ecology

What if we could redesign the system to work for humanity and the planet we call home? What would the economy of ecology look like?

Visual of A happy birth day to Louise Brown

A happy birth day to Louise Brown

Dear Louise Brown, On behalf of the future I would like to congratulate you on your birthday. It has been 40 years that you where born into this world on July 25th 1978, …

Visual of I like my steak lab-grown, not-grass fed

I like my steak lab-grown, not-grass fed

Right now, somewhere in a laboratory in California, the Netherlands or Japan, a technician is taking a few thousand skeletal muscle cells from a living animal, and placing them in …

Visual of Interview: Designer Shahar Livne is geomimicing the future of plastics

Interview: Designer Shahar Livne is geomimicing the future of plastics

We sat down with Shahar Livne, an Israeli-born designer who graduated from the Design Academy in Eindhoven to talk about her vision on the future of plastics.

Visual of Your next doctor might just be a robot

Your next doctor might just be a robot

Conventional wisdom says that you can’t replace the human touch in terms of medical care, but in our rapidly changing technological environment, it appears that this perception …

Visual of The Pyramid of Technology: How will we co-evolve with technology?

The Pyramid of Technology: How will we co-evolve with technology?

This question is an excerpt from the Pyramid of Technology toolkit Cooking is a process through which humans outsource part of their bodily functions to technology (think …

Visual of Social animals are the inspiration for robot swarms

Social animals are the inspiration for robot swarms

From flocks of birds to fish schools in the sea, or towering termite mounds , many social groups in nature exist together to survive and thrive. This cooperative behaviour can be …

Visual of The church of AI

The church of AI

Would you pray to a Robot deity? A group of Japanese buddhists is already doing so. Meet Mindar , the robot divinity shaped after the buddhist Goddess of Mercy, also known as …

Visual of What is a species?

What is a species?

A koala bear isn’t actually a bear, it’s a marsupial. Whales aren’t fish, they’re mammals . Tomatoes aren’t vegetables, they’re fruit . Almost nothing is actually a nut . Peanuts, …

Visual of Matilde Boelhouwer wants to make urban environments flower again

Matilde Boelhouwer wants to make urban environments flower again

Matilde Boelhouwer is a designer whose work speculates between art, design, science, biology and food. Matilde shapes this obligation into a studio which mainly focuses on the …

Visual of Is in vitro meat good news for animals?

Is in vitro meat good news for animals?

The Singapore Food Agency has approved “chicken bites” containing meat made from real chicken cells that were grown outside of a chicken’s body. Alongside similar news from Israel …

Visual of Swiping is the new touching

Swiping is the new touching

From all the memes that have reached me through my screen since the outbreak of the corona pandemic, there is one that perfectly reflects my thoughts in the beginning of March …

Visual of Science Friction explores living among companion species

Science Friction explores living among companion species

Is it possible to imagine other earthly stories? Can we conceive of other ways of living among different species? This exhibition explores these issues with the help of a …

Visual of This expo explores technological nature and indigenous insight

This expo explores technological nature and indigenous insight

Technology brings us closer to nature, and indigenous insight reconnects us to our roots.

Visual of Sónar Lisboa: a festival for body and brain

Sónar Lisboa: a festival for body and brain

Sometimes a festival can be so much more. Tapping into arts, design, and electronic and experimental music festival, Sónar Lisboa (8-10 April) is one for the body and for the …

Visual of Next Generation: Designing a living menstrual cup with Lucrezia Alessandroni

Next Generation: Designing a living menstrual cup with Lucrezia Alessandroni

What if living objects could re-connect humans with their menstrual cycle and change the way we perceive it?

Visual of Dancing at the intersection of natural and virtual worlds

Dancing at the intersection of natural and virtual worlds

Exploring the intersection of technology and art, a team of creatives presents a virtual performance that pushes the limits of human expression.

Visual of Potatoes from Mars

Potatoes from Mars

It might sound like the title of a bad horror movie. But cultivating potatoes in space may soon be more than just fiction. Scientists and biologists are currently using simulated Mars and moon soil to experiment with space farming. One of them is space farmer Wieger Wamelink.

Visual of Homo Desktopus

Homo Desktopus

A future physical anthropologist who knows nothing about the human race and would dig up a contemporary desktop computer, might conclude homo desktopus must have been the user of …

Visual of Deliver us from Skeuomorph Prosthetics

Deliver us from Skeuomorph Prosthetics

No, this is not another example in our fake for real series , comparing an artificial with a human hand. Rather, you are looking at twice the same hand: with and without its …

Visual of Hyperfins

Hyperfins

The next step in biomimetic body extentions for propelling yourself through water. Man moves on from copying ducks to become a dolphin-like cyborg. With these fins you can be …

Visual of Wrapping Greenland

Wrapping Greenland

The Discovery series 'Ways to save the planet' the episode 'Wrapping Greenland ' shows how Dr. Jason Box uses reflective blankets to cover glaciers in Greenland. Due to global …

Visual of Ars Electronica 2010: Artists Adressing NextNature

Ars Electronica 2010: Artists Adressing NextNature

Sind wir noch zu retten? That was the slogan of this year’s Ars Electronica festival in Linz (Austria). Titled ‘REPAIR’, the media art festival urged to leave our scepticism and …

Visual of Razorius Gilletus – On the Origin of a Next Species

Razorius Gilletus – On the Origin of a Next Species

Is the evolution of the single bladed razor into an exorbitant five–bladed vibrating gizmo the outcome of human needs, or is there another force in play? Say hello to Razorius …

Visual of 11 Golden Rules of Anthropomorphism and Design: Introduction

11 Golden Rules of Anthropomorphism and Design: Introduction

Welcome to the 11 part series The Golden Rules of Anthropomorphism and Product Design. In this series, we will be examining how designers can better integrate human-like forms or …

Visual of Back to the Tribe

Back to the Tribe

Traditionally, technology is seen as a force that diminishes our instincts and puts us at a distance of nature. Increasingly however, we realize technology can also energize and …

Visual of Nintendo Portables Are Breeding Grounds For Sexy Fun

Nintendo Portables Are Breeding Grounds For Sexy Fun

Sexuality and sensuality are phenomena which have been a nature for us as long as we humans exist. Not only humans experience these phenomena; also animals experience sexuality …

Visual of System Animals

System Animals

What animal is so naive to come into this world as a naked and crying infant, completely vulnerable, helpless, and an easy prey for any predator? Newborn lamb or giraffe’s babies …

Visual of The Sound of the Blue Canary

The Sound of the Blue Canary

Blue is a beautiful color, but its sound is simply irresistible. It is the song of the unhappy and the depressed. It is a sound that touches people. It was also the sound of a …

Visual of The Technological Sublime

The Technological Sublime

The sublime is an aesthetic concept of 'the exalted,' of beauty that is grand and dangerous. Through 17th and 18th century European intellectual tradition, the sublime became …

Visual of A More Interesting, More Depressing Theory of Easter Island's Downfall

A More Interesting, More Depressing Theory of Easter Island's Downfall

A new theory claims it wasn't human deforestation that caused the ecological collapse of Easter Island, but something smaller and squeakier.

Visual of Interview: Jason Silva, Media Artist and Curator of Awe-Inspiring Ideas

Interview: Jason Silva, Media Artist and Curator of Awe-Inspiring Ideas

Media artist, filmmaker and wonderjunkie Jason Silva talks about technological evolution and why humans are gods with anuses.

Visual of What Ant Colony Networks Can Tell Us About What’s Next for Digital Networks

What Ant Colony Networks Can Tell Us About What’s Next for Digital Networks

Ever notice how ant colonies so successfully explore and exploit resources in the world … to find food at 4th of July picnics, for example? You may find it annoying. But as an …

Visual of Gene-Edited Micropigs Will Be Soon Sold As Pets

Gene-Edited Micropigs Will Be Soon Sold As Pets

Earlier this year, a group of Chinese scientists published a paper about the modification of the genome of human embryos with the cutting-edge powerful technique called CRISPRs. …

Visual of Should Intelligent Sex Robots be Banned?

Should Intelligent Sex Robots be Banned?

The Campaign Against Sex Robots, recently launched, is pushing towards banning the continuation of sex robots development.

Visual of Meet Yangyang, Actroid From China

Meet Yangyang, Actroid From China

The humanoid robot Yangyang can function autonomously, talking and gesturing while interacting with people.

Visual of Plastivore – A Bird that Feeds on Plastic

Plastivore – A Bird that Feeds on Plastic

The speculative 'Plastivore' bird thrives on a diet of fungi and plastics.

Visual of Poem Passes the Turing Test

Poem Passes the Turing Test

Zackary Scholl developed a program to produce a poem that passed the Turing Test.

Visual of Should We Fear Thinking Machines?

Should We Fear Thinking Machines?

It seems thinking machines could put the human race in danger. How realistic these fears are?

Visual of Artificial Senses for Navigation

Artificial Senses for Navigation

A team of cyborgs and digital enthusiasts developed a wearable technology for the body that perceives a human sixth sense.

Visual of Empowered by Robots Event Report

Empowered by Robots Event Report

A report on the Empowered by Robots conference during DDW16, demonstrating fruitful collaboration between humans and robots.

Visual of The First Artificial Intelligent Lawyer

The First Artificial Intelligent Lawyer

There is an artificial intelligent robot called ROSS that is taking over the work of thousands of lawyers. Working non-stop, reading faster then any human attorney can do.

Visual of Augmented Biology: Growing Ears on Apples

Augmented Biology: Growing Ears on Apples

A promising way to grow body parts: using an apple.

Visual of Solar Energy: the Hottest New Currency

Solar Energy: the Hottest New Currency

Energy-backed money could help transition humanity to a more sustainable world, both environmentally and economically.

Visual of The Modular Body

The Modular Body

The Modular Body is an online science fiction story by Floris Kaayk about the creation of OSCAR, a living organism built from human cells.

Visual of 1932 -

1932 - "Brave New World" Published

Aldous Huxley published Brave New World in 1932, bringing the idea of the artificial uterus to the big audience.

Visual of Hire a Smart Robot

Hire a Smart Robot

What if your co-worker was a robot? Dutch startup Smart Robotics is a job agency for robots that allows you to hire a smart-robot.

Visual of A Truly Exotic Fruit: the Space Mango

A Truly Exotic Fruit: the Space Mango

Scientists sent mango embryos to space lab in order to let them develop new genetic traits.

Visual of How AI could revolutionize the teaching profession

How AI could revolutionize the teaching profession

In various parts of the world, access to education is, or risks becoming, a huge crisis. UNESCO estimates that around 20 million new teachers are needed worldwide - and that's not …

Visual of Call for projects: bring your groundbreaking creativity to tackle pressing energy issues

Call for projects: bring your groundbreaking creativity to tackle pressing energy issues

We need to change the way we power our daily lives. Burning fossil fuels is the primary cause of climate change, yet this is still our main source of energy. Much of this energy …

Visual of Custom-grown bones, and other wild advances in regenerative medicine

Custom-grown bones, and other wild advances in regenerative medicine

The human body has always been an incredible machine, from the grand feats of strength and athleticism it can accomplish down to the fine details of each vein, nerve, and cell. …

Visual of In Conversation with Marleen Hartjes: Introducing a digital door to the museum

In Conversation with Marleen Hartjes: Introducing a digital door to the museum

Don’t be surprised when you catch a human face on a screen strolling through the Van Abbe museum for contemporary art in Eindhoven, as these are Europe’s very first robotic …

Visual of This startup uses body heat to mine crypto

This startup uses body heat to mine crypto

While many love to speculate about the sheer number of jobs that robots and artificial intelligence are going to replace in the near future, no one seems to be coming up with any …

Visual of Air pollution may be making us less intelligent

Air pollution may be making us less intelligent

Not only is air pollution bad for our lungs and heart , it turns out it could actually be making us less intelligent, too. A recent study found that in elderly people living in …

Visual of This artificial reef was just deployed in Sydney Harbor

This artificial reef was just deployed in Sydney Harbor

Earth’s oceans have seen better days. They’re inundated with plastic waste, both whole single-use plastics and tons of plastic microparticles that find their way back into our …

Visual of How Pokémon are affected by climate change

How Pokémon are affected by climate change

You know climate change is real when dead coral Pokémon start to wash up on (virtual) beaches. Behold, Cursola, world’s first dead coral Pokémon. On the origins of Cursola While …

Visual of Why electric cars should be allowed to drive faster

Why electric cars should be allowed to drive faster

In response to the nitrogen crisis, the Dutch cabinet is planning to reduce the speed limit during the day to 100 kph. In itself a sensible decision. But it is strange that this …

Visual of There are 299 trees growing in a football stadium

There are 299 trees growing in a football stadium

Some centuries ago landscape painters taught us to appreciate the quality of an untouched landscape. Ever since we have been doing everything to recreate it. We camouflage cell …

Visual of Discussing bio-based material experiences with Elvin Karana

Discussing bio-based material experiences with Elvin Karana

The world of design is in need of new materials that align with the urgency for sustainability. Issues such as climate change, plastic waste and harmful materials require us to …

Visual of In conversation with Studio Drift

In conversation with Studio Drift

A flock of drones that fly like birds, drifting blocks of concrete, a choreography of opening and closing flowers. The work of Studio Drift is challenging the distinction between …

Visual of How Amazon trees write their own autobiographies

How Amazon trees write their own autobiographies

Tropical forests are one of the world’s largest carbon stores and they help regulate the global climate. But they’re being erased at a terrifying rate. Deforestation claimed an …

Visual of (Im)possible bodies: responsiblity and care in our cyborg future

(Im)possible bodies: responsiblity and care in our cyborg future

What does it mean to become a cyborg? Better yet, aren't we cyborgs already? What then, does it mean to have a body? Is a 'standard' desirable, what does that even mean, and what …

Visual of POND is a symphony of lights and water

POND is a symphony of lights and water

Have you ever gone a day without water? Most likely you have experienced low energy levels or fatigue after a few couple of hours. Water gives us energy. More than that, water is …

Visual of We are all parent Earth

We are all parent Earth

Last week I was strolling through the aisles of the supermarket when I heard a buzzing sound coming from my pocket. I looked up from my cart and saw it was a message from  …

Visual of Next Generation: Building aquatecture with Shaakira Jassat

Next Generation: Building aquatecture with Shaakira Jassat

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Cyborg mythologies #3: in god we trust, all others bring data

Cyborg mythologies #3: in god we trust, all others bring data

This is #3 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …

Visual of Welcome to new Evoluon

Welcome to new Evoluon

Today our human impact on Earth is humongous. Climate change, plastic oceans, mass urbanization and deforestation. Scientist recently calculated the technosphere now outweighs the …

Visual of Next Generation: Exploring blood, salt and iron as biomaterials with Hedwich Rooks

Next Generation: Exploring blood, salt and iron as biomaterials with Hedwich Rooks

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch: magazine@nextnature.net. …

Visual of Growing artificial muscles

Growing artificial muscles

A team of researchers from Freiburg University has developed an artificial muscle that may result in improvements in medicine, prosthetics, and implants.

Visual of Time gets bendy in Disney Pixar's new film

Time gets bendy in Disney Pixar's new film

Spoiler alert: this article explains a key plot point, but we don’t give away anything you won’t see in trailers. At the beginning of the new Disney Pixar film, Lightyear, Buzz …

Visual of The Limits and Beyond: A report about the future

The Limits and Beyond: A report about the future

In 1972, the Club of Rome published The Limits to Growth, a report about the future of the world. They described the limits of the world’s resources and what it is capable of …

Visual of Next Generation: Designing ecosystems of technology with Maike Gebker

Next Generation: Designing ecosystems of technology with Maike Gebker

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Artist refuses photography prize after admitting his image was AI-generated

Artist refuses photography prize after admitting his image was AI-generated

A German artist refused a photography prize after admitting his image was AI-generated.

Visual of Check your Technoprivilege!

Check your Technoprivilege!

Carl Friedrich Then in conversation with Hendrik-Jan Grievink about technoprivilege.

Visual of 5 must see exhibitions in 2023

5 must see exhibitions in 2023

1. THE FUTURE IS PRESENT Design Museum Danmark How will contemporary design define the future? THE FUTURE IS PRESENT grasps the very essence of Danish artistry of material …

Visual of The fantastical living landscapes of AUSGANG Studio

The fantastical living landscapes of AUSGANG Studio

AUSGANG Studio combines art, technology, and living materials to tell stories of our world's trajectories.

Visual of The World is not a Desktop

The World is not a Desktop

Mark Weiser (originally written for ACM Interactions ). What is the metaphor for the computer of the future? The intelligent agent? The television (multimedia)? The 3-D graphics …

Visual of Faustian Bargains and Pineapple Shampoo

Faustian Bargains and Pineapple Shampoo

Since the early days of the net, the electronic pastoral has lent itself to all sorts of dubious agendas pushed by science, the military and even libertarian tendencies. In the …

Visual of Doggerland – Mapping a Lost World

Doggerland – Mapping a Lost World

So you think climate change is new? So you think the flooding of landmass by the oceans is a new? So you must have not heard of the times when people walked from London to …

Visual of Synthetic biology demystified

Synthetic biology demystified

://nextnature.net The expanding research culture of synthetic biology demystified in this TV item on the International Genetically Engineered Machine competition . Via Posthuman …

Visual of ECO Currency – A Proposal to Balance Economical and Environmental Value

ECO Currency – A Proposal to Balance Economical and Environmental Value

Imagine we would have an alternative monetary currency for environmental value. Would the rain forest still be destroyed if there existed an ECO–currency to express its value and …

Visual of Self–Repairing Architecture

Self–Repairing Architecture

All buildings today have something in common: They are made using Victorian technologies. This involves blueprints, industrial manufacturing and construction using teams of …

Visual of Take your transgenic kids to the CPNH

Take your transgenic kids to the CPNH

The Center for PostNatural History doesn't house the dinosaurs or dioramas of your run-of-the-mill natural history museum. Instead, it's the first museum dedicated exclusively to …

Visual of Voodoo Phone

Voodoo Phone

Japanese professor Hiroshi Ishiguro from Osaka University has quite a track record of threading the uncanny valley. Remember his Doppelgänger Robot and Geminoid Female ? His …

Visual of Arne Hendriks – Incredible Shrinking Man

Arne Hendriks – Incredible Shrinking Man

Artist Arne Hendriks explores the possibilities and implications of downsizing the human species to better fit the earth.

Visual of Better Than Nature?

Better Than Nature?

At the turn of the millennium, miniaturized canines acquired the cherished status of living, designer handbag ornaments.  These teeny tiny photogenic doggies, which had been …

Visual of Better Walking with Robotic Legs

Better Walking with Robotic Legs

The Berkeley Robotics & Human Engineering Laboratory is researching a way to improve the performance of human bodies. They are doing innovative research in the field of …

Visual of Christian Schwägerl - Riding the Anthropocene

Christian Schwägerl - Riding the Anthropocene

Christian Schwägerl , freelance journalist and biologist, author of the book The Anthropocene: The Human Era and How It Shapes Our Planet , introduces us into the Anthropocene , a …

Visual of Monkeys Fall into the 'Uncanny Valley' Too

Monkeys Fall into the 'Uncanny Valley' Too

The uncanny valley, a phrase coined by Japanese robotic researcher Masahiro Mori nearly three decades ago, describes the uncanny feeling that occurs when people look at …

Visual of Artifice Earth: Adam Rutherford on the Promises of Synthetic Biology

Artifice Earth: Adam Rutherford on the Promises of Synthetic Biology

An interview about the history and promises of synthetic biology, and the problem with the word "nature".

Visual of Engineering Beneficial Parasites

Engineering Beneficial Parasites

Breeding parasites to improve immune function, skin tone and even resistance to poison.

Visual of Interview: Alexandra Daisy Ginsberg, Designer and Synthetic Biology Expert

Interview: Alexandra Daisy Ginsberg, Designer and Synthetic Biology Expert

An interview with Daisy Ginsberg, artist and synthetic biologist.

Visual of The Fence

The Fence

A satirical yet bona fide view on our changing relation with nature.

Visual of Beyond the Possible with Floris Kaayk

Beyond the Possible with Floris Kaayk

Floris Kaayk, artist and fictive documentaries maker, confronts us with the impossible.

Visual of Reducing Plastic Bags by 80%

Reducing Plastic Bags by 80%

The EU Commission will hopefully reduce the consumption of disposable plastic bags within 5 years by 80%.

Visual of The Power Amplification Robot

The Power Amplification Robot

Power Loader: the power amplification exoskeleton robot.

Visual of What’s the Point If We Can’t Have Fun?

What’s the Point If We Can’t Have Fun?

Since Darwin we tend to look at the biological world exclusively in economical terms. The idea that monkey's, frogs, or even ants do more than simply propagate, doesn't find much acceptance among scientists. And yet, even crayfishes at times seem to displace objects just for fun.

Visual of Anthropo-scene #10: From Thoughts to Geology

Anthropo-scene #10: From Thoughts to Geology

It's more than two years since I have started this exploration of the Anthropocene for Next Nature for you. We have visited many places together, places I have traveled to as a …

Visual of Drugs Testing with Artificial Organs

Drugs Testing with Artificial Organs

Researchers are working on artificial organs-on-chips will be used for drug development.

Visual of

"The End": a Virtual Opera Singer, Millions of Fans and the Meaning of Death

Sixteen-year-old Japanese singer Hatsune Miku grew in short time to a worldwide popstar. With her colourful appearance she counts millions of followers on social media, she …

Visual of Genome Editing - Bringing the Übermensch to a Shelf Near You

Genome Editing - Bringing the Übermensch to a Shelf Near You

Last April, a Chinese group of researchers published a paper that set the scientific world ablaze in a fierce debate. The paper was about their attempts to edit the DNA of a human …

Visual of Abandoning Modern Life to Live as a Goat

Abandoning Modern Life to Live as a Goat

Conceptual designer Thomas Thwaites is currently investigating and experiencing to live life as a goat.

Visual of Organs Could Self-Heal with Nanoneedles

Organs Could Self-Heal with Nanoneedles

An international team of scientists used nano-sized needles in order to promote production of new blood cells.

Visual of Which Technologies will 2016 Bring?

Which Technologies will 2016 Bring?

The new year is right around the corner, let’s forget about long-term future for a while to check out what new tech trends will hit it big in 2016. At the end of every year, …

Visual of The Risk of Technological Unemployment

The Risk of Technological Unemployment

Stephen Hawking gives his opinion on what technological unemployment, aka machines taking over our jobs, can represent for future human societies.

Visual of The Hotel Run by Robots

The Hotel Run by Robots

A futuristic Japanese hotel will be run by robots, designed to be extremely human-like.

Visual of Explore Mars with NASA's VR Experience

Explore Mars with NASA's VR Experience

Exploring the surface of Mars at least 15 years before a human being in flesh and blood will be able to, this is the new ambitious idea of the people at NASA.

Visual of What if Mosquitoes Were Only a Zoo Species?

What if Mosquitoes Were Only a Zoo Species?

Genetic engineers are developing techniques to kill several types of mosquitoes.

Visual of Pigs Have a Heart for Us

Pigs Have a Heart for Us

Replacing your old heart with a new heart from an animal may seem extreme? Well, this future may arrive sooner than we think.

Visual of Robots Are Making Pizza Now

Robots Are Making Pizza Now

A new wave of automation lies in pizza. Not only will robots deliver your pizzas in the future, they will even make them.

Visual of Setting Aside Half the Earth for Nature

Setting Aside Half the Earth for Nature

E.O. Wilson, a respected biologist, has proposed a radical idea: set aside half of the planet as nature preserves.

Visual of This Indestructible Micro-Animal Will Help Us

This Indestructible Micro-Animal Will Help Us

Will a small step for Ramazzottius Varieornatus be a giant leap for mankind?

Visual of Welcome to the Age of Plastic

Welcome to the Age of Plastic

According to a new study, humankind is now entering the "Age of Plastic". The research investigates the evidence that we are living in the Anthropocene, a time in which humanity is the main geological force.

Visual of 1916 - Artificial Womb Appeared in Cinema

1916 - Artificial Womb Appeared in Cinema

In 1916 the artificial womb made its first appearance on the big screen in the movie "Homunculus" by Otto Rippert.

Visual of 1999 - Ectogenesis Enters The Matrix

1999 - Ectogenesis Enters The Matrix

The movie The Matrix brought ectogenesis to the public eye.

Visual of Artificial Womb: the Timeline

Artificial Womb: the Timeline

NNN is currently doing a preliminary research into the idea of the artificial womb. This timeline will help you navigate through the investigation.

Visual of Artificial Womb Workshop at BioClub Tokyo

Artificial Womb Workshop at BioClub Tokyo

On August 8, NNN gave a workshop at BioClub Tokyo to share some insights on the future of technologies concerning human reproduction, sexuality and relationships.

Visual of Dinner with Chef Watson

Dinner with Chef Watson

Chef Watson knows over 10.000 recipes. The highbrow robotic cook invited us over for dinner during the first Neo-Futurist Dinner at Mediamatic.

Visual of Interview: Lining Yao, Interaction Designer and Maker of Novel Materials

Interview: Lining Yao, Interaction Designer and Maker of Novel Materials

We recently interviewed Lining Yao, Chinese interaction designer who uses organic materials as a technology that brings us back to nature.

Visual of Next Nature Gift Guide 2017

Next Nature Gift Guide 2017

The gift giving season is once again upon us and to help out those who are struggling to find that perfect gift for that special someone we have brought together a collection of Next Nature inspired gifts.

Visual of Jobs for Caretakers - Robots at Work #1

Jobs for Caretakers - Robots at Work #1

This is post number one of our serie 'Robots at Work'. In this episode we present you five jobs for caretakers, the ones that work with their hearts.

Visual of Jobs for the Extraordinary-Robots at Work #5

Jobs for the Extraordinary-Robots at Work #5

This is post number five of our serie 'Robots at Work'. In this last episode we present you five jobs for the extraordinary, the ones who won't let themselves be categorized.

Visual of Scientists Create Ghost Heart

Scientists Create Ghost Heart

The Texas Heart Institute researches in the field of organ transplantation. With the “ghost heart” — an heart organ scrubbed clean of all its former cells, the researches are on the verge of creating a sustainable and effective way of transplanting organs.

Visual of How to Train Your Robot

How to Train Your Robot

Humans and robots can work together to maximize the potential of both and boost productivity to new levels.

Visual of This artwork lets trees tell the story of climate change

This artwork lets trees tell the story of climate change

In our ongoing battle against climate change, it's hard to transcend from our human position and ‘think’ like nature. Given, nature doesn't think the way humans do, but it does …

Visual of Future AI may hallucinate and get depressed — just like the rest of us

Future AI may hallucinate and get depressed — just like the rest of us

Scientists believe the introduction of a hormone-like system, such as the one found in the human brain, could give AI the ability to reason and make decisions like people do. …

Visual of Scientists accidentally create mutant enzyme that eats plastic bottles

Scientists accidentally create mutant enzyme that eats plastic bottles

Scientists have created a mutant enzyme that breaks down plastic drinks bottles – by accident. The breakthrough could help solve the global plastic pollution crisis by enabling …

Visual of Open Call for ECO Coin Award 2018 Submissions

Open Call for ECO Coin Award 2018 Submissions

Nominate an inspiring project, platform, person or community who is tackling food waste for the ECO Coin Award 2018

Visual of Face the future of intimacy with Kiiroo

Face the future of intimacy with Kiiroo

Meet the teledildonics, an ingenious species of bi-directionally controlled sextoys from the future, available today. These touch emulating vibrators find each other on social sex …

Visual of Why you should attend ADE Green

Why you should attend ADE Green

ADE Green returns for the seventh consecutive year to the DeLaMar Theater in Amsterdam. Once more, Amsterdam Dance Event organizes this leading event to ignite sustainable action, …

Visual of AI creates images of food that doesn’t exist (yet)

AI creates images of food that doesn’t exist (yet)

A team of researchers from Tel-Aviv University developed a neural network capable of reading a recipe and generating an image of what the finished, cooked product would look like. …

Visual of These Next Senses allow you to augment your senses with technology

These Next Senses allow you to augment your senses with technology

Imagine you could communicate telepathically with a whale, listen to the WiFi networks in your environment, or experience smells through seeing color. Developments in technology …

Visual of Iceland is mourning a dead glacier

Iceland is mourning a dead glacier

Death certificates and commemorative plaques aren’t something you’d normally associate with a glacier. But that is exactly how Iceland recently mourned the loss of 700-year-old …

Visual of Smart homes could help dementia patients live independently

Smart homes could help dementia patients live independently

You might already have what’s often called a “smart home”, with your lights or music connected to voice-controlled technology such as Alexa or Siri. But when researchers talk …

Visual of The beginner's guide to biohacking

The beginner's guide to biohacking

What is the first thing that comes to mind when you hear the term 'biohacking'? Perhaps you are now thinking of a bunch of kids sitting in their kitchen with a DNA kit, (wannabe) …

Visual of A guide to parenting with AI Barbie

A guide to parenting with AI Barbie

The rise of artificial intelligence has brought us more advanced toys. If AI Barbie and her talking robotic friends are going to raise our kids, what would their parenting style …

Visual of Why half of the world's beaches could disappear by 2100

Why half of the world's beaches could disappear by 2100

Up to half of the world’s sandy beaches are at risk of disappearing by the end of this century if no action is taken to limit greenhouse gas emissions. That’s according to a new …

Visual of Next Generation: Shimmering nature with Elissa Brunato

Next Generation: Shimmering nature with Elissa Brunato

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Would you like to see your work here?  Get in touch …

Visual of Cyborg artist Moon Ribas feels earthquakes

Cyborg artist Moon Ribas feels earthquakes

Imagine waking in the night, and feeling the vibrations of an earthquake on the other side of the world pulsing through your body. This is a reality for Catalan-born artist Moon …

Visual of Virtual makeup: maybe they're born with it, maybe it’s XR

Virtual makeup: maybe they're born with it, maybe it’s XR

As our reality exists increasingly within digital realms, our virtual world demands a virtual identity. Our work is hybrid, our social identity is online and our connection is …

Visual of Cooling buildings with ultra-white paint

Cooling buildings with ultra-white paint

From icy tundras to billowing clouds, the colour white crops up repeatedly in our planet’s palette. This colour provides a natural way for light from the sun to reflect back from …

Visual of Join us at the DDW Talks: Next Biodiversity

Join us at the DDW Talks: Next Biodiversity

The influence of humans on the earth can hardly be underestimated. Think of climate change, deforestation, and the decline of biodiversity. We are heading for a sixth mass …

Visual of Bio, Art & Design (BAD) Award Winners

Bio, Art & Design (BAD) Award Winners

The three winners of the Bio, Art & Design (BAD) awards have been announced.

Visual of Jurassic World scientists still haven’t learned

Jurassic World scientists still haven’t learned

Just because you can doesn’t mean you should – real-world genetic engineers can learn from the cautionary tale. “ Jurassic World: Dominion ” is hyperbolic Hollywood entertainment …

Visual of How to plant seeds with your shoes

How to plant seeds with your shoes

Imagine helping nature restore itself simply by going for a run. In a fusion of fashion and conservation, London-based designer Kiki Grammatopoulos has introduced her concept …

Visual of Hedgehog's robotic fungi farms

Hedgehog's robotic fungi farms

Beyond being little umami bombs, mushrooms are: protein-packed and nutritious. But here's the pitfall: their cultivation can be pricy. Especially gourmet mushrooms such as …

Visual of Enter the memesphere

Enter the memesphere

Why memes might be the next tool to make sense of on our increasingly hybrid virtual and physical environment.

Visual of Meet the BAD Awards winners of 2023

Meet the BAD Awards winners of 2023

The annual Bio Art & Design (BAD) Award encourages new artists and designers to explore the world of bio art and design. Let's have a look at the three winning projects of this year.

Visual of Next Gen: De-exctincting the mammoth with Wendi Yan

Next Gen: De-exctincting the mammoth with Wendi Yan

What if an ancient mammoth found herself resurrected by humans into our modern age?

Visual of A Model's Body

A Model's Body

Dutch photographer Koen Hauser blends parts of the human body with parts from anatomical models. You know, the ones you had in biology class and gave you this fine colorful …

Visual of Friending, Ancient or Otherwise

Friending, Ancient or Otherwise

By ALEX WRIGHT, Published in NY Times December 2, 2007 The growing popularity of social networking sites like Facebook , MySpace and Second Life has thrust many of us into a new …

Visual of Rhythm robot Keepon

Rhythm robot Keepon

The goals of "understanding humanity" and "humanizing robots" are tightly related to each other. Infanoid Project is trying to relate robotics to human sciences in order to …

Visual of Remote pets

Remote pets

Humans have domesticated animals for thousands of years. The earliest known evidence of a domesticated dog is a jawbone found in a cave in Iraq and dated to about 12,000 years ago …

Visual of Tail communicator

Tail communicator

'The LED Dog Tail Communicator' is an initiative of James Auger and Jimmy Loizeau, and it is part of the larger 'Augmented Animals' project. Its focus points to technological …

Visual of Artificial 'Trees' to Stop Climate Change

Artificial 'Trees' to Stop Climate Change

The fabrication of forests with artificial trees is one of the best strategies to stop climate change, according to scientists of the Institution of Mechanical Engineers . The …

Visual of Bacteria that Turn CO2 into Energy

Bacteria that Turn CO2 into Energy

We’ve written earlier about man–made bacteria that eat waste & shit petrol . How about a genetically modified bacteria that can eat CO2 and excrete methane that could power …

Visual of DrinkPeeDrinkPeeDrinkPee

DrinkPeeDrinkPeeDrinkPee

Drinkpeedrinkpeedrinkpee is a project by Britta Riley and Rebecca Bray about the role our bodies play in larger ecosystems. It's an installation about the Urine to Fertilzer DIY …

Visual of Ear on your arm? Why not?!

Ear on your arm? Why not?!

For over 40 years Australian artist Stelios Arcadious Stelarc has made art with medical instruments, prosthetics, robots, virtual reality systems and biotechnology to investigate …

Visual of Liberate the Breast Cancer Genes

Liberate the Breast Cancer Genes

On May 12, 2009 the ACLU and the (not-for-profit) Public Patent Foundation, filed a lawsuit, charging that patents on two human genes associated with breast and ovarian cancer are …

Visual of Mapping the DNA World

Mapping the DNA World

DNA related tools, once expensive and restricted to research and crime labs, are rapidly becoming affordable. Like GPS – once a high-tech wonder now turned into a everyday gadget …

Visual of Objects of Desire

Objects of Desire

Created by  Alex Sandwell Kliszynsk . Via Posthuman blues .

Visual of Plastic Birds

Plastic Birds

Bird spotting is not a typical activity for us next nature explorers, yet occasionally we bump into some birds worth mentioning (remember the amazing copy-paste bird , rubber duck …

Visual of Supermarket – Our Next Savanna

Supermarket – Our Next Savanna

We are living in the future and we find it boring. The best place to gather evidence for this claim is the supermarket. To begin with, try and have a fresh look at the word:  …

Visual of Tattooed Goldfishes

Tattooed Goldfishes

If a tattooed pig is a bit too much for you, why not go for a tattooed goldfish? They bring you lost of luck and are available Chinese characters such as “Wealth, Dragon, …

Visual of Think Hello

Think Hello

Remember Asimo ? Honda has now developped a new Brain-Machine Interface technology that allows humans to control the humanoid robot simply by thinking certain thoughts. The BMI …

Visual of Cultivating the Money-verse

Cultivating the Money-verse

Alright, we were mistaken. Money isn't virtual after all.   A recent TV commercial of a Greek bank shed light on the issue. Your money lives, is anthropomorphic and inhabits an …

Visual of Geminoid Female

Geminoid Female

Professor Hiroshi Ishiguro ( Intelligent Robotics Laboratory at Osaska University) has done it again! This time in coöperation with robot-maker Kokoro Co. Ltd . Objective: to …

Visual of Next Nature Movie #1: Quest for Fire

Next Nature Movie #1: Quest for Fire

The Quest for Fire (1981) shows the Next Nature of 80.000 BC. Set in a world without highways, supermarkets, airports, Internet, television, farming, money or written language, …

Visual of Next Nature Movie #3: Koyaanisqatsi

Next Nature Movie #3: Koyaanisqatsi

Koyaanisqatsi (1982) is a film with no actors, no storyline, and no dialogue. The only things we see are landscapes, images of cities, and people going about their regular lives. …

Visual of US Judge Rules Gene Patents Invalid ?because they are Natural

US Judge Rules Gene Patents Invalid ?because they are Natural

Did you know that about 20 percent of your body isn't really yours? It has been patented by some corporation you probably never heard of. You can't patent gold, you can't patent …

Visual of American Hyperbodies

American Hyperbodies

Lady Gaga is famous for fashion that exaggerates or obscures her body, but a few months ago, she made a foray into 'actual' body-modification. Gaga appeared on Jay Leno's talk …

Visual of Birdfeeders spit Blackcaps in two species

Birdfeeders spit Blackcaps in two species

Until now, most people have likely regarded bird-feeders as merely a pleasant addition to their gardens. But scientists have now discovered that bird-feeders in the UK are …

Visual of City Rats Love Ethnic Food

City Rats Love Ethnic Food

City rats, it seems, prefer the same foods that humans do: Greasy, fatty, sweet, and salty. Although rats are usually seen as the billy goats of city life, ready to chow down on …

Visual of Evolutionary Janitors

Evolutionary Janitors

We normally think of polluted water as the source of disease, not the cure for it. The Gowanus Canal in Brooklyn, affectionately known as the Super Fun Superfund , is one of the …

Visual of Flap to Freedom

Flap to Freedom

It works like this. Position yourself with a friend in front of a battery hen and flap your arms as fast as you can when the music sets in. The harder you flap the faster your …

Visual of Manko & Life [#8]

Manko & Life [#8]

Manko sighed. Nada: 'Did you like it?' Manko: 'I have to admit that if this is the starter, I'm not sure I'll survive the main course.' Everyone at the table laughed. Manko: 'Let …

Visual of Mapping the Utilisphere

Mapping the Utilisphere

Earth has had a geosphere, atmosphere and biosphere for a few billion years. Only within the last several thousand years has earth gained a global noosphere, the intangible …

Visual of Next Nature Services

Next Nature Services

Intentionality separates culture from nature. A dog is intentional, a fox is not; a park is intentional, a forest is not. Since trash, ruined buildings, and automated computer …

Visual of Protei, the Sail Bot that Cleans Up Oil

Protei, the Sail Bot that Cleans Up Oil

Protei is a sailing robot that's designed to clean up oil spills without human assistance. After sailing upwind, the bot drifts downwind, zigg-zagging across the surface to absorb …

Visual of The Cat Parasite that Sells Motorcycles

The Cat Parasite that Sells Motorcycles

The protozoa Toxoplasma gondii makes an unobtrusive home in nearly every warm-blooded species, but it's prolific life is limited: Toxo can only reproduce in cat stomachs. The …

Visual of The Incredible Shrinking Man

The Incredible Shrinking Man

It has been a trend for people to grow taller and taller during the evolution. When people get taller, they will need more energy, food and space. Since the human population is …

Visual of The Soul is a Plastic Bag

The Soul is a Plastic Bag

In the film Plastic Bag , the title character spends a lifetime (or more) on a quest for a creator not even aware of his existence.  A stunning short by Ramin Bahrani, director of …

Visual of A Clockwork Forest

A Clockwork Forest

Has nature become a fairytale or do we want it to be one? In their installation The Clockwork Forest , artist collective Greyworld seems to opt for the latter. The work of art …

Visual of A Fake Sun for Your 25/7 Life

A Fake Sun for Your 25/7 Life

The earth operates on a 24 hour cycle, and so do humans. For most of history, we didn't have much choice in the matter. However, in the absence of visual cues light sunlight, some …

Visual of Bonobos (And Maybe Baboons) Domesticated Themselves

Bonobos (And Maybe Baboons) Domesticated Themselves

While evidence indicates that humans  domesticated themselves , we're not the only primates capable of self-domestication. Bonobos and baboons have shown they are just as capable …

Visual of Rule #7: Respect Social Standards

Rule #7: Respect Social Standards

Anthropomorphic products enter the human social space. Humans have the most complex social behavior of any organism on Earth. Anyone or anything trying to join in should be careful to do it right.

Visual of Is Life on Earth Suicidal?

Is Life on Earth Suicidal?

At Next Nature, we often argue that "our image of nature as static, balanced and harmonious  is naive and up for reconsideration ." Paleontologist Peter J. Ward happens to agree. …

Visual of Where Be Dragons? Try Your Instinctual Fear of Snakes

Where Be Dragons? Try Your Instinctual Fear of Snakes

This last Monday rang in the Chinese Year of the Dragon. Not restricted just to the benevolent, snake-like creature of Chinese mythology, or to the greedy, princess-stealing …

Visual of A Frankenstein-esque System

A Frankenstein-esque System

The boundary between humans and machines is slowly but steadily blurring. The Immortal is a machine which exists out of several life-support machines connected with wires and electric cords.

Visual of A Lifetime of Questions through Google

A Lifetime of Questions through Google

Google becomes the authority on existential questions about aging.

Visual of Brick Era

Brick Era

Mankind has expanded the variety of stones found on the planet.

Visual of Customizing the Brain with Psychoactives

Customizing the Brain with Psychoactives

It’s long been a desire of the human species to have complete control over our own thoughts. We’ve all had these moments where we curse our brain. Asking questions like: “Why …

Visual of EcoBot III: a Robot that Produces Energy Fueled by Organic Matter

EcoBot III: a Robot that Produces Energy Fueled by Organic Matter

There are robots that look like people, and then there are robots, like the Ecobot III, that look nothing like humans but have our same biological needs: they have to eat, digest …

Visual of Electric Skin Could Allow Robots to Feel

Electric Skin Could Allow Robots to Feel

A new kind of piezotronic transistor mesh could make for robotic skin that’s as sensitive as your own is, covered in thousands of tiny mechanical hairs.

Visual of Fuel Your Body With Algae Headgear

Fuel Your Body With Algae Headgear

Algae as the future alternative fuel for the human body.

Visual of Why Meat Grown in Labs is the Next Logical Step for Food Production

Why Meat Grown in Labs is the Next Logical Step for Food Production

Lab grown meat is part of the trajectory that agricultural technology is already following.

Visual of Project Genesis

Project Genesis

We serve our systems as much as they serve us.

Visual of What Will We Look Like in 100,000 Years?

What Will We Look Like in 100,000 Years?

In 100,000 years human beings might look like a manga character: big intense eyes, high forehead, large head, straight nose, more pigmented skin, and perfect symmetry. “There will …

Visual of Growing Crops with Video Projections

Growing Crops with Video Projections

Growing plants with projected YouTube videos.

Visual of How Technology becomes Nature

How Technology becomes Nature

In this talk at TEDxGhent, our own Dr. Van Mensvoort shows how technology becomes nature in seven steps and what engineers, inventors, designers and entrepreneurs can learn from that.

Visual of In Vitro Meat: Animal Liberation?

In Vitro Meat: Animal Liberation?

Many people welcome in vitro meat because of what it may mean for animals. Even though they often find the idea strange, the promise for animals is widely felt as a source of hope.

Visual of Painting the Anthropocene

Painting the Anthropocene

Govedare paints the human impact on natural environments, showing how nature has become a subset of culture.

Visual of The Earth As You've Never Seen It Before

The Earth As You've Never Seen It Before

Breathtaking satellite images that will change how you see the World.

Visual of Transportations Of The Future

Transportations Of The Future

A selection of nine enthralling and striking concepts of future way of transportation.

Visual of Cities Evolve in Similar Ways as Galaxies

Cities Evolve in Similar Ways as Galaxies

Scientists think the laws governing the structure of galaxies in outer space are the same laws underlying the growth of cities.

Visual of Did a Robot Grow your Vegetable?

Did a Robot Grow your Vegetable?

The world’s largest indoor farm  is not the only firm developing vertical agriculture. Japanese company  Spread plans to grow more than ten million heads of lettuce a year by …

Visual of Dynamic Exoskeleton Chair

Dynamic Exoskeleton Chair

An exoskeleton chair that allows the body to move freely.

Visual of IBM Predicts Artificial Intelligence Future

IBM Predicts Artificial Intelligence Future

While the Watson technology is exponentially increasing its processing power on an annual basis and steadily moving from answering trivia questions, to cooking advice, onto medical advice, it is about time we confront it with the million dollar question: "Watson, what do you want?".

Visual of Meet the Band Aid of the Future

Meet the Band Aid of the Future

This potentially revolutionary device includes LED lights and temperature sensors to provide medication directly to the wounded section of the skin.

Visual of Our Bodies, Our Fuel

Our Bodies, Our Fuel

This piece from Ars Technica details the breadth in the variety of energy sources emitting from our every day interactions.

Visual of Stewart Helps People to Trust Self-Driving Car

Stewart Helps People to Trust Self-Driving Car

Stewart is a tactile interface that mediates the communication between human and self-driving car.

Visual of Stratospheric Sky Garden with Proto Life

Stratospheric Sky Garden with Proto Life

A sky garden of cacti and artificial life forms floating a hundred thousand feet above the Earth's surface.

Visual of How Technology is Becoming More and More Sensitive

How Technology is Becoming More and More Sensitive

Over the past decade scientists have tried to get technology surfaces to be as sensitive as our skin, especially as our fingertips. Human tact is a very sophisticate interface …

Visual of Turning Poop Back Into Food

Turning Poop Back Into Food

Nasa funded a program to turn astronauts’ poop into food.

Visual of AI Teenage Girl Hit by Depression

AI Teenage Girl Hit by Depression

An AI was intended to improve human-like experiences in regards to the company’s customer service chatbots, but has fallen into a suicidal depression instead.

Visual of C-Sections Caused an Evolutionary Change

C-Sections Caused an Evolutionary Change

C-sections have an unexpected side effect on human evolution. Newborn heads are getting bigger, while the mothers birth cannals are becoming smaller.

Visual of Colorless coral: How climate change is affecting the great barrier reef

Colorless coral: How climate change is affecting the great barrier reef

Our peculiar image of the week comes from the Great Barrier Reef. You've probably seen images of this vibrant underwater attraction before. If you're lucky, maybe you've seen it …

Visual of When FB Replaced Editors with Algorithm

When FB Replaced Editors with Algorithm

Facebook had just fired their curatorial team for the ‘Trending’ news section over an algorithm, resulting in false stories attacking a news anchor, a writer, and Mac Donald’s.

Visual of Evolution Will Change the Way We Sleep

Evolution Will Change the Way We Sleep

A group of researchers is working to optimize the way we sleep, increasing our relaxation, and therefore reducing the time devoted to our naps.

Visual of Getting Wasted on Plastics

Getting Wasted on Plastics

A new community currency that rewards recyclers with local discounts and deals.

Visual of How We Domesticated Food

How We Domesticated Food

We tend to believe that the fruit and the vegetables we eat today are "natural" and the same as they always were. It turns out that in the past this familiar food didn't look like this at all.

Visual of Designer Dave Hakkens is putting plastic waste to better use

Designer Dave Hakkens is putting plastic waste to better use

We recently handed this year’s ECO Coin Award to Dutch designer Dave Hakkens, founder of the Precious Plastic movement. With his open sourced recycling machines, he provides people around the world the knowledge to start recycling plastic locally.

Visual of Landfills Cause Changes in Bird Migration

Landfills Cause Changes in Bird Migration

Garbage dumps may not be very attractive places for us but they sure are for animals. A study published in Science Advances shows how certain groups of storks modified (and …

Visual of Medical Practice Aided by Robots

Medical Practice Aided by Robots

Robots in health care could lead to a doctorless hospital.

Visual of The New Era of Tourism is Underwater

The New Era of Tourism is Underwater

Sleeping underwater has always been your dream? Thanks to an ambitious project it will be soon reality.

Visual of Are Robots the Future of Tattoos?

Are Robots the Future of Tattoos?

An industrial robot just tattooed the first person ever in San Francisco.

Visual of Storing Knowledge for Eternity

Storing Knowledge for Eternity

Researchers discovered a way to store data in five dimensions on a nano structured glass able to survive for billion of years.

Visual of The Supermarket with No Employees

The Supermarket with No Employees

This automated store in Sweden doesn’t have any human employees, only a smartphone app.

Visual of Vacation in the Era of Marine Pollution

Vacation in the Era of Marine Pollution

While we can’t just leave the coast permanently without upsetting the delicate balance of this new environment we created, we can take better care of it to ensure that it is around for years to come.

Visual of 2017 - Artificial Womb Incubates Fetal Lamb

2017 - Artificial Womb Incubates Fetal Lamb

A lamb born at the equivalent of 23 weeks in a human gestational period was kept alive in an artificial womb and developed just as if it was in a normal womb.

Visual of Digital Detox: Disconnect to Reconnect?

Digital Detox: Disconnect to Reconnect?

Do you feel information overloaded? Do you experience stress? Do you feel like you are addicted to your smartphone, laptop, or the Internet? Get yourself digital detoxed!

Visual of Explore Depths from Your Chair

Explore Depths from Your Chair

To explore deep sea Standfort University developed OceanOne: a humanoid diving robot, which at the same time creates a simulation of the underwater experience on land.

Visual of Female Menstrual Cycle on a Computer Chip

Female Menstrual Cycle on a Computer Chip

The complicated system of a female menstruation cycle was reproduced on a computer chip for the first time.

Visual of A Floating Gym in Paris

A Floating Gym in Paris

This floating gym harnesses human energy to sail down the Seine River in Paris.

Visual of HUBOT: Meet the Robot Coach

HUBOT: Meet the Robot Coach

Craftsmanship is generally very appreciated, but it takes a lot of time to master a craft. Therefore, as a robot coach you train - you guessed it, a robot - to transfer your …

Visual of The New Male Birth Control

The New Male Birth Control

A new contraceptive has appeared on the horizon, bringing the prospect of an alternative form of male birth control one step closer.

Visual of Preventive Punishment for Robots

Preventive Punishment for Robots

The Punishment is an installation featuring a robotic arm that mimics a kid's handwriting perfectly, and repetitively writes "I must not hurt humans".

Visual of Jobs for Facilitators - Robots at Work #3

Jobs for Facilitators - Robots at Work #3

This is post number three of our serie 'Robots at Work'. In this episode we present you five jobs for facilitators, the ones who love to work with technology.

Visual of Building a City on Mars by 2117

Building a City on Mars by 2117

The United Arab Emirates released plans to build a city on Mars.

Visual of Untouched Nature? Not in the Amazon

Untouched Nature? Not in the Amazon

The Amazonian rainforest was already transformed over two thousand years ago by people who built hundreds of large, mysterious earthworks.

Visual of This bio-brick is made out of urine mixed with sand and bacteria

This bio-brick is made out of urine mixed with sand and bacteria

The world’s first bio-brick grown from human urine has been unveiled by University of Cape Town (UCT) master’s student in civil engineering Suzanne Lambert, signalling an …

Visual of Towards a design brief for the artificial womb

Towards a design brief for the artificial womb

Humanity is facing the disconnection between biological reproduction and the body, facilitated by the emerging technology of the Artificial Womb. Envisioned in bleak science …

Visual of Edible packaging: Seaweed could replace plastic in disposable packaging

Edible packaging: Seaweed could replace plastic in disposable packaging

What to do about the plastic planet ? The seas are steadily filling up with plastic , and it's vital to find ways to address the problem . One way to do this is to move away from …

Visual of Next hospitals: How virtual reality is shaping the future of medicine

Next hospitals: How virtual reality is shaping the future of medicine

And it’s already showing incredible results. VR transports us to faraway worlds without even asking us to leave our chairs. Yet we usually hear about it in the context of video …

Visual of A next natural landscape of bikes

A next natural landscape of bikes

It was just little over a year ago that bike sharing schemes started to take off in China. Yet in the blink of an eye, millions of bikes painted in vivid colours, popped up in and …

Visual of Space Tourism: Your next vacation destination might not be on Earth

Space Tourism: Your next vacation destination might not be on Earth

Back in the mid-twentieth century, before the first moon landing, people had all sorts of ideas about the golden age of space travel in front of them. Colonize the moon! Fly …

Visual of The New Technology in Agriculture: Trees

The New Technology in Agriculture: Trees

New technologies are changing the landscape, but the latest trend reshaping rural environments and agriculture is agroforestry: the art of planting trees.

Visual of Next Nature is hiring an army of bots

Next Nature is hiring an army of bots

As we showed with HUBOT , we can use new technologies and robotics to make our work more enjoyable, interesting and humane. Aside from our speculative jobs, a lot of robotic …

Visual of The artificial womb: dream or nightmare?

The artificial womb: dream or nightmare?

The emerging technology of the artificial womb confronts us with a series of moral and societal questions. How to cope with that? Join us on 29 March at Eindhoven University of …

Visual of The remaining numbers of endangered animal species shown in pixels

The remaining numbers of endangered animal species shown in pixels

Today is World Animal Day , a day to put the spotlight on man's best friends in order to improve their welfare standards around the globe. At Next Nature HQ, we honor this day by …

Visual of Why not all buildings have sustainable green roofs

Why not all buildings have sustainable green roofs

Rooftops covered with grass, vegetable gardens and lush foliage are now a common sight in many cities around the world. More and more private companies and city authorities are …

Visual of Oded Ezer discusses the future of typography and the importance of dreaming

Oded Ezer discusses the future of typography and the importance of dreaming

Oded Ezer is a typographer from Israel who never fails to push boundaries, or rather, discard them altogether. Ezer is a rebellious force that swings between commercial and …

Visual of Pirjo Kääriäinen on new ecological biomateriality

Pirjo Kääriäinen on new ecological biomateriality

Meet Pirjo Kääriäinen, professor of design driven fibre innovation at Aalto University, Finland. Kääriäinen founded CHEMARTS —a collaborative program at the university that brings …

Visual of These are the meltwater lakes of Antartica

These are the meltwater lakes of Antartica

During the Antarctic summer, thousands of mesmerising blue lakes form around the edges of the continent’s ice sheet, as warmer temperatures cause snow and ice to melt and collect …

Visual of Next Generation: Unleashing nature’s untapped potential with Amelie Unger

Next Generation: Unleashing nature’s untapped potential with Amelie Unger

This story is part of Next Generation , a series in which we give young makers a platform to showcase their work. Your work here? Get in touch and plot your coordinates as we …

Visual of 14 Golden Rules of working with a robot

14 Golden Rules of working with a robot

The 14 Golden Rules of HUBOT are rules of conduct which must be followed and which everyone needs to hold each other to account. Themes like respect, teamwork, creativity, and …

Visual of Blocking the sun with dust

Blocking the sun with dust

In the past few years, scientists have hatched some pretty crazy-sounding schemes in the name of protecting Earth and its inhabitants. From building an underwater wall 120 …

Visual of Why we need to get better at predicting space weather

Why we need to get better at predicting space weather

The Sun is the most important source of energy for sustaining life on Earth, but it gives us a lot more than just light and heat. It also gives us solar storms.

Visual of Next Generation: Launching the Eva Biodesign Lab with Carlos Silveira

Next Generation: Launching the Eva Biodesign Lab with Carlos Silveira

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Mapping the world's DNA

Mapping the world's DNA

The Earth BioGenome Project is aiming to create a database of genomes of all organic life on earth within 10 years.

Visual of The Cyborg Foundation is fighting for cyborg rights

The Cyborg Foundation is fighting for cyborg rights

Cyborgs - part human, part machine - are becoming more present in society, but their rights are not yet established.

Visual of Next Generation: Fantasising about fashion with ShirpShiro

Next Generation: Fantasising about fashion with ShirpShiro

Finding realistic solutions to the humanitarian and environmental issues in the textile and fashion industries.

Visual of We’re all radioactive – life isn't possible without it

We’re all radioactive – life isn't possible without it

Most radiation is natural and life on Earth wouldn’t be possible without it.

Visual of Bacteria might have eaten the Titanic's wreckage by 2030

Bacteria might have eaten the Titanic's wreckage by 2030

In 1912, the RMS Titanic met a fateful demise as it crashed into the depths of the North Atlantic Ocean, leaving a mark on the world's collective memory, and igniting a lasting …

Visual of This billionaire wants to live forever

This billionaire wants to live forever

From the mythical fountain of youth to the many anti-aging procedures available today: humans have dreamed of internal youth for a long time already. At lot of us perceive aging, …

Visual of Scoring music hits with Grimes using her Elf. Tech

Scoring music hits with Grimes using her Elf. Tech

The music industry is witnessing drastic changes. With the emergence of artificial intelligence technology, no industry has been left untouched and there are broad discussions …

Visual of Whoops! Our sustainability efforts are warming the oceans

Whoops! Our sustainability efforts are warming the oceans

Cleaning up ships' pollution is making the ocean warmer than expected. Less pollution means less cooling clouds, heating up the Atlantic.

Visual of Why NASA sends giant disco balls into space

Why NASA sends giant disco balls into space

In the 1970s, NASA and the ASI launched a giant disco ball into space. Its purpose? Teaching the humans of today and the civilizations of tomorrow about Earth.

Visual of Playing Pong with lab-grown brains

Playing Pong with lab-grown brains

Biotechnology startup Cortical Labs successfully guided human brain cells in a petri dish through a simulated game of Pong.

Visual of Why looking at beaver dams might save the world

Why looking at beaver dams might save the world

Eddie Corwin studies beaver dams and ponds from satellite images in order to restore watercourses and wetlands, and establish nature reserves.

Visual of How to design a digital democracy

How to design a digital democracy

10 design requirements to fully immerse ourselves into the 21st Century—in which technology makes our world richer, not poorer.

Visual of The Material Futures of Central Saint Martins

The Material Futures of Central Saint Martins

Meet United Matters, a London collective exploring how we might live in the future by blurring the boundaries between craft, science and technology.

Visual of Building the farm of tomorrow

Building the farm of tomorrow

Seven examples of how design will help us built the farm of tomorrow.

Visual of Biosphere 2

Biosphere 2

Biosphere 2 is a manmade closed ecological system in Oracle, Arizona. Constructed between 1987 and 1989, it was used to test if and how people could live and work in a closed …

Visual of They are made out of meat

They are made out of meat

A short story by Terry Bisson. For those who prefer video to literature, there's also this seven-minute film adaptation . "They're made out of meat." "Meat?" "Meat. They're made …

Visual of Diesels Global Warming Ready Campaign

Diesels Global Warming Ready Campaign

The Earth is heating up. The sun will blow up within 5 billion years. The human race will probably go extinct before entering the posthuman stage, or the probabillity that we are …

Visual of French Aids Campaign

French Aids Campaign

This French Aids campaign is a wonderful example of biomimicmarketing (using images of old nature for propaganda or marketing purposes). They may be disturbing but the message …

Visual of Printing virtuality

Printing virtuality

Phone, internet, television, photography, even books or music: today it is hard for the mind to escape from virtual worlds. A day without communication or interaction could make …

Visual of Vin Memoriam

Vin Memoriam

The Vin Memoriam concept introduces a new ritual in the mourning process after losing a loved one. When a person has passed away, a small amount of blood can be processed into a …

Visual of Amsterdam Weekly on the Natural Revolution

Amsterdam Weekly on the Natural Revolution

The free cultural paper Amsterdam Weekly discusses the Natural Revolution of and includes tree tips for successful living in the next version of nature. Download PDF (148kb) . …

Visual of China controls weather for olympics

China controls weather for olympics

The sun always shines on TV in China. "At this summer’s Beijing Olympics, China puts a 50-year experiment to the test: Officials are betting weather modification can keep the sun …

Visual of Killer Robots

Killer Robots

Rule #1:  A robot may not injure a human being or, through inaction, allow a human being to come to harm. Remember Isaac Asimov's classic  three laws of robotics ? Surely thats …

Visual of Luxalive - The emotionally aware lamp

Luxalive - The emotionally aware lamp

So you thought that animated Pixar Lamp from the movies was just a fantasy? Not anymore. Luxalive is a prototype of an reading lamp that moves according to the character of its …

Visual of BVPS Next Nature in LA - Pictures!

BVPS Next Nature in LA - Pictures!

May 17th 2008. Biggest Visual Power Show: Next Nature in LA . More pictures below. We are all born in a world that has been designed already. BVPS intro video by Floris Kaayk. Big …

Visual of Blood Cells 2.0

Blood Cells 2.0

Unlike many people fear that computers will overtake humans, Ray Kurzweil states that robots will merge with humans, robots the size of cells which can do the job way more …

Visual of Crash course on synthetic genomics

Crash course on synthetic genomics

Next Monday when your colleagues ask you what you have been doing for the weekend, you might answer you something default like you went out with friends, danced, biked to the …

Visual of From Genes, to Memes, to Temes

From Genes, to Memes, to Temes

Susan Blackmore studies memes: ideas that replicate themselves from brain to brain like a virus. She makes a bold new argument: Humanity has spawned a new kind of meme, the teme, …

Visual of Green Glowing Monkeys

Green Glowing Monkeys

Japanese researchers of the Central Institute for Experimental Animals , took a green fluorescent protein gene of a jellyfish, wove it into the DNA of a few marmosets embryos, …

Visual of Green Vibes

Green Vibes

The big lobby to endeavor for a climate neutral lifestyle must have reached its peak. It is common knowledge that recycling electronic and battery operated utensils is better for …

Visual of Nanotechnology Crashcourse

Nanotechnology Crashcourse

This mashup video project integrates various video clips that ask: What is nanotechnology? Via Posthumanblues , via Futureblogger . See also: Small Talks , Bacteria Bots , …

Visual of Pollution trading – savior or scam?

Pollution trading – savior or scam?

While most people are still prudently changing light bulbs and recycling coffee cups to fight global warming – or at least their gnawing conscience – policy-makers have long moved …

Visual of Branded Pigs

Branded Pigs

What are these people doing? Of course! They are tattooing a pig with the pattern of the luxury bag brand Louis Vuitton. For those who want something more special than the mundane …

Visual of 3D Bioprinter promises tissue on demand

3D Bioprinter promises tissue on demand

Behold "the world's first production model 3D bio-printer." A machine capable of arranging human cells and artificial scaffolds into complex three-dimensional structures, which …

Visual of Goodbye, Nature vs Nurture

Goodbye, Nature vs Nurture

Talking about nature and nurture as separate, clear-cut forces is far adrift from the complexities of developmental science, says Evelyn Fox Keller in NewScientist . ONE of the …

Visual of Nano Supermarket – Jury Report

Nano Supermarket – Jury Report

Nanotechnology is an important emerging technology of our time – it radically intervenes with our sense of what is natural – yet most people are still relatively unaware of its …

Visual of Next Nature Movie #10 – Idiocracy

Next Nature Movie #10 – Idiocracy

As we are nearing the end of the year, and anticipate you might have some time to watch a film, we discus our top 10 Next Nature movies. Idiocracy (2006) is not a great film, …

Visual of Outer-Space as Local-Space

Outer-Space as Local-Space

In 1977, NASA launched Voyager 1 and Voyager 2, two unmanned interplanetary space probes that were sent out to explore the outer space. Aboard each was a record which intended to …

Visual of Reading the Body: Finger Length Ratio Predicts Athletic Ability

Reading the Body: Finger Length Ratio Predicts Athletic Ability

The human body is increasingly recognized as a biometric source of information for a wide spectrum of issues, including security, psychopathology, personality and health. Earlier …

Visual of The Buttons

The Buttons

Nowadays buttons are completely mundane and natural objects in our environment. You find them on phones, alarm clocks, keyboards, elevators, dishwashers and of course on the …

Visual of The Virtual Lives of Extinct Animals

The Virtual Lives of Extinct Animals

What happens when next nature dreams of old nature? Such is the case with extinct animals that have ever come in contact with humans, particularly the dinosaurs, our own …

Visual of To Milk the Cows, Click here

To Milk the Cows, Click here

In millions of offices and homes around the world, people are hard at work planting crops, feeding cattle and tilling their land. Welcome to Farmville , the digital rural world …

Visual of Urban Dolls

Urban Dolls

The idea of altering your body for aesthetic purposes is still somewhat frowned upon today. But more than because the very idea of improving yourself, this is about its …

Visual of When Dreams become a Commodity

When Dreams become a Commodity

As neuroscience progresses, we gain access to previously inaccessible and unexplored areas of the human mind. Consequentially the intricate processes in our brain are cultivated …

Visual of Babel Fish

Babel Fish

Researchers are working on a language and a device that will help humans and dolphins talk with each other. Denise Herzing , a researcher and founder of the Wild Dolphin Project …

Visual of Living Life Support

Living Life Support

Designer Revital Cohen imagines a future where life-support machines are replaced with life-support animals. In this scenario, a transgenic lamb is allowed to frolic in the fields …

Visual of Monkey See, Monkey Buy

Monkey See, Monkey Buy

Yale researchers and advertising executives have created the first ad campaign aimed at animals.  The targets in question are a group of captive capuchin monkeys with a taste for …

Visual of Nano Skin Prosthetics

Nano Skin Prosthetics

Nano-skin may let amputees feel again.

Visual of New steps to meld mind and machine

New steps to meld mind and machine

Until now we've seen the types of brain-computer interface where the human has to put on some sort of bulky hat full of wires to control a machine. It won't be like that for long: …

Visual of Think Breast is Best?  Try Udder

Think Breast is Best? Try Udder

Scientists in China have created transgenic cows that produce 'human' milk.  The researchers boosted the fat content of the milk and added three types of proteins, unique to …

Visual of Unboxing Artificial Intelligence

Unboxing Artificial Intelligence

Did you know that phones were once used for calling up our (human) friends? Researching the beginning of it all, we came accross demo video's on the cloud called "internet" where …

Visual of Complete Computer Simulation of a Bacterium Holds Hope for Medicine

Complete Computer Simulation of a Bacterium Holds Hope for Medicine

Researchers at Stanford and the J. Craig Venter Institute  recently created the first complete computer model of an organism. The simulation models the genome and life processes …

Visual of Illiterate Kids Learn to Hack Tablet Computers with No Outside Help

Illiterate Kids Learn to Hack Tablet Computers with No Outside Help

The One Laptop Per Child program is experimenting with what at first seems to be the lazy way to philanthropy: dropping off tablet computers in remote Ethiopian villages  and then …

Visual of Little Green Cows

Little Green Cows

The world is alight with algae fever. In this age of deep ecological design aspirations, the range of speculative design projects based on algae technology is growing. Algae are …

Visual of Magnifiying the Universe

Magnifiying the Universe

Nowadays the human impact on our planet can hardly be underestimated. Climate change, plastic islands, genetic manipulation – ‘We were here’ echoes all over. Yet, every now and …

Visual of Nature Ludens: The Natural World at Play

Nature Ludens: The Natural World at Play

An ingenious Russian crow that used a lid as a snowboard to slide down a snowy roof persuaded millions of YouTube viewers that animals are not merely beasts of burden – they also …

Visual of Robots Invade Stores to Steal Our Jobs

Robots Invade Stores to Steal Our Jobs

There's a new threat to the world's unemployed. Researchers at Carnegie Mellon University have developed a robot that helps to organize shop inventories, making that trip to the …

Visual of Structuring biomimicry, improving building's resiliency

Structuring biomimicry, improving building's resiliency

The same way Einstein assumes the speed of light to be a constant of reference for his Theory of Relativity, the philosophy of biomimicry assumes Nature as a constant of reference …

Visual of Thirsty? With a Cyborg Bladder, You'll Never Need to Drink

Thirsty? With a Cyborg Bladder, You'll Never Need to Drink

Some desert animals, like the kangaroo rat, get through their lives without needing to drink even a drop of water. Now, a Japanese design company aims to make humans just as …

Visual of A Robot to Make Rats Depressed

A Robot to Make Rats Depressed

The robot in the picture above chases and attacks the living rat rights besides it. The W-3, as the robot is named, is designed to make rats seriously depressed. In fact, this …

Visual of Anthropo-scene #4: Longing for Nature

Anthropo-scene #4: Longing for Nature

What one ugly overpass in Berlin reveals about our attitudes towards nature.

Visual of Bionic man

Bionic man

An showcase of what we are currently capable of installing in human beings.

Visual of Bright Streetlights Make Us No Safer, and Why That's Good News

Bright Streetlights Make Us No Safer, and Why That's Good News

Artificial lighting at night makes us fat, depressed and sick. What are the alternatives?

Visual of Chinese Whisper Challenge Pits Man Against Machine

Chinese Whisper Challenge Pits Man Against Machine

Ever played "telephone" or "chinese whispers" as a kid? Now, you can pit your speech recognition skills against a computer.

Visual of Computer Teaches Itself to Play Games

Computer Teaches Itself to Play Games

An algorithm observes human players to learn how to beat Super Mario Bros.

Visual of Get Your One Way Ticket to Mars

Get Your One Way Ticket to Mars

What to do when earth is not enough? Thousands of people, tired of their life on Earth, are ready to emigrate to Mars. Since subscriptions opened on April 22, 80,000 people have …

Visual of How to Turn Skin Cells into a Baby

How to Turn Skin Cells into a Baby

A stem cell experiment with mice may one day mean that same-sex couples could have bio children.

Visual of Implanted into Bacteria, Synthetic DNA Functions as a Diagnostic Computer

Implanted into Bacteria, Synthetic DNA Functions as a Diagnostic Computer

In the movie Fantastic Voyage, a submarine and its crew were shrunk and injected into the body of a sick man in an attempt to save his life. Despite the fictional nature of this …

Visual of Invisible Headphone Implants

Invisible Headphone Implants

Invisible ear implants for listening to music, getting directions, and recording conversation.

Visual of Neo-Evolution with Harvey Fineberg

Neo-Evolution with Harvey Fineberg

Humanity has three options when it comes to our evolution. Dr. Harvey Fineberg makes a case for "neo-evolution".

Visual of Next Nature Interview on London Real

Next Nature Interview on London Real

London Real interviewed Koert Van Mensvoort on the concept of Next Nature and its implications on our planet.

Visual of Portrait of MAN

Portrait of MAN

Amazing short animation by Steve Cuts.

Visual of Q&A with CEO of In Vitro Meat Company

Q&A with CEO of In Vitro Meat Company "Modern Meadow"

Excerpts from the Rebbit AMA with Andras Forgacs, founder of a company that manufactures in vitro meat.

Visual of Space Farming for Astronauts

Space Farming for Astronauts

Space Farming: NASA plans to grow a vegetable garden 230 miles above the Earth.

Visual of Animals Love Technology

Animals Love Technology

A macaque stole a tourist's iPhone and fiddled around with it like a human would.

Visual of Anthropocene: the Shrinking of Aral Sea

Anthropocene: the Shrinking of Aral Sea

As a consequence of a big water diversion project to irrigate surrounding areas the Aral Sea is drying up.

Visual of Building a Boat with Marine Plastic Trash

Building a Boat with Marine Plastic Trash

A man from Kenya collected tourists’ disused slippers and seaborne plastic bottles to build a boat.

Visual of Domestication as a Last Refuge

Domestication as a Last Refuge

In glass capsules endangered rainforest flora will be able to survive regardless of what happens to their natural habitat.

Visual of Marine Plastic Creatures

Marine Plastic Creatures

Photographer Kim Preston transforms everyday household plastic objects into sea creatures.

Visual of No Future for Traditional Meat

No Future for Traditional Meat

At Home in the Lab with Mark Post, Father of the In Vitro Hamburger. Interview from The In Vitro Meat Cookbook

Visual of Pixel Space

Pixel Space

If the moon were only one pixel: a scale model of the solar system that shows how big our milky way actually is.

Visual of Plastic Pollution Solution

Plastic Pollution Solution

Is there a possibility to clean up the oceans from plastic pollution?

Visual of Retro Robot Band

Retro Robot Band

The '50s robot band, Le Trio Fantastique, is exemplary of human distant longing for technology that integrates with our body and senses, to the point of taking our place!

Visual of Bowerbirds' Plastic Love Nest

Bowerbirds' Plastic Love Nest

To attract a female, male bower birds build structures and adorn these with colorful plastic decoration.

Visual of Zero-Waste Grocery Store

Zero-Waste Grocery Store

The first Zero-Waste Grocery Store "Original Unverpackt" will open this summer in Germany.

Visual of The Moon will Become a WiFi Zone

The Moon will Become a WiFi Zone

Researchers proved it is possible to provide the Moon with the wireless connectivity we have on Earth.

Visual of WikiGalaxy

WikiGalaxy

Turning 100,000 entries from the Wikipedia into a growing nebula of human knowledge.

Visual of AI is as Intelligent as a Four-Year-Old Kid

AI is as Intelligent as a Four-Year-Old Kid

Computer can already beat us in many tasks. Complicated calculation, processing speed and chess, to name a few. However, generally speaking, you’re still likely to be more …

Visual of Computer Generated Deep Dream

Computer Generated Deep Dream

Turning a normal stroll through the supermarket into a psychedelic dream (or nightmare) of algorithmic pareidolia.

Visual of Harvard Creates Half-Man Cyborg Flesh

Harvard Creates Half-Man Cyborg Flesh

Bioengineers at Harvard University have created the first cyborg tissue.

Visual of This Headset Will Widen Your View of Reality

This Headset Will Widen Your View of Reality

This augmented reality helmet allows the wearers to see all around them without having to turn their head.

Visual of Hearing Colors

Hearing Colors

Thanks to the antenna implanted in his skull, Neil Harbisson can hear images and paint sounds.

Visual of How Many Trees are There on Earth?

How Many Trees are There on Earth?

There are about 3.04 trillion trees on Earth. That is 422 trees per human being.

Visual of Transfigurations: Let's Design People

Transfigurations: Let's Design People

Plastic artist Agi Haines explores hypothetical scenarios for surgically implanted body enhancements in babies.

Visual of Agriculture Isn’t as Green as You Think

Agriculture Isn’t as Green as You Think

Agriculture today isn’t where it needs to be. Here’s how farmers are taking the next step for better agriculture tomorrow

Visual of AI Outsmarts Face Masking Methods

AI Outsmarts Face Masking Methods

The latest researches showed how AI can recognize human faces even if pixelated and meant to be incognito.

Visual of Creating a Second Skin to Look Younger

Creating a Second Skin to Look Younger

Scientists managed to create what every woman has been dreaming of: a second skin to reduce wrinkles and tighten the skin.

Visual of Your Data Is Worth More Than You Think

Your Data Is Worth More Than You Think

How valuable are your data?

Visual of The

The "Dog" That Will Save Lives

A laboratory is developing a synthetic dog that will be used for surgery trials, saving many canine lives and changing the veterinary world.

Visual of 'Fiji Water' Is Purer than Tap Water, No?

'Fiji Water' Is Purer than Tap Water, No?

Researchers tested 'Fiji Water' against ordinary tap water. What they found is kind of shocking.

Visual of The First Fully Autonomous Soft Robot

The First Fully Autonomous Soft Robot

The Octobot is the first of its kind made fully of soft materials and is aimed to pave the way towards a more safely interaction with humans.

Visual of The First Self-Driving City Coach

The First Self-Driving City Coach

Mercedes-Benz just revealed the first self-driving city coach and took it to the streets of Amsterdam for a test drive.

Visual of The Bioengineered Elixir of Life

The Bioengineered Elixir of Life

Scientists say they can reverse aging by reprogramming the genome.

Visual of Greetings from Mars

Greetings from Mars

Since plans for conquering the Red Planet are becoming more serious we should get acquainted with the possible view from up there.

Visual of How Is Hi-Tech Changing Sports?

How Is Hi-Tech Changing Sports?

Hitech is changing sports, but what are the consequences?

Visual of Insects are helping us develop the future of hearing aids

Insects are helping us develop the future of hearing aids

The human ear is a miracle of mechanical evolution. It allows us to hear an astonishing range of sounds and to communicate and navigate in the world. It’s also easy to damage and …

Visual of Computers Need Domestication

Computers Need Domestication

Soon we won’t program computers anymore, we’ll train them like dogs.

Visual of Man Controls Prosthetic Arm with His Mind

Man Controls Prosthetic Arm with His Mind

Researchers at the John Hopkins University School of Medicine succeeded in hooking up a prosthetic arm to the human brain.

Visual of Mentally Disordered Robots

Mentally Disordered Robots

While robots are becoming more and more human, with all their sensors and information processing abilities, may it be likely that they too could develop mental illnesses?

Visual of Rethinking 3D Printing for the Future

Rethinking 3D Printing for the Future

Additivism is a movement that calls for radical rethinking of new technologies, such as 3D printing, the plastification of the world and our human position within it.

Visual of This Robot Takes Care of Your Children

This Robot Takes Care of Your Children

This robot nanny is designed to take on adult responsibilities, raising concerns regarding the consequences of using robots to raise our children.

Visual of A Search Engine for Satellite Imagery

A Search Engine for Satellite Imagery

Terrapattern is a search engine that gathers similar elements of satellite imagery, giving surprising results.

Visual of Self-Driving Trucks Hit the Highways

Self-Driving Trucks Hit the Highways

A driverless convoy of trucks drove through Europe and safely arrived in Rotterdam yesterday.

Visual of Slenderman: the Modern Big Foot

Slenderman: the Modern Big Foot

The new mythical creature hunting our imagination is called Slenderman and is born on the internet. But who is this being and how it came to be? It may just be the modern version of a much older myth.

Visual of Walk, Talk and Get Paid

Walk, Talk and Get Paid

As the digital age makes people more lonely, Chuck McCarthy created a service to walk with strangers.

Visual of Welcome to Chanel Data Center

Welcome to Chanel Data Center

Two robots opened the show of Chanel during the Paris Fashion Week of 2017. Well robots, two models dressed up like humanoid robots entered the catwalk. Is Chanel going Next Nature?

Visual of 2014 - Womb Transplant Baby Born

2014 - Womb Transplant Baby Born

A Swedish woman who had her uterus removed due to cancer in her twenties gave birth to her own child as the world's first person to undergo a uterus transplant. And the donor? Her own mother.

Visual of 3D Printed Ovaries

3D Printed Ovaries

3D printed ovaries help infertile mice to have a healthy offspring.

Visual of Facial Recognition Replaces Passports

Facial Recognition Replaces Passports

Biometric technology replaces passports in Australian airports.

Visual of Add-on Body Parts: Bionic Thumb

Add-on Body Parts: Bionic Thumb

Royal College of Art graduate Dani Clode reframed prosthetics as extensions of the body, rather than replacements for missing parts.

Visual of Cruising Critters Travel the Ocean on Plastic

Cruising Critters Travel the Ocean on Plastic

Tons of living animals have floated from Japan to the United States traveling across the ocean on plastic junk and debris.

Visual of Design Your Own Vegetables

Design Your Own Vegetables

With her project Future Food Formula, food designer Chloé Rutzerveld is looking for innovative methods to design vegetables.

Visual of GM Ants Show How Insect Societies Work

GM Ants Show How Insect Societies Work

Scientists gene modify ants in order to find out more about their social behavior.

Visual of Govert Flint on Enrichers

Govert Flint on Enrichers

NNN fellow Govert Flint discusses Enrichers in Frame magazine.

Visual of NNN Presents HUBOT - The Job Agency for People and Robots

NNN Presents HUBOT - The Job Agency for People and Robots

A horse can run faster than a human, yet nobody claims horses will make mankind dispensable. When a man rides a horse and the two work together, something new happens. Then, what …

Visual of Designer Anouk Wipprecht combines fashion with robotics

Designer Anouk Wipprecht combines fashion with robotics

We met Anouk Wipprecht and talked about smart fabrics and accessories that can listen to our body, therapeutic fashion and the future of dressmaking.

Visual of Opening HUBOT at DDW

Opening HUBOT at DDW

The robots have arrived! Yesterday we celebrated the launch of HUBOT , job agency for people and robots at MediaMarkt , as part of the Dutch Design Week in Eindhoven. Our virtual …

Visual of HUBOT: Meet the Organ Designer

HUBOT: Meet the Organ Designer

As an organ designer, you develop genetic algorithms from which organs are grown to perfectly fit the recipient’s body, but also to meet the personal wishes of the patient.

Visual of Want Plastic with Your Salt?

Want Plastic with Your Salt?

A recent study examining the purity of 17 commercial sea salt brands from eight different countries found microplastics in all 17 samples.

Visual of Plastic Beach

Plastic Beach

While this image seems like another polluted beach after spring break, it was taken on a remote uninhabited world heritage site in the Polynesia.

Visual of Our Relationship with Tech Is Growing Stronger

Our Relationship with Tech Is Growing Stronger

It's getting difficult to discern what's technology and what's not.With wearable technology becoming more and more integrated into society, our lives become infused with more technology.

Visual of Jobs for Entrepreneurs - Robots at Work #4

Jobs for Entrepreneurs - Robots at Work #4

This is post number four of our serie 'Robots at Work'. In this episode we present you five jobs for entrepreneurs, the ones who love doing big business.

Visual of Slaughterbots Video Depicts Killer Bots Nightmare

Slaughterbots Video Depicts Killer Bots Nightmare

This seven-minute video, titled 'Slaughterbots', shows a future in which palm-sized autonomous drones commit untraceable massacres.

Visual of Bacteria Are the New Hard Drives

Bacteria Are the New Hard Drives

DNA is the densest known storage medium in the universe - and Harvard University researchers have managed to use it to store GIFs inside bacteria.

Visual of Tiny Food Made in a Tiny Kitchen

Tiny Food Made in a Tiny Kitchen

A small introduction to tiny cooking.

Visual of Turning Glass Bottles into Sand

Turning Glass Bottles into Sand

A machine lets drinkers instantly turn their empty beer bottles into sand.

Visual of Rescue Drone Will Save You in Open Water

Rescue Drone Will Save You in Open Water

Drone made to rescue in bad weather condition in open waters.

Visual of Virtual Networking, the Future Social Media

Virtual Networking, the Future Social Media

Virtual reality is already becoming a part of the conversation surrounding social media. Will it become the next popular social network?

Visual of Artificial Womb Workshop at Border Sessions

Artificial Womb Workshop at Border Sessions

At Border Sessions Festival in the Hague a workshop was hosted by Next Nature Network on the artificial womb.

Visual of The age of cyborgs has arrived

The age of cyborgs has arrived

How many cyborgs did you see during your morning commute today? I would guess at least five. Did they make you nervous? Probably not; you likely didn’t even realize they were …

Visual of Anthropomorphism Puts a Friendly Face on Autonomous Vehicles

Anthropomorphism Puts a Friendly Face on Autonomous Vehicles

Do you ever look at the bonnet of a car and see a face? Now, designers are looking at how to give self-driving cars the friendliest "faces" they can through anthropomorphism.

Visual of How will the artificial womb affect society?

How will the artificial womb affect society?

Where contraceptives such as the pill disconnect sex from reproduction, in vitro fertilisation disconnects contraception from sex, and the artificial womb would disconnect the …

Visual of Gamers are the new athletes: Sports in video games from Pong to VR

Gamers are the new athletes: Sports in video games from Pong to VR

Sports have always had an important place in human societies, providing entertainment, exercise, and a demonstration of the exceptional things the human body can achieve. But in a …

Visual of HUBOT: Meet the Shiva Therapist

HUBOT: Meet the Shiva Therapist

Meet the Shiva Therapist fro HUBOT. She massages with her own hands, but for the heavy work, she has four additional robotic arms at her disposal.

Visual of How this self-sustainable microhome may change the future of housing

How this self-sustainable microhome may change the future of housing

Looking for a self-sustainable mobile microhome? Ecocapsule got you covered. This cute-as-pie capsule pod allows you to live completely off the grid in a low-energy, mobile …

Visual of Why in the future, we will all wear one piece of garment

Why in the future, we will all wear one piece of garment

It's not an easy task to define the practice of designer Jasna Rok . Fashtech pioneer? Radical innovator? Visionary designer? ‘All of the above’ seems only appropriate. In fact, …

Visual of Next Nature Academy presents: A workshop-in-a-box for your team

Next Nature Academy presents: A workshop-in-a-box for your team

Are you working on projects where technology and human interaction are involved, and are you looking for a new approach? As of today, we offer a brand new workshop concept for you …

Visual of The Great Pacific garbage

The Great Pacific garbage "patch" is now three times the size of France

Mon dieu! The swirling pile of trash in the Pacific Ocean is growing at an exponential rate. A recent study has estimated that the mass of the garbage island is four to sixteen …

Visual of Reimagining popular apps with the Pyramid of Technology

Reimagining popular apps with the Pyramid of Technology

Today, there's an app for everything. They help us satisfy our cravings, allow us to communicate at all times and make it easier to share special moments. But the dark, cold …

Visual of Struck by lightning: Shipping emissions double frequency of lightning storms

Struck by lightning: Shipping emissions double frequency of lightning storms

They say lightning never strikes twice, but it appears to be striking a lot more often in some areas of ocean than others. New research published in Geophysical Research Letters …

Visual of Managing the data deluge: Twitter as a tool for ecological research

Managing the data deluge: Twitter as a tool for ecological research

As early as 2009-10 , researchers were looking at Twitter data mining as a way to predict the incidence of flu. At the time, the H1N1 virus, or “swine flu,” had made the jump from …

Visual of Turning cities into parks: In conversation with Raymond Brouwers on Urban Street Forests

Turning cities into parks: In conversation with Raymond Brouwers on Urban Street Forests

Urban neighborhoods with high-rise concrete buildings are often dreary and gray. Therefore, the Urban Street Forest project aims to color our cities with the planting of vertical …

Visual of The artificial womb: are we ready?

The artificial womb: are we ready?

“Within a few years it will be possible for a premature baby to continue to mature in an artificial womb,” says gynecologist Guid Oei. It is therefore that the Artificial Womb: …

Visual of Beyond biomimicry: a new urgency

Beyond biomimicry: a new urgency

Designers face an unprecedented urgency to alter their methods and reprioritize their goals to address the accelerating degradation of the environment. This new …

Visual of 5 things to do at DDW19

5 things to do at DDW19

Lining up plans for Dutch Design Week ? Once more, 2600 designers gather in over 120 locations during 450 events. So whether you're a local, new in town, or just passing through, …

Visual of How modern technology is inspired by the natural world

How modern technology is inspired by the natural world

What do a kingfisher, cocklebur pods and a Namibian beetle have in common? Besides being living organisms, they have all served as inspiration for creative human technologies to …

Visual of NATURE is an exhibition where biology and design meet

NATURE is an exhibition where biology and design meet

Cube Design Museum in Kerkrade and Cooper Hewitt in New York present the comprehensive exhibition NATURE - in which internationally renowned designers, artists and inventors …

Visual of 10 Next Nature dinner table conversation starters

10 Next Nature dinner table conversation starters

Summer is here and the sun is out, and yes, this is awesome. After a long day in the sizzling summer sun, you get a group of people together to share some delicious food, …

Visual of Should men be able to give birth to children?

Should men be able to give birth to children?

Within a few years, it may be possible for premature babies to grow inside an artificial womb. And when that day arrives, should men be able to give birth to children? Should we …

Visual of Fake for real: Octopus lips

Fake for real: Octopus lips

A recent lip filler trend blew up on social media. 'Devil lips' , or Octopus lips, have attracted divided opinion online. When the body modification hit Instagram, some spectators …

Visual of With this technology we can shake hands during the pandemic

With this technology we can shake hands during the pandemic

“Please refrain from hand shaking" is a common sign we now see as a result of public health organizations advising people to avoid shaking hands as a greeting. As people still …

Visual of Her is an outlook on the possible future of dating a chatbot

Her is an outlook on the possible future of dating a chatbot

With most of us stuck at home because of lockdown, for the singles around us intimacy may have turned into a distant dream. Could we find our salvation in technology? And what …

Visual of How my chatbot fell in love with me

How my chatbot fell in love with me

The virus is forcing all of us to sit at home. While we are allowed to have social contact—albeit at an appropriate distance, intimate contact is hard to find. How to cope with …

Visual of In vitro meat (finally) hits the market

In vitro meat (finally) hits the market

Humanity has an insatiable hunger for meat. Since 2013 we have been researching, developing and campaigning for a humane and eco-friendly way to get our protein fix. Since day one …

Visual of Next Generation: Searching for Null Island with Deborah Mora

Next Generation: Searching for Null Island with Deborah Mora

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of COVID-19 is a virus, corona is a meme

COVID-19 is a virus, corona is a meme

As the viral pandemic continues to spread, so too does the world’s collective uncertainty. As a result, people are turning to media for some levity. And can you blame them. …

Visual of Welcome to the Novacene

Welcome to the Novacene

James Lovelock (1919) has lived on Earth for over a century. You may find that long, but it is short for himself. He thinks big and from a long-term awareness. At the age of …

Visual of Seeing in 3D

Seeing in 3D

If you are a regular reader of content from Next Nature, then you know that 3D printing can be used in all sorts of technological developments, such as organ printing , food waste …

Visual of CO2 injected volcanic rock could save the atmosphere

CO2 injected volcanic rock could save the atmosphere

The rapid technological advancement of the human race has led to many consequences, especially regarding the integrity of the atmosphere that protects all life on Earth. Although …

Visual of Coffee without the beans

Coffee without the beans

As with many of the products we consume, there’s a cost beyond what we pay at the store. Producing coffee has an environmental cost, too.

Visual of Cyborg mythologies #1: plastic surgery & techno-futuristic foretellings

Cyborg mythologies #1: plastic surgery & techno-futuristic foretellings

This is #1 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …

Visual of Bio textiles: meet three designers reimagining materials using biotechnology

Bio textiles: meet three designers reimagining materials using biotechnology

The world needs interdisciplinary creators who are designing not just for humans, but for the rest of the living planet. To foster this thinking, Biodesign Challenge (BDC) pairs …

Visual of Next Generation: Pursuing digital tactility with Studio PMS

Next Generation: Pursuing digital tactility with Studio PMS

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Next nature disasters: the Facebook outage of 2021

Next nature disasters: the Facebook outage of 2021

Where were you on the 4th October 2021? During the day that will be remembered for the Facebook outage, not everyone was equally impacted.

Visual of Donna Haraway rejects the doomsday rhetoric of the Anthropocene

Donna Haraway rejects the doomsday rhetoric of the Anthropocene

For multispecies feminist theorist Donna J. Haraway, “it matters what stories make worlds, what worlds make stories.” She studies the current age as the Chthulucene (chthon, …

Visual of Join the Next Nature Talkshow on biodesign!

Join the Next Nature Talkshow on biodesign!

A living lamp that you need to feed, a tapestry made of animal waste streams and tableware made from algae. Welcome to the wonderful world of biodesign.

Visual of To save forests, researchers are hooking trees up to Twitter (again)

To save forests, researchers are hooking trees up to Twitter (again)

In July 2018, a century-old red oak went live on Twitter. The account @awitnesstree , tweeting from the Harvard Forest in Petersham, Massachusetts, introduces itself in its bio: …

Visual of Turn your garden into living artworks for bees

Turn your garden into living artworks for bees

Art not for people, but for insects. That is the goal of the Pollinator Pathway project by Alexandra Daisy Ginsberg. With her concept she wants to change the way we perceive our …

Visual of What Julia Watson is reading this summer

What Julia Watson is reading this summer

In an era of high-tech and climate extremes, we are drowning in information while starving for wisdom. Architect Julia Watson imagines a design movement building on indigenous …

Visual of How technology will help us adapt to climate change

How technology will help us adapt to climate change

Climate change will transform how we live, but these tech and policy experts see reason for optimism

Visual of FIBER Festival 2022: an exploration towards an alternative future

FIBER Festival 2022: an exploration towards an alternative future

FIBER Festival explores the future of a changing world through audiovisual art, daring conversations, and experimental electronic music.

Visual of Next Generation: Tasting Landless Food with Malu Luecking

Next Generation: Tasting Landless Food with Malu Luecking

Regeneration of extinct flavor families via microalgae 

Visual of Next Generation: Changing the oceans chemistry with Santa Ramaherison

Next Generation: Changing the oceans chemistry with Santa Ramaherison

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Hurray! There are now vaccines for honeybees

Hurray! There are now vaccines for honeybees

A significant milestone has been reached as the US Department of Agriculture has granted approval to a vaccine for insects for the very first time. An important breakthrough, …

Visual of How to control electronic devices with your mind

How to control electronic devices with your mind

Controlling devices with your mind. Unreal? Think again. Brain-computer interfaces have been changing the game in healthcare, gaming, and accessibility lately.

Visual of Next Gen: Digitizing wilderness with Freyja Sewell

Next Gen: Digitizing wilderness with Freyja Sewell

Freyja Sewell decided to utilise the pandemic to rediscover her connection with nature by immersing herself in the wilderness in complete silence.

Visual of We now have satellite traffic jams in space

We now have satellite traffic jams in space

It seems that traffic jams aren't just a problem confined to Earth's highways and byways. How did this happen? And should we be concerned?

Visual of How to design your (home)office

How to design your (home)office

Designer Govert Flint proposes a new office concept, entirely based on movement and play.

Visual of The Petunia Carnage

The Petunia Carnage

To pay tribute to the destroyed orange petunias during the Petunia crisis, Klaus Pichler has composed an illustrative book.

Visual of N is for Nature

N is for Nature

There are people who think what makes a good wine comes from nature - factors like rain and soil and temperature. Then there are those who think it's a matter of second nature - …

Visual of Nature So-called

Nature So-called

Nature is not what it used to be. Or at least that is what we may think, when we look at the way humans and their technologies have treated nature. When we speak of "nature", …

Visual of The infoBreath

The infoBreath

A flower arcing from a frosted pane of glass. Rigged with a breath sensor and connected to an internet packet sniffer, the flower is cued in to the wireless network flowing in the …

Visual of 10 Biomimic Gadgets

10 Biomimic Gadgets

Coming across an image like this, makes one wonder at first: is it a giant punch-bag? Some sort of soft water-drop-sculpture? No, it is the Emergency Outdoor Survival Cocoon , …

Visual of A hunt for hightech

A hunt for hightech

In "A Hunt for High Tech", Bart Hess seeks to harness both nature and technology and create armoured skin and fur for a new human archetype incorporating animalistic and …

Visual of CrackBerry addicts are suing their Employers

CrackBerry addicts are suing their Employers

No self-respecting manager would be without a BlackBerry. But now these handheld gadgets, which provide workaholics with constant email updates, are being blamed for chronic …

Visual of Crop Circles

Crop Circles

In the UK farmers recall simple circles appearing on their land for generations. The British media first reported on the circles in the early 1980s. By 1990 crop circles had …

Visual of Digizerk

Digizerk

Henk Rozema displaying his invention (2006), the digital tombstone "Digizerk". It was only a question of time that global digitalization would be introduced on cemeteries. The …

Visual of Do you

Do you "MIND"?

NeuroSky (founded in 2004) innovator in "wearable" bio-sensor/signal processing systems and SEGA TOYS are developing mind-controlled computer games and next generation consumer …

Visual of Modernistic Vaginas

Modernistic Vaginas

The influence of modernism and its trend of thought that affirms the power of human beings to create, improve, and reshape the world, along with its clear universal style of …

Visual of Intelligent Documentary Making

Intelligent Documentary Making

Our image of nature is permanently under construction. For Dutch biologist Gerdien De Jong , this became al too clear after watching The Life of Mammals , a series of nature …

Visual of Philips Vibe Emotion Sensor

Philips Vibe Emotion Sensor

The VIBE - emotional sensing necklace combines conductive ink and textile sensors. The necklace can read multiple biometric signals of the wearer and communicates them to other …

Visual of Robots in disguise

Robots in disguise

"Every year, in Germany alone, around 7000 people wait for a new cornea to save their eyesight. But donor corneas are in short supply. In an EU project, researchers have developed …

Visual of Simulacra and Simulations

Simulacra and Simulations

The simulacrum is never that which conceals the truth--it is the truth which conceals that there is none. The simulacrum is true. -Ecclesiastes If we were able to take as the …

Visual of The objectuals

The objectuals

The Objectuals is a series of work by artist Hyung Koo Lee , it features an interesting mix of visual distortion apparatus for the human body. Lee says that he experienced …

Visual of The Professors Doppelgänger Robot

The Professors Doppelgänger Robot

Although there are numerous researchers out there creating humanoid robots, none are as explicit about the close relation between anthropomorphism and narcissism as professor …

Visual of Walking Energy Cells

Walking Energy Cells

Remember this one? Body heat is used to power machines in The Matrix . Nine years after the first of the trilogy came to screen, a company comes up with a body-powered-battery. In …

Visual of True Knowledge beats Google

True Knowledge beats Google

What you are looking at, is the logo of perhaps the (in idea) biggest competitor on the search-engine market. It is beta-testing right now, but its demo video looks promising. Why …

Visual of Feelings Translated to Plants

Feelings Translated to Plants

Ambient Biomedia is an investigative project about using living beings, in particular plants, to display human lifestyle problems information. The working principle of our systems …

Visual of Build a better being

Build a better being

Will Wright's hugely successful games SimCity and The Sims let players shape the structure of urban areas and the lives of virtual humans; his upcoming game, Spore , lets them …

Visual of Country looking for a new land

Country looking for a new land

The Maldives, a chain of islands off the coast of India is taking the possibility of disappearance into account. This little piece of paradise is so low above sea level that it …

Visual of Call for Proposals: Designing for Next Nature

Call for Proposals: Designing for Next Nature

Nowadays, children know more corporate logo's and brands than bird or tree species. The average Western person has more worries about the instability of financial markets and …

Visual of Evolution in the Bedroom

Evolution in the Bedroom

Good morning anywhere in the world! Waking up is a problem (at least for 50% of the population). That's why alarm clocks exist; machines and devices are invented to solve …

Visual of Fake for Real

Fake for Real

Fakeness has long been associated with inferiority. Fake Rolexes that break in two weeks, plastic Christmas trees, leaky silicone breasts that cause cancer, imitation caviar. Even …

Visual of Fake-Space Race

Fake-Space Race

Some weeks ago we pondered over the oddity of a space race in cyberspace . Rockets and jet-packs –so cool in the previous century– don't make sense in a virtual environment. The …

Visual of Future playground

Future playground

Shot taken before the robot in question short-circuited and started to kill all humans in sight.

Visual of Join the Neolithic Revolution

Join the Neolithic Revolution

Why hunt? Why gather? Join the Neolithic revolution! Somewhere around 9500 BC proto-farmers began to select and cultivate food plants with desired characteristics. While in their …

Visual of Man Charged for Dumping Silicone Girlfriend

Man Charged for Dumping Silicone Girlfriend

Fifteen policemen rushed to the scene, after a couple reported to have bumped into a "corpse" while out walking their dog in a mountain forest in Izu, central Japan. The officers …

Visual of Modernistic Tree

Modernistic Tree

Mondrian would have appreciated square trees. Furthermore, they would enable wood industry to lose less material, to cut easier with machines and to store more efficiently. Hence …

Visual of Peer-to-Peer Immigration

Peer-to-Peer Immigration

At the beginning of the computer era, many objects and experiences from everyday life were transferred to the digital environment in order to make technology understandable (think …

Visual of RepRap - a self-reproducing machine

RepRap - a self-reproducing machine

The RepRap is a selfreproducing 3D printer. The 3D printer 'prints' his own components by melting tiny plastic particles together. Imagine what would happen if this 3D printer …

Visual of Robotic R)evolution

Robotic R)evolution

In 1921 the word "Robot" (meaning "labor") was introduced by Czech writer Karel ?apek . In his play "R.U.R." (Rossum's Universal Robots), robots seem happy to work for humans. …

Visual of Slavoj Zizek - Ecology without Nature

Slavoj Zizek - Ecology without Nature

This lecture by Marxist philosopher Slavoj Zizek – never mind the crappy sound & image quality: this is philosophy folks! – should provide all next nature explorers with a …

Visual of Software that Ranks Female Beauty

Software that Ranks Female Beauty

Earlier we reported software that predicts how a wine will rate in reviews even before it is made . Now, for puber-geek delight, lets try that for women. Tel Aviv University …

Visual of Voyage of the Bacteria Bots

Voyage of the Bacteria Bots

The 1966 science-fiction movie Fantastic Voyage famously imagined using a tiny ship to combat disease inside the body. With the advent of nanotechnology, researchers are inching …

Visual of A hermit crab in a glass house

A hermit crab in a glass house

Never thought I would ever empathize with a hermit crab. But somehow the 'situation' the creature is in, provides me with a feeling of recognition. According to this video marine …

Visual of A.T.R.E.E.M.

A.T.R.E.E.M.

Meet A.T.R.E.E.M. (acronym for Automated Tree-Rental for Emission Encaging Machine), a device that compares daily activities, energy and products to the growth of a tree. "From an …

Visual of Bioinstinct

Bioinstinct

Designer Laura Boffi envisions a future in which human instincts will leap behind on technological progress. For example, once the 'disease called mortality' is cured with …

Visual of Brain Needs 'Nature'

Brain Needs 'Nature'

Scientists have begun to examine how the city affects the brain, and the results are chastening. Just being in an urban environment, they have found, impairs our basic mental …

Visual of Craig Venter – Catalyst of evolution

Craig Venter – Catalyst of evolution

If the six hour crash course on synthetic genomics is a bit too much for you, there is always a more snappy TED lecture in which Craig Venter ponders on whether we can create new …

Visual of iReligion

iReligion

Graphic designer Roel Boonen takes the Apple cult to the extreme with this iReligion triptych. His piece is illustrative on how central corporations and digital technology have …

Visual of KOBIAN Shows Emotion

KOBIAN Shows Emotion

Meet KOBIAN, the humanoid robot that is not only able to walk about and interact with humans, but uses its entire body in addition to its facial expressions to display a full …

Visual of Millions of gadgets unused in Britain

Millions of gadgets unused in Britain

Gadgets! You love them when you buy them, but what happens next? Over half of Brits have abandoned gadgets because they don't know how to use them properly.  Seventy-one per cent …

Visual of Moscow won't let it snow

Moscow won't let it snow

Already in the early days of modern civilization, people claimed that they could control the weather. A known example from recent history are the rituals that American Indians …

Visual of Next Nest

Next Nest

When a bird builds a nest, we call it nature, but when a human puts up an apartment building, suddenly it’s culture? As if the dividing line between nature and culture wasn't …

Visual of Stop continental drift

Stop continental drift

Is it a cynical gesture to glue a 'Stop Continental Drift' bumper sticker on your gasoline addicted car? Absolutely. Yet indirectly it also criticizes the romantic …

Visual of The Hermaphrodite Effect

The Hermaphrodite Effect

According to research carried out by scientists from the Columbia Environmental Research Centre , sewage water containing hormones and pesticides caused by human consumption is …

Visual of The Robot Versus the Sign

The Robot Versus the Sign

Quote Eric Horvitz : "After finishing my doctoral work, I returned to Stanford Medical School to finish up the MD part of my MD/PhD. During one of my last clinical rotations, I …

Visual of Who designed the banana?

Who designed the banana?

Looking at a banana from a design perspective, one immediately notices the fruit is highly ergonomic and sophisticated: Bananas fit perfectly in the human hand, they come with a …

Visual of Artificial Shrub Observatories

Artificial Shrub Observatories

Justin Shull investigates the born and the made by mixing them up in mobile installations like the "Terrestrial Shrub Rover" and the "Porta Hedge" . His designs consist of several …

Visual of Digital Gastronomy

Digital Gastronomy

The food printer seems to be one of those lustrous concepts that continues to pop-up in the fantasy of techno-connoisseurs. Some years ago James King already proposed a printed …

Visual of Digitally Enhance your Ego

Digitally Enhance your Ego

Avatars, almost every internet user has at least one of them running around somewhere on the web. We control then in numerous games and forums, but do they also control us? …

Visual of Doll Box Coffins

Doll Box Coffins

This interactive piece called Boys & Girls was made by artist Job Koelewijn , who invites people to take place in the life size coffin–style Barbie & Ken packages, where …

Visual of Douglas Coupland: A radical pessimist's guide to the next 10 years

Douglas Coupland: A radical pessimist's guide to the next 10 years

Douglas Coupland is a writer and artist based in Vancouver. For the canadian newspaper Globe and Mail, he wrote The ‘radical pessimist's guide to the next 10 years’ a dystopian …

Visual of FluDOC – Glowing Bacteria Show if You Have Influenza

FluDOC – Glowing Bacteria Show if You Have Influenza

Bacteria are traditionally perceived as infectious and unhealthy, but that is about to change. This week designer Jan van der Asdonk graduated from the Next Nature Lab at the TU/e …

Visual of Friendly Vending Machine

Friendly Vending Machine

Designer Guus Baggermans was quite annoyed by the clumsy impoliteness of current vending machines, that typically require you to enter some abstract number to select your drink or …

Visual of Manko & Zero [#4]

Manko & Zero [#4]

The way down was slow and somehow greasy. Total darkness surrounded them. Gill turned on the car radio and the LED's lit up their faces in a green pulsating glow. 'Jovi Rocks!', …

Visual of Mud Tub

Mud Tub

Mud tub is an experimental tangible interface that allows people to control a computer while playing in the mud. By sloshing, squishing, pulling, punching, etc, in a tub of mud …

Visual of Nanoparticles in Sunscreen Damage Microbes

Nanoparticles in Sunscreen Damage Microbes

Nanotechnology has been hailed for its benefits because of the potential ability to create drugs that could cure cancer and radiation poisoning, make miniature pollutant filters …

Visual of Next Nature Movie #5: American Beauty

Next Nature Movie #5: American Beauty

During the selection of the top ten of next nature movies we’ve doubted quite a bit between the Truman Show (1998) and American Beauty (1999). The Truman Show tells the story of a …

Visual of Nine Strategies of Geo-engineering

Nine Strategies of Geo-engineering

Recently some scientists in Britain have recommend planetary ' geoengineering ' to avoid climate change. And as politicians are listening , it is time to explore the options. New …

Visual of Nomadic Plants

Nomadic Plants

Nomadic Plants are a species assembled from a group of robotic-electronic-biological organisms living in symbiosis in order to survive in habitats affected by human activity. The …

Visual of Old People as Old Nature

Old People as Old Nature

Two grannies assessing the milk productivity of two goats by means of a chart: this is the story of the commercial behind this screenshot. The first granny is a data analysis …

Visual of Technology vs Football: 4-4

Technology vs Football: 4-4

Some matches remain interesting, even though they're predictable. Take the continuous battle between technology and football. Every time the stakes get high, such as at the World …

Visual of There is not enough Africa in Computers

There is not enough Africa in Computers

Brian Eno - artist, composer, inventor, thinker - spoke to Kevin Kelly about the meaning of Africa for music and technology. "Africa is everything that something like classical …

Visual of Birds Change Along with Us

Birds Change Along with Us

A 'treasure in the trees' reveals the exchange of materials between man and animal. This beautiful house finch nest, made of natural resources and manmade garbage, demonstrates …

Visual of Blue, Belgian and Beefy

Blue, Belgian and Beefy

The Belgian Blue is a unique cattle breed that was developed quite accidentally in the late 1800s. An chance mutation lead the cattle to develop 'double muscling,' which occurs …

Visual of Disgusting Switches

Disgusting Switches

If a light switch would be hairy or snotty nobody would want to turn on the light anymore, which is exactly why designer Katrin Baumgarten created some of the most one nauseating …

Visual of Drugs are Nuts

Drugs are Nuts

Thinking about Next Nature can sometimes result in a feeling of vertigo. Normal standards are eroded and slowly replaced by next natural ones. A bewildering example can be found …

Visual of Get Vegetarian Teeth and Eat Less Meat

Get Vegetarian Teeth and Eat Less Meat

Want to live a greener life? Eat less meat. Recently the UN appealed for a radical shift in diet , to improve individual health and ease conditions affecting the global …

Visual of I am not a Robot. I am a Unicorn.

I am not a Robot. I am a Unicorn.

At Cornell Creative Machines Lab they were curious to see how two "chatbots" would make conversation. Powered by Cleverbot , created by AI researcher Rollo Carpenter, the robots …

Visual of Is that a hamster in your pocket or are you just pleased to see me?

Is that a hamster in your pocket or are you just pleased to see me?

Mobile phones may be the most affective technology we own but researchers at the Design Research Lab in Berlin have taken this notion to its most outlandish limit. Their cellular …

Visual of Manko & Death [#11]

Manko & Death [#11]

Manko had been here before. Being just thoughts, surrounded by nothing. He felt glad his thoughts were there, one after the other, so there had to be a form of time and therefore …

Visual of Manko & The Earth [#12]

Manko & The Earth [#12]

Zero: 'Where to begin? We've had many discussions in our Lab about the future of the children. The plan was simple: to raise the kids to the physical age to be 'frozen' in. Then, …

Visual of Mushrooms in the Mokum

Mushrooms in the Mokum

Mediamatic  is hosting a pop-up urban mushroom farm in the middle of Amsterdam. Rows and rows of shiitake, oyster, and the elusive almond-flavored  Agaricus subrufescens are …

Visual of My Fetal Pony:  Neoteny in Girls' Toys

My Fetal Pony: Neoteny in Girls' Toys

It's no secret that Mickey Mouse has evolved in response to consumer pressures. Once a violent river-rat, he became the boy scout of rodents with good looks to match. Steven Jay …

Visual of (Nano)technology imitating Nature

(Nano)technology imitating Nature

Over the coming years, nanotechnology will invade our everyday lives. Nanotechnology, usually defined as the control and manipulation of matter at the nanoscale, will be …

Visual of Occasionally Extinct and Virtually Alive

Occasionally Extinct and Virtually Alive

Japanese researchers are currently working on cloning a mammoth, and plan to produce a fluffy new prehistoric calf within four or five years . The bucardo, an extinct subspecies …

Visual of Powershow 2011 Pictures

Powershow 2011 Pictures

Pictures of the Next Nature Power Show 2011 are online.

Visual of Rainbow Tulips

Rainbow Tulips

Human design brings us ‘natural’ experiences that could not exist without the human hand, but can be appreciated nevertheless. Perhaps we are intuitively faked to believe …

Visual of Robo-teacher

Robo-teacher

Say hello to teacher Engkey ! The city of Daegu — South Korea, introduced 29 robot teachers in 19 elementary schools as part of a large scale project to robotize teaching. The …

Visual of Rule #1: Any Association that Can be Made, Will be Made

Rule #1: Any Association that Can be Made, Will be Made

For other entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design,  click here.   People have evolutionarily built-in mechanisms that help us to …

Visual of Sympathy for the Device

Sympathy for the Device

Tweenbots are small robots that depend on the kindness of strangers. They are only able to move straight forward and do this constantly. Once they get stuck in a hole or at a …

Visual of The Majestic Plastic Bag

The Majestic Plastic Bag

Behold the heroic journey of one of the most illustrious creatures on our planet. Created by the good people of Healthebay.org .

Visual of The Story of our Food

The Story of our Food

Every time we eat a piece of food, we take a bite out of the world. All these small bites tell a dozen stories. A carton of eggs presents the story of contented hens, a bottle of …

Visual of Welcome to Earth, Number 7,000,000,000!

Welcome to Earth, Number 7,000,000,000!

Welcome to earth, #7,000,000,000! Hope you like the #anthropocene. Learn more: http://bit.ly/se1SQc

Visual of Who Watches the Watchers?

Who Watches the Watchers?

In The Watchers , the creative geniuses at Studio Smack picture a world where surveillance systems don't just watch us - they actively judge.  Are you a green-coded Conformist or …

Visual of #9: Be Aware of the Ecosystem You're Invading

#9: Be Aware of the Ecosystem You're Invading

Part 9 in the 11 part series Anthropomorphism and Design . With most products, one wouldn’t normally worry about the environment that it enters. However, anthropomorphic products …

Visual of A Second Life for Rescued Plastic Pens

A Second Life for Rescued Plastic Pens

Artist Willis Elkins "rescues" plastic detritus from the sea. His most recent venture, the Jamaica Bay Pen Project , retrieves sun-baked, useless pens from the shores of New …

Visual of A Space-Faring Backup for Earth's Biota

A Space-Faring Backup for Earth's Biota

Elon Musk, the chief executive of spacecraft company SpaceX, believes we need to reinvigorate popular interest in space colonization, not just to boldly go where no man has gone …

Visual of Animals of the Future

Animals of the Future

Nearly every adult in the Western world owns a personalized pet, sometimes more than one . It is treated with great care, fed when necessary and fitted to the owner’s wishes and …

Visual of Dolphin Wannabe

Dolphin Wannabe

Same article , different example: Water Powered JetPack by Jetlev . (Thanks: Marlies Peeters)

Visual of Meat, the Expectations

Meat, the Expectations

As the planet’s population speeds towards 9 billion, it’s becomes impossible to continue consuming meat like we do today. Will we all be eating rice and beans? Grasshoppers …

Visual of Free Range Robot Filters Out the Ocean's Plastic

Free Range Robot Filters Out the Ocean's Plastic

Whale sharks are great at filtering; plastic needs to be filtered. For now, however, whale sharks only have an appetite for plankton. Industrial designer Elie Ahovi has jumped …

Visual of Hidden Cities Emerge from the Amazon

Hidden Cities Emerge from the Amazon

Famed for its jaguars, orchids, and horrifying parasites, the Amazon is just as famous for what it lacks: human presence. For many years, the prevailing wisdom has been that …

Visual of Ice Cream Cones Made from Ice Cream, and Other Wikicells

Ice Cream Cones Made from Ice Cream, and Other Wikicells

Plastic is a part of the earth's ecosystem , but it's a part that no one wants. At Harvard, scientists are looking to replace single-use plastic bottles, plates, and cups with …

Visual of In the Future, We Will Mine for Plastic

In the Future, We Will Mine for Plastic

Peak oil, the point when petroleum extraction is at its maximum, may have already occurred sometime  in the last few years . Not only affecting whether we drive a Humvee or not, …

Visual of Mice Reporting For Duty

Mice Reporting For Duty

Researchers have developed genetic manipulated mice, with extra smell receptors that make them highly sensitive to the smell of explosives. Scientists hope to use these mice in the future to discover land mines

Visual of Nano Product: Lungless

Nano Product: Lungless

350 million years after crawling from the sea, the Lungless suit will bring us back. Inspired by fish gills, the Lungless Aquatic Respiration Suit uses millions of cascading …

Visual of Plastic Junk Helps Ocean Animals (Sometimes)

Plastic Junk Helps Ocean Animals (Sometimes)

While the Pacific garbage patch is often characterized as a dense, Texas-sized island of plastic, in reality it's an area of 2,736 square km scattered with  tiny, floating bits of …

Visual of Replacing Synapses with a Single Switch

Replacing Synapses with a Single Switch

Neural synapses in the human brain are extraordinarily complex structures. Responsible for relaying information between neurons, chemical synapses govern the release of over 100 …

Visual of Robutt

Robutt

Tokyo University of Electro-Communications , revealed SHIRI (? = "buttocks"), a "Buttocks Humanoid That Represents Emotions With Visual and Tactual Transformation of the Muscles." …

Visual of Rotund Rats, Fat Cats and Chubby Chimps

Rotund Rats, Fat Cats and Chubby Chimps

It's nothing new that humanity is getting chubbier by the day. What's surprising is that we're bringing our animals along for the ride. A meta-analysis of animal weight has …

Visual of Rule #4: Complex Products Tend to Be Anthropomorphized

Rule #4: Complex Products Tend to Be Anthropomorphized

For past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design,  click here.   Think about a spoon. Now think about a spoon with a face. What do you …

Visual of Rule #5: Consider Zoomorphism as an Alternative

Rule #5: Consider Zoomorphism as an Alternative

For past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design,  click here.   When a product imitates animal behavior, the strict social rules …

Visual of Tiny Amounts of Alcohol Might Extend Life

Tiny Amounts of Alcohol Might Extend Life

A new study on the effects of cholesterol on the life span of Caenorhabditis elegans, a tiny worm often used in experimentation, resulted in some surprising finds. The life span …

Visual of Microchips Learn to Repair Themselves

Microchips Learn to Repair Themselves

Taking a cue from the human brain, a new microchip can rewire itself after damage.

Visual of Birdhouse Sweet Birdhouse

Birdhouse Sweet Birdhouse

3D printer company MakerBot  recently launched a contest  inviting designers to create the birdhouse of the future. The winner is The American Craftsman Bungalow by Brent J. …

Visual of Demo Day at Next Nature Lab

Demo Day at Next Nature Lab

Unpolished creativity at the Next Nature lab from the Industrial Design Department at the Eindhoven University of Technology.

Visual of Tattoos that Make Everyone a Product

Tattoos that Make Everyone a Product

QR and barcode tattoos turn an artist's body into a business card.

Visual of Ghost Imaging: Taking Pictures of the Invisible Thanks to a New 3D Technique

Ghost Imaging: Taking Pictures of the Invisible Thanks to a New 3D Technique

British research group created anew scanning technique permits to obtain 3D images and detect wavelengths that our visual system is not able to see.

Visual of Grossed Out by Lab-Grown Meat? Here's 7 Reasons Why You Shouldn't Be

Grossed Out by Lab-Grown Meat? Here's 7 Reasons Why You Shouldn't Be

In vitro meat is creepy, unnatural and downright disgusting – and so is every other kind of food we eat.

Visual of Hate Babies? Why Not Give Birth to an Endangered Species?

Hate Babies? Why Not Give Birth to an Endangered Species?

Solving the world's population crisis by replacing human infants with aquatic creatures.

Visual of Have We Passed

Have We Passed "Peak Automobile"?

You’ve heard about peak oil, but what about peak automobile?

Visual of Hire a Hyperreal Girlfriend to Look Better on Facebook

Hire a Hyperreal Girlfriend to Look Better on Facebook

Baudrillard intersects with social media in the world of fake online girlfriends.

Visual of Killing Cancer Cells, Arcade-Style

Killing Cancer Cells, Arcade-Style

A speculative nanotech pill that lets you virtually rove your body, zapping cancer cells as you go.

Visual of Let's Build a Garden on Mars

Let's Build a Garden on Mars

One would need a gardening robot, fitted plant species and some kind of dome structure for the plants to grow in.

Visual of Lions Relax in Morning Traffic

Lions Relax in Morning Traffic

A pair of apex predators bring traffic to a standstill.

Visual of Loyal Lamps that Follow You Like Pets

Loyal Lamps that Follow You Like Pets

Two lights that behave like pets, acting and reacting like autonomous creatures.

Visual of Manmade Global Warming Is at Least 15,000 Years Old

Manmade Global Warming Is at Least 15,000 Years Old

How the extinction of mammoths changed the atmosphere.

Visual of Moments in Meat History Part II- The Last Mammoths

Moments in Meat History Part II- The Last Mammoths

The Mammoth was the last of the giant land mammals of the Pleistocene era.

Visual of Moments in Meat History Part VI - Meat the Future

Moments in Meat History Part VI - Meat the Future

By the turn of the century, some people began raising questions about our meat consumption habits.

Visual of Moving From Password to Biometric Data

Moving From Password to Biometric Data

Unlock our devices with our fingerprint, this technology for security represents a change in our digital life.

Visual of Nanotech Shots Take Mice from Drunk to Sober in Minutes

Nanotech Shots Take Mice from Drunk to Sober in Minutes

Ever curse the fact that you have to wait hours to sober up after a night at the bar? Now, you can sober up almost instantly  – that is, if you're a mouse. Researchers at  MIT …

Visual of Nature through the Windshield

Nature through the Windshield

Volume magazine interviews Next Nature founder Koert van Mensvoort.

Visual of Out of Network

Out of Network

Artist Filippo Minelli aims to point out the gap between the reality we still live in and the ephemeral world of technologies.

Visual of Paradise Reset

Paradise Reset

Interview with our own Koert van Mensvoort in the IKON Television Documentary 'Paradise Reset' on the future of human nature.

Visual of Plastic makes the world go round

Plastic makes the world go round

Cockroaches will inherit the world after humans are gone? Maybe not. Seeing plastic as the new moss, or algae, photographer Jeanny Kaethoven makes this beautiful pictures of …

Visual of Shape-Shifting House Acts like a Flower

Shape-Shifting House Acts like a Flower

Imagine your home adapting itself to seasonal, meteorological and even astronomical conditions by changing its shape.  D*Dynamic is based on the discovery of mathematician Henry …

Visual of Smart Sock Makes Your Feet Speak

Smart Sock Makes Your Feet Speak

A new wearable device provides runners with info on posture, rhythm and stride length.

Visual of

"Soylent" Liquid Meals Will Save the World

Can a meal replacer save us money, time, and maybe even save the world?

Visual of The (Almost) Invisible Dancing Wheelchair

The (Almost) Invisible Dancing Wheelchair

Designed by a dancer, a new wheelchair moves intuitively with the user's movements.

Visual of The Artificial Touch-Sensitive Hand

The Artificial Touch-Sensitive Hand

Restoring the sense of touch with an artificial hand, using a brain interface.

Visual of The Insect with Natural Mechanical Gears

The Insect with Natural Mechanical Gears

The first – and only – mechanical gears found in nature.

Visual of The Prefuture of Synthetic Biology

The Prefuture of Synthetic Biology

Alexandra Daisy Ginsberg discusses the promises and realities of synthetic biology.

Visual of New Technologies to Make Us Sleep Less, and Better

New Technologies to Make Us Sleep Less, and Better

Having 50% more “conscious lifetime” might sound like an appealing proposition to anyone with a hectic schedule. This could be achieved not necessarily by living longer, but by …

Visual of Transfer a Loving Tap Via Bluetooth

Transfer a Loving Tap Via Bluetooth

A bracelet able to transfer a touch between two people.

Visual of When Is Biomimicry Not Really Biomimicry?

When Is Biomimicry Not Really Biomimicry?

A entomologist gives another explanation for that famous fruit fly with ant-patterned wings: it's not evolution, it's human error.

Visual of Where the Other Half Lives

Where the Other Half Lives

Map-enthusiast Valerie Pieris has created a fascinating visualization of human population centers. We all know that a huge fraction of humanity lives in Asia, but this map really …

Visual of World's First In Vitro Hamburger Arrives

World's First In Vitro Hamburger Arrives

Break out the ketchup: Mark Post has grown the world's first entirely artificial burger from cultured beef cells.

Visual of Animals Doing Extreme Stunts

Animals Doing Extreme Stunts

CGI video of animals doing crazy stunts makes us realize how peculiarly creative humans really are.

Visual of Assemble Your Own Computer

Assemble Your Own Computer

Kano: the low-cost computer anyone can assemble.

Visual of Browsing the Map of Space Ship Earth

Browsing the Map of Space Ship Earth

Besides finding their way, people look at to transport them to another place, or in this case, another perspective on planet Earth.

Visual of Cat-like Sensitive Whiskers for Robots

Cat-like Sensitive Whiskers for Robots

Electronic whiskers put sensitive catlike sensors on robots.

Visual of Cosmos Tourism

Cosmos Tourism

The World View Experience offers an expensive journey to the edge of space.

Visual of Fish Fins vs Bones

Fish Fins vs Bones

Zebrafish can regrow fins. Is there a possibility we can regrow bones in the near future?

Visual of Floating Underwater Self-Sufficient City

Floating Underwater Self-Sufficient City

Asian architects of AT Design Office want to build an incredible floating underwater metropolis that is also self-sufficient.

Visual of In Suburbia Anything Can Happen

In Suburbia Anything Can Happen

Without social bonds and solidarity, anything can and does happen: a small house surrounded by new big buildings.

Visual of Making the Skin your New Touchscreen

Making the Skin your New Touchscreen

A tool that could turn the arm into a touch screen display.

Visual of NANO Supermarket Best Product 2014

NANO Supermarket Best Product 2014

A jury of design and science experts awarded the best NANO Supermarket product a € 2.500 prize.

Visual of Nature Learned to Turn Plastic into Rocks

Nature Learned to Turn Plastic into Rocks

Plastic can fuse with rocks to form a new material: plastiglomerate.

Visual of New Plant Paradigms

New Plant Paradigms

In this approaching era, what might be biologically possible for plants?

Visual of Nike Robotic Sneakers

Nike Robotic Sneakers

Futuristic Nike sneakers for robots.

Visual of OpenWorm: The First Digital Organism

OpenWorm: The First Digital Organism

The first digital life form is an interactive worm based on its real biology.

Visual of Our Tribal Gut Bacteria Are Disappearing (And Why We're Getting Fat)

Our Tribal Gut Bacteria Are Disappearing (And Why We're Getting Fat)

Healthy gut bacteria may hold the key to weight loss – but only isolated communities may preserve "natural" intestinal biomes.

Visual of Professions Of The Future

Professions Of The Future

As technology evolves, what today seems like science fiction may be the job market of tomorrow: 11 professions of the future.

Visual of Recovering Phosphorus from Wastewater

Recovering Phosphorus from Wastewater

Researchers found a technology that allows to recover valuable substances from wastewater.

Visual of Robotic Furniture puts IKEA to Shame

Robotic Furniture puts IKEA to Shame

Science Fiction taught us to think of robots as human-like beings, yet the robots that actually make it into your home are more likely to look like furniture.

Visual of Sexy High Heels

Sexy High Heels

Our peculiar image of the week makes us shivers with Anthropomorphobia.

Visual of Shock Therapy for a Better Self

Shock Therapy for a Better Self

The Pavlok wristband gives its wearers an electric shock if they fail at hitting work deadlines or completing fitness goals.

Visual of Technosphere Interference

Technosphere Interference

Does Technosphere stop humans from sexual replication?

Visual of Timeline Of The Far (not so bright) Future

Timeline Of The Far (not so bright) Future

BBC predicts the far future.

Visual of We Are Weaker Than Our Ancestors

We Are Weaker Than Our Ancestors

Human fitness has decreased so significantly that even the strongest of us would consider ancient men to have a supernatural force.

Visual of What Will Life Be Like Inside A Computer?

What Will Life Be Like Inside A Computer?

Many scientists believe that we will soon be able to preserve our consciousness indefinitely. This could be done by copying and transferring these contents into a computer, or by piecemeal replacement with parts of the brain gradually replaced by hardware.

Visual of 3D Printed Fish Remove Toxins and Deliver Drugs

3D Printed Fish Remove Toxins and Deliver Drugs

Researchers from UC San Diego announced that they have developed 3D print tiny microrobots in the shape of fish able to detect and remove toxin from liquid.

Visual of After In Vitro Burger, Chicken is the Next

After In Vitro Burger, Chicken is the Next

Soon, we might be getting a taste of the first lab-grown chicken meat.

Visual of Analogue vs Digital: Handwriting

Analogue vs Digital: Handwriting

Will handwriting soon be history? Or will we always prefer a handwritten love letter from our beloved?

Visual of Anthropo-scene #8: Anthropocene Rabbit

Anthropo-scene #8: Anthropocene Rabbit

With cities covering growing area of land, we humans and our spaces build the new wilderness for animals and plants.

Visual of Artificial Brain Able to Perceive, Learn and Forget

Artificial Brain Able to Perceive, Learn and Forget

Scientists in Russia have taken a next step in the development of artificial intelligence by creating a "brain" that is able to educate itself.

Visual of DOUG: the First Robot Able to Draw

DOUG: the First Robot Able to Draw

Robots can already read, talk and reason. Yet, they do not seem to have found limits to their artistic skills either. Meet DOUG_1, first the drawing robot.

Visual of Using Drones to Fight Deforestation

Using Drones to Fight Deforestation

British company BioCarbon Engineering developed a new ingenious way to exploit drones: reforestation.

Visual of Experimental Office: No Chairs, No Desks

Experimental Office: No Chairs, No Desks

To counter the sitting dogma, design firm RAAAF and artist Barbara Visser created a dynamic office concept, entirely based on movement and leaning.

Visual of From the Super Muscular Pig to the Hypoallergenic Cow: New GMOs May Soon Be on Your Plate

From the Super Muscular Pig to the Hypoallergenic Cow: New GMOs May Soon Be on Your Plate

The acronym that keeps Europe awake at night is TTIP (Transatlantic Trade and Investment Partnership), a trade and investment deal that the EU is negotiating with the US. From …

Visual of Hair Matter(s)

Hair Matter(s)

French student at the Design Academy Eindhoven collected hair from African American hairdressers to create jackets and hats.

Visual of Ingestible Device to Monitor Vital Signs

Ingestible Device to Monitor Vital Signs

Biomaterials researchers at MIT came up with a very tiny device able to monitor vital signs from deep inside the body.

Visual of Interview: Suzanne Lee, Fashion Innovator Who Grows Clothing in the Laboratory

Interview: Suzanne Lee, Fashion Innovator Who Grows Clothing in the Laboratory

We recently talked with Suzanne Lee about the textile industry and technology, growing leather in the lab, and the use of new alternative materials in the future of fashion.

Visual of Let Your Drone Mow Your Lawn

Let Your Drone Mow Your Lawn

If you do not want to slave away under the sun, pushing a bulky mower around, drones can do it for you.

Visual of Local Deliveries: Robots or Drones?

Local Deliveries: Robots or Drones?

Starship, a robot that will remodel our local deliveries system.

Visual of Medical Microbots Used to Perform Biopsy

Medical Microbots Used to Perform Biopsy

With recent successful experiments, we may see doctors switching from the single forceps to hordes of so-called microgrippers.

Visual of Tracking Employees' Body Functions to Improve Business Performance

Tracking Employees' Body Functions to Improve Business Performance

In the quest for competitive advantage, companies adopt wearable biometric technologies to monitor employees and improve business results.

Visual of Next Nature Book Second Edition

Next Nature Book Second Edition

After it sold out, the Next Nature book has been reprinted with a brand new cover.

Visual of Ocumetrics Bionic Lenses can Triple Your Eyesight Capability

Ocumetrics Bionic Lenses can Triple Your Eyesight Capability

Dr. Garth Webb, an optometrist from British Columbia, has invented the Ocumetics Bionic Lens : lenses that after being implanted through an eight minute surgery, improve eyesight …

Visual of Order Anything with Amazon's Button

Order Anything with Amazon's Button

Amazon introduced a new gadget, named Dash Button, that will help you order groceries automatically.

Visual of Art Installation Submerges Amsterdam

Art Installation Submerges Amsterdam

Waterlicht shows how the Netherlands would look without waterworks — a virtual flood.

Visual of See Through the Skin with Your Smartphone

See Through the Skin with Your Smartphone

In the near future he ability to see through things won’t be a dream anymore with this infrared smartphone camera.

Visual of Smart Gloves Turn Gestures into Music

Smart Gloves Turn Gestures into Music

English artist Imogen Heap, with an army of artists, musicians, scientists and technologists, developed the Mi.Mu gloves.

Visual of Smog: an Augmented Reality?

Smog: an Augmented Reality?

A few days ago, these images of iconic buildings in Beijing as they look with and without intense smog have been posted on Weibo, one of China’s most popular social media …

Visual of Let’s Sweat the Heat Out: Sweating Wall Concept

Let’s Sweat the Heat Out: Sweating Wall Concept

Hydroceramic: a composite material able to lower the temperature of an interior space by five degrees Celsius.

Visual of The Future of Artificial Reproduction

The Future of Artificial Reproduction

According to researchers we could go a step further and use stem cells derived from your skin cells.

Visual of The Sketchbook Made Of Artificial Skin

The Sketchbook Made Of Artificial Skin

The SkinBook is made of synthetic skin that allows beginner tattooists to practice their skills.

Visual of Turning Cockroaches into Rescue Robots

Turning Cockroaches into Rescue Robots

Cyborg cockroaches might be used for search-and-rescue operations in the future.

Visual of Gameplay of the Crowds

Gameplay of the Crowds

Australian programmer started a social experiment called “Twitch Plays Pokémon”. Over a Million People Play Pokémon in Social Experiment

Visual of 3D-Printed Shell to Save Tortoise's Life

3D-Printed Shell to Save Tortoise's Life

A severely injured tortoise was saved by a team of doctors thanks to a 3D printed shell.

Visual of Anonymity Becomes the New Privacy

Anonymity Becomes the New Privacy

Artists respond to biometric technology and data collecting software through subversive projects.

Visual of Are There Pokémon on the Moon?

Are There Pokémon on the Moon?

Pokémon Go is slowly taking over our planet. People know more Pokémon than bird or tree species. However, avid players will have noticed that some of the first-gen Pokémon are not available in the game yet.

Visual of Who Are These Trolls Invading China?

Who Are These Trolls Invading China?

China's government fabricates about 488 Million social media posts every year as a strategy to distract from critics to the regime.

Visual of Brexit: the Cultural Climate Warms Up

Brexit: the Cultural Climate Warms Up

On the aftermath of such a historic day for Britain and the EU, it's easy to get swayed into the polarities of political discourse, particularly on social media and the Internet, where things heat up and move fast. The results of the referendum have just come out, and the Internet is already burning with tension. This is called "climate change" - just not the one you are used to hear about.

Visual of Cellphones Go Feral

Cellphones Go Feral

After reports of Samsung phones causing serious damage, plane delays and even hospitalization, the company made a first recall. However, the new phones were still bursting into flames.

Visual of Cockroach Milk: the Next Superfood?

Cockroach Milk: the Next Superfood?

A recent research reveals that the next extra nutritious ingredient may be the liquid produced by cockrach mothers to feed their offsprings. Are you willing to try it?

Visual of The Danger of a Plastic Sea

The Danger of a Plastic Sea

By 2050 plastic waste will outnumber the number of fish in the sea. These Surfers are taking action and raising awareness.

Visual of Dave Hakkens Wins the ECO Coin 2016

Dave Hakkens Wins the ECO Coin 2016

Dave Hakkens wins the 2016 ECO coin Award for his incredible work on the Precious Plastic recycling machines.

Visual of Difficulty in Voting for Trump or Hillary?</br>Elect an Artificial Intelligence for President

Difficulty in Voting for Trump or Hillary?
Elect an Artificial Intelligence for President

Would you vote for an artificial intelligence to govern our society?

Visual of Edible Crops Grown in Martian Soil

Edible Crops Grown in Martian Soil

Scientists at Wageningen University, The Netherlands, grew edible crops in Martian soil.

Visual of Empowered by Robots Design Challenge

Empowered by Robots Design Challenge

Wanted: New jobs for humans and robots! Which designers, technicians, robot enthusiasts will help us with innovative, feasible ideas for the new jobs of the future?

Visual of The First Baby with Three Genetic Parents

The First Baby with Three Genetic Parents

This year, on April 6th, a baby was born with three genetic parents: two mothers and one father.

Visual of Future of Feelings: Emotion Reading Radio

Future of Feelings: Emotion Reading Radio

Researchers have the developed the EQ-Radio: a tool to read people emotions from a distance.

Visual of Traffic Lights for Smartphone Zombies

Traffic Lights for Smartphone Zombies

Ground Level Traffic Lights For Smartphone Zombies

Visual of King Bee Inspecting His Drones?

King Bee Inspecting His Drones?

Facebook boss Mark Zuckerberg at the Mobile World Congress, in Barcelona.

Visual of The Lightest Solar Cell Ever Made

The Lightest Solar Cell Ever Made

Researchers created solar cells as light as a soap bubble.

Visual of We Love Cities, so Do Wild Animals

We Love Cities, so Do Wild Animals

How wild animals and cities are adapting to each other.

Visual of Making King's Day More Sustainable

Making King's Day More Sustainable

On King's Day the water board of Amsterdam wants to collect urine and use it as fertilizer.

Visual of Meet the Firefighter Drone

Meet the Firefighter Drone

Meet the firefighter drone, she is the best at extinguishing fires and keep every species safe!

Visual of Next Nature Gift Guide 2016

Next Nature Gift Guide 2016

Here is a the Next Nature gift Guide 2016.

Visual of What Is Next Nature? #2

What Is Next Nature? #2

Fruit flavored candy

Visual of Disney Causes Tourism Overload in Norway

Disney Causes Tourism Overload in Norway

Disney's Frozen is causing tourism overload in Norway, and it's not sure if that is a good thing.

Visual of There Are More People Flying in Airplanes right Now, than there were Alive on Earth in the Stone Age

There Are More People Flying in Airplanes right Now, than there were Alive on Earth in the Stone Age

Today there are on average there are some 8000 planes in the sky carrying at least half a million people. On average during the Stone Age there must have been less.

Visual of Computer-Simulated Realistic Sounds

Computer-Simulated Realistic Sounds

Researchers at MIT have created a system that is able to simulate sounds that are so perfect that they can even fool human listeners.

Visual of A Robot to Help The Refugee Crisis

A Robot to Help The Refugee Crisis

In the last months we've been witnessing a refugee crisis of huge proportions. More than a million people crossed the sea to flee violence in Africa and the Middle-East. Together …

Visual of Will We Share .thought Files?

Will We Share .thought Files?

With the evolving technique called EEG, electroencephalography, we can measure brain activity and ultimately even read the brain.

Visual of The Movie Written by Artificial Intelligence

The Movie Written by Artificial Intelligence

Sunspring is a Sci-Fi short movie entrirely written by an artificial intelligence.

Visual of Bodily Currencies: Blood, Sweat and Tears

Bodily Currencies: Blood, Sweat and Tears

Welcome to the access and experience economy. Currency: sweat, blood and action.

Visual of A Taste of RoboBee Honey

A Taste of RoboBee Honey

Where most researchers are focusing on keeping bees alive, researchers of Harvard are developing a bee replacement; the Robobee. The Robobee is only the size of half a paperclip, with ultra thin wings flapping 120 times per second. The main goal is to build a mechanic pollinator.

Visual of Meeting the Future at TodaysArt

Meeting the Future at TodaysArt

Last week The Hague hosted a festival dedicated to contemporary experiments in music, art and digital culture.

Visual of Using Feces as Medicine

Using Feces as Medicine

Man uses feces to perform a microbiome transplant on himself.

Visual of A Village Made of Plastic

A Village Made of Plastic

A canadian entrepreneur is trying to help reduce plastic pollution by building a village made out of plastic in Panama.

Visual of Watch the First Movie Trailer Made by AI

Watch the First Movie Trailer Made by AI

IBM's Watson succeeded in creating its first-ever movie trailer for the upcoming sci-fi thriller Morgan.

Visual of What's Flying There? Coloring Book

What's Flying There? Coloring Book

What’s Flying There? is a coloring book that opens up new perspectives for drones applications in the human habitat.

Visual of The World's First Cyborg Olympics

The World's First Cyborg Olympics

The first cyborg Olympics will take place in Zurich in October.

Visual of 1923 - Term 'Ectogenesis' Coined

1923 - Term 'Ectogenesis' Coined

The term "ecotogenesis" was first coined in 1923 in "Daedalus".

Visual of 2015: Artificial Placenta Approaches

2015: Artificial Placenta Approaches

In 2015, a group of scientists from the University of Michigan claimed to have made the world's first artificial placenta.

Visual of AI Tries to Decode Dolphins

AI Tries to Decode Dolphins

Over a four year project period, researchers will use artificial intelligence to understand the dolphin language, creating a dolphin dictionary.

Visual of Air Purifying Billboards

Air Purifying Billboards

These blue eco-boards are turning California a bit greener.

Visual of Barbie Becomes a Hologram of Herself

Barbie Becomes a Hologram of Herself

Barbie has been turned into a hologram version of herself and will now be your kids assistend.

Visual of Boat Noise Makes Fish Bad Parents

Boat Noise Makes Fish Bad Parents

A study revealed that the sound of motorboat engines disturbs coral reef fish so acutely it changes their behavior, making them bad parents.

Visual of DNA Hacking: Catch a Computer Virus

DNA Hacking: Catch a Computer Virus

We know how it feels to catch a cold; how might it feel to catch malware?

Visual of Cognitive Cooking with Chef Watson

Cognitive Cooking with Chef Watson

The AI chef nows more than 10,000 recipes from all over the world and is capable of combining any ingredient while following your personal food preferences.

Visual of Circular Runway for Airport Efficiency

Circular Runway for Airport Efficiency

The endless runway is a new airport concept by Dutch scientist Henk Hesselink.

Visual of Antarctica Is Turning Green

Antarctica Is Turning Green

Rising temperatures have boosted the growth rates of seasonal mosses on Antarctica, turning the continent green.

Visual of Teaching Crows to Clean Up Cigarette Butts

Teaching Crows to Clean Up Cigarette Butts

Cigarette butts are littered everywhere. But now, two Dutch designers have come up with a unique solution to the problem: the Crowbar.

Visual of App Activates Cells That Manage Diabetes

App Activates Cells That Manage Diabetes

Scientists develop engineered cells to be implanted in patients with diabetes to regulate blood sugar levels, controlled with a smartphone app.

Visual of Drones and Robots Co-Work in Solar Farms

Drones and Robots Co-Work in Solar Farms

BladeRanger might have found the ultimate solution for solar panels cleaning putting drones and robots together at work.

Visual of Sustainable Flying with Electric Planes

Sustainable Flying with Electric Planes

German company revealed fastest electric plane.

Visual of Fellow Day 2017: Next Habitat

Fellow Day 2017: Next Habitat

Last week, our NNN fellows gathered to discuss the Next Habitat; how will we work in the future? And how does this affect our personal lives?

Visual of Flying Car Modular Transport System

Flying Car Modular Transport System

Airbus and Italdesign unveil modular urban land and air transport system.

Visual of Hoverboarding Over the Atlantic

Hoverboarding Over the Atlantic

In 2017, a hoverboard can fly 164 feet above earth and able to hover over the Atlantic Ocean.

Visual of HUBOT: Take the Jobtest!

HUBOT: Take the Jobtest!

The robots are coming! They’re getting smarter, cheaper and more reliable. How long will I have my job before a robot steals it? The industrial revolution made muscular power …

Visual of The Idea for Lab-Grown Meat Was Born in a Prisoner-of-War Camp

The Idea for Lab-Grown Meat Was Born in a Prisoner-of-War Camp

The phone call was as unexpected as the American accent at the other end of the line. And when she hung up a few moments later, Ira van Eelen had to stop to catch her breath. More …

Visual of An afternoon with Josh Tetrick: The man who wants to bring in vitro meat to the market by 2018

An afternoon with Josh Tetrick: The man who wants to bring in vitro meat to the market by 2018

Meet Josh Tetrick, entrepreneur who wants to reinvent the food industry and plans to launch lab-grown meat on the market by the end of 2018.

Visual of In Conversation with Yoyo Yogasmana, Winner of the First ECO Coin Award

In Conversation with Yoyo Yogasmana, Winner of the First ECO Coin Award

Read our conversation with the ECO Coin Award Winner of 2015: Yoyo Yogasmana.

Visual of Intimate Technology S01E03: A iReal

Intimate Technology S01E03: A iReal

What if your devices had a life of their own? Guy Farber’s playful short movie "An iReal" explores this very possibility.

Visual of Intimate Technology S01E07: Our Selves

Intimate Technology S01E07: Our Selves

We think of selfhood as residing in our everyday stream of consciousness. But could we possibly have a second digital self in our online behaviors? Watch episode 3 of our Intimate Technology series.

Visual of Looking into the Artificial Eye

Looking into the Artificial Eye

Sensor specialists recently developed a sensor that mimics the mammalian eye.

Visual of Make the World Your Office

Make the World Your Office

Imagine being able to enter your office through a digital representation of reality. It sounds crazy, but it’s possible with augmented and virtual reality.

Visual of New in: Next Nature Memory Game

New in: Next Nature Memory Game

We are pleased to announce the launch of the Next Nature Memory Game. Now available in our web shop, it playfully explores the shifting borders between biology and technology.

Visual of The Next Nature Guide to Games in 2017

The Next Nature Guide to Games in 2017

In the next nature, many people spend as much time in the digital world of gaming as they do in the real world. We have covered video games before, but this year we thought it …

Visual of 3D Printed Capsule Replaces Needle Injection

3D Printed Capsule Replaces Needle Injection

A needle free oral delivery system might in the future dissolve the old way of vacancies injected by syringes.

Visual of Pink GM Chicken Marks Anthropocene

Pink GM Chicken Marks Anthropocene

The Pink Chicken Project suggests modifying chickens’ DNA in order to send a message about our Earth health.

Visual of Plastic Exoskeletons for Turtles

Plastic Exoskeletons for Turtles

Antonio Esparza designed the TurtleBag: a 3D printable exoskeleton to help turtles distinguish plastic bags from jellyfish and extend their lifespan.

Visual of Smartflower Solar Device

Smartflower Solar Device

POP is an all-in-one solar energy system that hold visible benefits for humans.

Visual of Precious Plastic One Year After

Precious Plastic One Year After

Help Dave Hakkens build the third version of his Precious Plastic recycling machines!

Visual of Pre-Order the Pyramid of Technology Toolkit

Pre-Order the Pyramid of Technology Toolkit

The Pyramid of Technology toolkit is a workshop-in-a-box that helps you better understand technology and catalyze innovative processes.

Visual of Rights for Robots: EU Calls for Regulation

Rights for Robots: EU Calls for Regulation

A new report recommends that we decide the legal status of robots sooner rather than later. It even suggests that they could be given personhood and rights.

Visual of Shazam Your Plant Findings

Shazam Your Plant Findings

Shazam for Plants app lets you catch around 400.000 plant species left on our planet through the lens of your smartphone.

Visual of Sleep and Dream Controller

Sleep and Dream Controller

Developers at Dutch-based company Arenar have designed a device that not only claims to improve the quality of sleep, but also induces lucid dreams.

Visual of Smell of Data Documentary on Nextnature.net

Smell of Data Documentary on Nextnature.net

The Smell of Data documentary will make its online debut on nextnature.net.

Visual of Stay Young with Millennial Blood

Stay Young with Millennial Blood

A clinical startup sells millennial blood to reverse aging.

Visual of The Age of Rust

The Age of Rust

Meet the incredible new species "Petramosaurus Cavator" and discover its impact on our planet.

Visual of The City as Technology in Tokyo

The City as Technology in Tokyo

Are cities in their current form really the future of the human habitat? What is a next nature version of the city and how would it look like? In line with this perspective, NNN designer Hendrik-Jan Grievink led two workshops in Tokyo.

Visual of The World's First Floating City

The World's First Floating City

In effort of protecting and prospering their country, the Polynesian government has signed an agreement to realize the world’s first floating city.

Visual of MIT's new voiceless interface can read the words in your head

MIT's new voiceless interface can read the words in your head

The way we interact with the technology in our lives is getting progressively more seamless. If typing terms or addresses into your phone wasn’t easy enough, now you can just tell …

Visual of Drones Protect Indonesia from Volcanic Danger

Drones Protect Indonesia from Volcanic Danger

In Bali, volcanic danger looms large. Scientists are trying to use drones to forestall the danger and make the invisible workings of the volcano visible.

Visual of E-Skin Makes You Control Objects Without Touching Them

E-Skin Makes You Control Objects Without Touching Them

Scientists developed an e-skin that lets the wearer manipulate virtual objects without touching them, by using magnetic fields.

Visual of Give AI curiosity and it plays video games all day

Give AI curiosity and it plays video games all day

If you teach a robot to fish, it’ll probably catch fish. However, if you teach it to be curious, it’ll just watch TV and play video games all day. Researchers from  Open AI …

Visual of In conversation with Teresa van Dongen, biodesigner exploring natural forms of artificial light

In conversation with Teresa van Dongen, biodesigner exploring natural forms of artificial light

There was a time when flipping the switch, and seeing a glass bulb light up, was magical to anyone in the world. Today, the presence of a light switch in a room, is something …

Visual of Should lab-grown meat be labelled as meat when it's available for sale?

Should lab-grown meat be labelled as meat when it's available for sale?

Australian regulators will soon be faced with a challenge: can animal flesh produced in a lab be called meat? Amid reports that lab-grown meat could be on sale this year, the US …

Visual of Aleph Farms wants to bring clean meat from the lab to the next farming industry

Aleph Farms wants to bring clean meat from the lab to the next farming industry

Growing meat artificially, instead of within an animal, may soon be an available reality. Meet one of the pioneering developers of this product of the future: Aleph Farms. With …

Visual of Next Nature baby care

Next Nature baby care

Babies' needs aren't complex. And yet, they are. Over the years, parents have found some tricks to ease their babies as well as themselves. Taking a baby for a drive to make them …

Visual of The next sexual revolution is going to be all about technology

The next sexual revolution is going to be all about technology

Sex is one of the most powerful, fundamental human drives. It’s caused wars, and built and destroyed kingdoms. It occupies a significant percentage of most people’s thoughts. As …

Visual of Making Seawater into Clean Fuel

Making Seawater into Clean Fuel

Scientists have been hard at work searching for renewable energy sources. Now, a new breakthrough: the ability to produce hydrogen fuel from seawater.

Visual of Skiing on Mars? It's possible!

Skiing on Mars? It's possible!

For those experiencing symptoms of motion sickness in VR , it’s now possible to step inside a real-life simulation of what it could be like to ski on mars. Last week, desert dust …

Visual of Smart Ring Turns Thumb Gestures into Words and Numbers

Smart Ring Turns Thumb Gestures into Words and Numbers

From the Georgia Institute of Technology arrives FingerSound, a smart ring that recognizes thumb gestures and converts them into words and numbers.

Visual of How an app is helping restaurants cut food waste

How an app is helping restaurants cut food waste

Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …

Visual of Aleph Farms grew meat in space

Aleph Farms grew meat in space

Hello meat lovers! In vitro meat innovator Aleph Farms has taken the saying 'one small step for man and one giant leap for mankind' to a whole new level. The startup has succeeded …

Visual of The Artificial Womb project receives funding to develop a prototype

The Artificial Womb project receives funding to develop a prototype

Hooray! The team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …

Visual of 6 designers changing the future of fashion

6 designers changing the future of fashion

We live in a world of fast or disposable fashion. This industry is increasingly impacting the environment due to the use of toxic chemicals, water and energy consumption, heavy …

Visual of This brain-controlled exoskeleton allows a paralyzed man to walk again

This brain-controlled exoskeleton allows a paralyzed man to walk again

A breakthrough technology that responds to signals from the brain has transformed the life of a paralyzed 28-year-old man called Thibault. Four years after the initial incident …

Visual of Join us for the closing event of Reprodutopia!

Join us for the closing event of Reprodutopia!

Should men be able to give birth to children? Should we externalize pregnancy with artificial wombs? And are these feminist dreams or frankenstein nightmares? Welcome to …

Visual of How cities are cutting out cars

How cities are cutting out cars

It’s common consensus in the tech industry that the days of cars as we know them—powered by gas, driven by humans, and individually owned by all who want and can afford one—are …

Visual of Towards collective standpoints on the future of babymaking

Towards collective standpoints on the future of babymaking

For the closing event of Reprodutopia , a true meeting of minds took place as we discussed the social implications surrounding the future of reproductive technologies. Multiple …

Visual of The GOGBOT Conference 2019 is your guide to biotech futures

The GOGBOT Conference 2019 is your guide to biotech futures

Look around you and try to find the most natural thing in the room you are in now. It is you. But for how long? Welcome to the wonderful world of bio design ; a world full of …

Visual of Artificial bones for the natural meat experience

Artificial bones for the natural meat experience

The world is developing, climate change is happening and it's time for us to do something. Now. One strategy would be to simply stop eating meat — or at least reduce the amount of …

Visual of Sophia the Robot has a sister: Little Sophia

Sophia the Robot has a sister: Little Sophia

Robot Sophia is pretty much the international face of the ‘modern robot’. Sophia is the Audrey Hepburn-inspired humanoid robot who stands out for multiple reasons. She is the …

Visual of Emma is your colleague of the future

Emma is your colleague of the future

Emma is in poor health. She has painful varicose veins, stress-related eczema, puffy skin, a grey complexion, red eyes and a hunch-back. She is an imagined office worker of the …

Visual of This exhibition looks at how robots are changing the world we live in

This exhibition looks at how robots are changing the world we live in

Delve into the science and fiction of robots at V&A Dundee’s latest exhibition: Hello, Robot . Contemplate the existence of robots and how they have both shaped, and been …

Visual of Why some plastic packaging is necessary to prevent food waste

Why some plastic packaging is necessary to prevent food waste

There has been a surge in awareness of the damage that plastic pollution does to our planet in recent years. It has spurred a number of campaigns to remove single-use plastics …

Visual of Watch this robot fish swim through the ocean

Watch this robot fish swim through the ocean

Earth’s oceans are having a rough go of it these days. On top of being the repository for millions of tons of plastic waste , global warming is affecting the oceans and upsetting …

Visual of A vegan meat revolution is coming to global fast food chains

A vegan meat revolution is coming to global fast food chains

A few years ago, convincing meat-free “meat” was nothing more than a distant dream for most consumers. Meat substitutes in supermarkets lacked variety and quality. Plant-based …

Visual of Smart cities could give the visually impaired a new outlook on urban life

Smart cities could give the visually impaired a new outlook on urban life

Travelling to work, meeting friends for a catch up or just doing some shopping are often taken for granted by people with no known disabilities. For the visually impaired, these …

Visual of Next Generation: Growing technology with Prosthetic X

Next Generation: Growing technology with Prosthetic X

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Shahar Livne wins ECO Coin Award 2020

Shahar Livne wins ECO Coin Award 2020

Each year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honour them with our ECO Coin Award . We …

Visual of This startup is growing sushi-grade salmon from cells in a lab

This startup is growing sushi-grade salmon from cells in a lab

As the ills of factory farming become more pronounced, people are increasingly gravitating towards vegetarian or pescatarian diets. Besides producing a large percentage of our …

Visual of Perfect Sense explores what it means to love in turbulent times

Perfect Sense explores what it means to love in turbulent times

Imagine you are single and you finally meet that someone you like. You are in the early stages of dating, but then a virus appears and compromises everything. For some of us this …

Visual of A countryside dweller's guide to the future

A countryside dweller's guide to the future

The current lockdown in much of Europe has city-dwellers flocking to the countryside to wait out the outbreak sweeping the continent. Seeking relief from coronavirus, urbanites …

Visual of Design your Self!

Design your Self!

Who are you, who do you want to be, and what do you need to do to get there? We are constantly pushed to lead the perfect life. The media present us with a picture of an existence …

Visual of 7 ways to connect with your loved ones

7 ways to connect with your loved ones

During these challenging times, we have tried to find happy moments together where we could find them. From weekly Zoom lunches to having online wine tastings, still, it doesn't …

Visual of How technology keeps us connected

How technology keeps us connected

At this moment in time, many people are staying at home in order to flatten the curve . It is times like these that we realize how vital technology is to us and our societies. It …

Visual of Exploring the society of trees

Exploring the society of trees

In conversation with Canadian researcher Suzanne Simard, inventor of the Wood Wide Web.

Visual of Cyborg mythologies #2: Jesus was a cyborg

Cyborg mythologies #2: Jesus was a cyborg

This is #2 in our cyborg mythologies series, where we explore the cyborg as a historical being intertwined within mythologism, ancient religion and sacred iconology. A way to …

Visual of Next Nature plans for Evoluon honored with Region Deal

Next Nature plans for Evoluon honored with Region Deal

Good day astronauts of spaceship Earth! Today it was announced that Next Nature's plans for the Evoluon have been awarded a financial contribution of €7.6 million from the Region …

Visual of Evolving In Vitro with Yuval Yancovitch

Evolving In Vitro with Yuval Yancovitch

With 7.9 billion people and counting, the Food and Agricultural Organisation of the United Nations predicts that by 2050, food supply needs to grow by 70% in order to accommodate …

Visual of Track freshness and reduce food waste with Rui Xu

Track freshness and reduce food waste with Rui Xu

Imagine this: you wake up on a lazy Sunday morning, trudging your way to the fridge only to be welcomed with the smell of something rotting. Did the meat expire sooner than …

Visual of Gear up for our VR timemachine!

Gear up for our VR timemachine!

Travel to big future in our VR timemachine at the Evoluon in Eindhoven

Visual of This exhibition explores the open ends of the apocalypse

This exhibition explores the open ends of the apocalypse

The exhibition "Apocalypse - End Without End" shows that the end is a human invention

Visual of The Institute of Digital Fashion explores what's next in the industry

The Institute of Digital Fashion explores what's next in the industry

Trading animal skins for pixels, our digital selves call for a digital wardrobe. The Institute of Digital Fashion , led by CommuneEast founder Leanne Elliott Young and Digi-Gxl …

Visual of Next Generation: Exploring non-binary futures with Lena Kuzmich

Next Generation: Exploring non-binary futures with Lena Kuzmich

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Screen mutations and reframing perspectives with Louisa Zahareas

Screen mutations and reframing perspectives with Louisa Zahareas

In the digital era of a globalized world, our screens have become a second set of eyes. Communication has advanced leaps and bounds, to a point where we cannot imagine a world …

Visual of That modernist dream of the house as butler is not going to happen

That modernist dream of the house as butler is not going to happen

Looking at evolution, we see that there’s always a next nature. Nature changes along with us. How will that influence our way of life in the future?

Visual of What Rachel Armstrong is reading this summer

What Rachel Armstrong is reading this summer

Architect Rachel Armstrong establishes an alternative approach to sustainability. Through a close reading of computational properties of the natural world, Armstrong develops a …

Visual of Why urban gardens are crucial for conserving bees and butterflies

Why urban gardens are crucial for conserving bees and butterflies

As humans have industrialised farming to feed a growing global population, pollinators – animals vital for plant reproduction – have seen their food supply decline. In the UK, …

Visual of Five things not to miss at Floriade

Five things not to miss at Floriade

Here are 5 things you cannot miss at Floriade Expo 2022

Visual of Chloé Rutzerveld designs the food of tomorrow

Chloé Rutzerveld designs the food of tomorrow

You are in for a surprise when you look at food and concept designer Chloé Rutzerveld 's portfolio. It is hard to believe that somebody so young - she is just 25 - has already …

Visual of Fermenting Futures and the beauty of biotechnology

Fermenting Futures and the beauty of biotechnology

Exploring the co-evolution of yeast and humans, while discovering the aesthetic value of yeast biotechnology, is what designers Anna Dumitriu and Alex May have been concocting. …

Visual of Next Generation: Producing glass from ashes with Benedikt Peirotén

Next Generation: Producing glass from ashes with Benedikt Peirotén

Benedikt Peirotén has started a project called ‘From the Ashes’ proposing using waste streams to replace the energy-intensive ingredients in glass.

Visual of Publish your graduation project

Publish your graduation project

*Our open call will continue for another month due to popular demand* Calling all art students, academics and everything in between. Are you a recent graduate (or soon to be)? Do …

Visual of Are plants our new co-composers?

Are plants our new co-composers?

Musicians have stumbled upon an unconventional and intriguing creative partner: plants. Yes, that's right, plants. Through the use of advanced sensors and software, …

Visual of ChatGPT is getting stupider and we don't know why - so I asked ChatGPT

ChatGPT is getting stupider and we don't know why - so I asked ChatGPT

AI language model ChatGPT has hit the mainstream last year when it became widely accessible to everyone. Next to doing our (home)work, it became also a D&D Dungeon Master , …

Visual of People are now having sex in self-driving taxis

People are now having sex in self-driving taxis

In the evolving scenery of self-driving taxis in San Francisco, passengers are getting frisky in the backseat of driverless taxis.

Visual of Dubai will soon house the world's largest artificial coral reef

Dubai will soon house the world's largest artificial coral reef

A floating sustainable city where humans can live, work and study while supporting aquatic ecosystems. Soon this will become a reality in Dubai, as sustainable real estate company …

Visual of Meet Indonesia's virtual news anchors

Meet Indonesia's virtual news anchors

Virtual news anchors seem to spread like wildfire across Asia. We've witnessed Xinhua present the news from China and applauded Lisa on becoming India’s first regional AI news …

Visual of This bin transforms household waste into chicken food

This bin transforms household waste into chicken food

Imagine a trash can that matches the size of your ordinary bin, yet it scoffs at weeks' worth of discarded food before even considering fullness. You're off the hook, as there's …

Visual of We can now grow insulin from lettuce

We can now grow insulin from lettuce

In a ground-breaking discovery, researchers at the University of Pennsylvania have achieved to produce insulin out of lettuce. There's no need for needles and injections anymore, …

Visual of How WhatsApp voice memos help Senegal's farmers

How WhatsApp voice memos help Senegal's farmers

Within the digital realms of our smartphones, WhatsApp groups cater to diverse intents: exchanging witty dad jokes, soliciting style counsel ahead of night-outs with friends, or …

Visual of Soon you can have dinner in space in a low-carbon balloon (if you're rich)

Soon you can have dinner in space in a low-carbon balloon (if you're rich)

Get ready to take your dining experience to literal new heights, soon we are able to enjoy high cuisine at the edge of space. French company Zephalto is introducing extravagant …

Visual of Next Gen: Watching our collective heartbeats with Nino Basilashvili

Next Gen: Watching our collective heartbeats with Nino Basilashvili

Heartsync is an interactive art installation crafted by artist Nino Basilashvili that syncs up your heartbeat with others. 

Visual of Better than the real thing

Better than the real thing

Written by Debbie Mollenhagen PART 1: FROM LINEAR TO CIRCULAR Designer living has become designing life. I often ask myself: did it taste like the real thing? But when I open my …

Visual of Biggest Visual Powershow: Photo report

Biggest Visual Powershow: Photo report

The pictures of the Next Nature Biggest Visual Powershow , in Zollverein are now online! Powershowmaster Koert van Mensvoort and Claudia (most advanced robot in the world). …

Visual of Biomimicmarketing

Biomimicmarketing

The sciences of biomimicry studies nature's models and then imitates or takes inspiration from these designs to solve human problems: Culture imitates nature. The Black&Decker …

Visual of Bird radio

Bird radio

Instruction for the Birds: Land on perch->trigger sound file->observe human response-->behave accordingly. Instructions for People: Listen, you'll be able to understand. The sound …

Visual of Child Care Robot

Child Care Robot

NEC corporation is developping a "Childcare Robot PaPeRo" capable to play with and watch over children. The Childcare Robot is capable of recognizing and verbally communicating …

Visual of Crowd counter

Crowd counter

Crowd counter is a piece of software able to track moving features within a video clip. It works on the assumption that points that move together are most likely part of the same …

Visual of Cutters

Cutters

Hope you have a strong stomach for this one: There are many ways known for decorating the body (both human and f.e. swine ). But it's fascinating to see that so many "cutters" …

Visual of Entry 2006 exhibition opened

Entry 2006 exhibition opened

Today the Entry 2006 exhibition opened in the coalwashe building, Zollverein. For 100 days 'perspectives and visions in design' with over 300 exhibits from more than 20 countries …

Visual of Erkundungen im Nächste Natur (D)

Erkundungen im Nächste Natur (D)

Die Natur verändert sich mit uns (English version: Exploring Next Nature ) by Koert van Mensvoort , published in Entry Paradise, Neue Welten des Designs, Gerhard Seltman, Werner …

Visual of Evolution

Evolution

From the street to the street. Watch the evolution of beauty here .

Visual of Featherless Chicken

Featherless Chicken

Behold the featherless chicken, created by Scientists at the genetics faculty at the Rehovot Agronomy Institute near Tel Aviv, Israel. The idea behind the development of this …

Visual of Google Maps Mars

Google Maps Mars

Google has added it's first map of a Solar Planet to the google maps. The map of Mars provides detailed information of its mountains, craters, plaines and more (including …

Visual of How To Grow A Chair: An Interview with Richard Reames

How To Grow A Chair: An Interview with Richard Reames

Using ancient grafting techniques and a few basic tools, Richard Reames shapes living trees into furniture and sculpture near his home in Oregon for clients worldwide. He is the …

Visual of Ideology becomes nature

Ideology becomes nature

Is this fake nature? Surely, it's nature altered by human hands. Somewhere in the East German forest these trees started to change color in autumn a little earlier than all the …

Visual of Klima Kontrolle

Klima Kontrolle

Klima Kontrolle (video) is a project by Roel Wouters and Luna Maurer . A fan is placed in front of a computer screen and accelerates until it blows away the entire desktop. …

Visual of Metalosis Maligna

Metalosis Maligna

Metalosis Maligna is a documentary by Floris Kaayk about a disease which affects patients with medical implants. Sourcing from such implants a wild metal growth ultimately …

Visual of Post History

Post History

Jos de Mul (Erasmus University Rotterdam), published in Next Nature Paperback, 2005 For someone whose main instrument is a computer, the world becomes a gigantic database. We see …

Visual of Second life prostitute

Second life prostitute

The world's oldest profession has made quick inroads into virtual life. You can make a quick buck if you're willing to accept in-game money for sexual services -whether that's …

Visual of Surfing the marble

Surfing the marble

The world is flat again! Here's how the worlds largest search engine company describes its newest toy: To put it simply, Like a game community , Google Earth is growing its own: …

Visual of The Animal Sweater

The Animal Sweater

The pattern on the Animal Sweater suggests a new way to experience commercial imagery. The Animal sweater, designed by Karl Grandin, was first shown at The Biggest Visual Power …

Visual of Utility Pets

Utility Pets

In the not-so-distant future people will be given a pig with their own DNA engineered into it. The pig, known as a "knockout" pig in the scientific jargon, is a form of living …

Visual of Walls with Ears

Walls with Ears

A traditional textile heritage is celebrated with flocked wallpaper that comes to life as it reacts to ambient noise levels. The louder the space the brighter the wallpaper glows. …

Visual of What's Epic?

What's Epic?

Epic is a fictional prospect (from 2004) on the future culture of media and internet-corporations. The human addiction to news and information must - according to this video - …

Visual of Wildgruen

Wildgruen

Mandy Meißner's "Wildgruen", a plant that can move and communicate. In her view, plants need to be freed from their isolation, both in the way that they can only lean towards the …

Visual of A Tomb for All People

A Tomb for All People

Those crazy Germans are planning to build modern versions of pyramids that will function as gigantic burial sites. "The Great Pyramid can potentially be any human being's grave or …

Visual of Augmented Animals

Augmented Animals

Animals do not shape their living environment as radically as humans, but why don't we give them some help. James Auger envisions animals, birds, reptiles and even fish becoming …

Visual of Augmented Fish Reality

Augmented Fish Reality

Augmented Fish Reality is an interactive installation of five rolling robotic fish-bowl sculptures. These sculptures allow Siamese Fighting fish (Betta Splendons) to use …

Visual of Ball of Being

Ball of Being

Ball of Being is an online dance film featuring atoms, planets, footballs, globes, foam and molecules. It is uncertain whether we are entering a microscopic nanoworld, virtual …

Visual of Barcode Tattoos

Barcode Tattoos

Barcode tatoos . An intuitive manifestation of the decreasing border between humans and products?

Visual of Bio inspired Architecture

Bio inspired Architecture

This cell-shaped building for the institute for Nanobiomedical Technology & Membrane Biology in Chengdu, China, is an unusual croos-disciplinary collaboration between MIT …

Visual of Bioprinting in Hawai

Bioprinting in Hawai

This Fall, the 1st world Bioprinting Congress is organized in Honolulu, Hawai. Four whole days of biopatterning, bioassembly and biofabrication! The ironic choice of location …

Visual of Bonsai tree table

Bonsai tree table

Somehow next nature seems to reveal itself through furniture. Earlier we've featured the treetrunk bench , the bone chair , the folding chair , sketch furniture and how to grow a …

Visual of Botanicalls: The Plants have your Number

Botanicalls: The Plants have your Number

Botanicalls is a system that allows plants to call their owner when they need more (or less) sunlight or water. It works by placing moisture and light sensors in plants and then …

Visual of Brain biometric key

Brain biometric key

Using electrodes positioned around a person's scalp, scientists from the Centre for Research and Technology Hellas in Greece are developping a method for electronic identification …

Visual of Brain-computer interface for Second Life

Brain-computer interface for Second Life

While recent developments in brain-computer interface (BCI) technology have given humans the power to mentally control computers, nobody has used the technology in conjunction …

Visual of Dutch Tomatoes: Everlasting

Dutch Tomatoes: Everlasting

See also: How to grow a Heinz Bottle , Ferrari Tomato

Visual of Fake for Real: Actress Plays Virtual Character

Fake for Real: Actress Plays Virtual Character

Tomb Raider, featuring superwoman Lara Croft, was one of the most successful video games of its generation. Although many computer games had previously been created as spin-offs …

Visual of Fake for Real: World View

Fake for Real: World View

In ancient times, heroes like Marco Polo and Christopher Columbus explored unknown territories of the globe. The climax of these terrestrial explorations was reached at the …

Visual of Flesh Nike

Flesh Nike

A Nike shoe stapled together with human flesh, created by Adam Brandejs .

Visual of Future Beauty: Hyperbreasts?

Future Beauty: Hyperbreasts?

Let's talk about hyperbreasts. Have you ever wondered why men like women with large breasts? Historically large breasts are presumably sexually attractive for men because they …

Visual of Global Warming Mug

Global Warming Mug

Al Gore would love one of these mugs; displaying what happens when the world heats up and oceans begin to rise. Via Shikake | See also: ScaryIdeas.com | Related posts: Design A …

Visual of Guys and Dolls

Guys and Dolls

Google Video is no longer in operation. Sorry for the inconvenience "It's a high form of masturbation" A RealDoll is a realistic life-size sex doll that cost more than an average …

Visual of How to print an Organ?

How to print an Organ?

What to do about the shortage of human organ donors? An emerging branch of medicine, called organ printing (future vision alert) , takes a patient's own healthy cells and uses a …

Visual of Ladybug cleans the Toilet

Ladybug cleans the Toilet

A bug that does the cleaning? This 1-meter (39-inch) tall, 1.35-meter (53-inch) long prototype robot ' named "Lady Bird" ' is designed to clean public restrooms at highway rest …

Visual of Magical Interaction

Magical Interaction

Man's ability to control illumination is magical in itself but is seldom experienced as such because light switches are purely functional and generally don't stir up imagination. …

Visual of Manufactured landscapes

Manufactured landscapes

Edward Burtynsky is a photographer that makes pictures scarred or altered landscapes, changed by industrial activities. His work shows the disappearance of nature and the …

Visual of Fake for Real: Natural Breasts?

Fake for Real: Natural Breasts?

It is true, they are rare, but they do exist: girls with tiny waists and large breasts. Occasionally, women are simply born like this. The only problem they have - in a world …

Visual of Peach Nipple Handbags and Shoes

Peach Nipple Handbags and Shoes

Artist Nicola Costantino creates objects that comment on the meat and leather industries. In the surrealist tratdition, these handbags and shoes are imprinted with tiny images of …

Visual of Philips Wake Up Light - Sunrise Alarm Clock

Philips Wake Up Light - Sunrise Alarm Clock

Philips hits the shops with a product that aims to naturalize alarm clocks. The annoying buzzing machines were once invented to cultivate our day/night rhythms, formerly connected …

Visual of RedesignMe

RedesignMe

We are all born in a world that has been designed already. Cars, dishwashers, dildo's, remote controls, ATM machines. Although these products are supposed to make life better, …

Visual of Robot farmer Mr Woo

Robot farmer Mr Woo

Comedian Paul Merton went to China for Five.tv (early 2007) and near Beijing he reads the following headline: This farmer grows robots...

Visual of Robotarium - Zoo for Artificial Life

Robotarium - Zoo for Artificial Life

Robotarium X , the first zoo for artificial life, approaches robots very much in the way as we are used to look at life in old nature. We, humans, enjoy watching and studying …

Visual of Second Life is not Sustainable

Second Life is not Sustainable

What has a virtual world got to do with CO2 emissions? Electricity. Second Hype creator Linden Lab consumes an enormous amount of electricity on its 4,000 servers that support …

Visual of Sexy Car - How did that ever happen?

Sexy Car - How did that ever happen?

This peculiar image made me realize: It is in fact totally miraculous that people are capable to perceive machines as 'sexy'. How did that ever happen?

Visual of Skyscreen - largest urban LED screen in Asia

Skyscreen - largest urban LED screen in Asia

Alright, we can agree most of old nature has been altered by human activity. We're not just talking rain forest, icecaps and genetically modified fruit and kittens . Now you might …

Visual of Slogan: The Future is Analog

Slogan: The Future is Analog

I first saw this statement on the Artvertising building . Let this be our slogan of the week.

Visual of Stoneage noodles

Stoneage noodles

15.000 Years ago we lived in caves, wore animal-fur and ate mammut- noodles !? Oh well, though our knowledge has grown a bit, the human nature hasn't changed that much: every …

Visual of Switch Critters - Can you make them switch?

Switch Critters - Can you make them switch?

Earlier we discussed the Magical Interaction project, in which Joris van Gelder rethought the boring activity of switching on/off a light by transforming it into a magical …

Visual of The Desktop Factory - Do It Yourself

The Desktop Factory - Do It Yourself

Nowadays, most people can't make anything at home because it's too expensive. Roboticist Hod Lipson wants you to stop shopping and use his portable 3-D printer to make your own …

Visual of The Metaverse Roadmap

The Metaverse Roadmap

In ancient times heroes like Marco Polo and Christopher Columbus explored the unknown territories of the globe. Today world traveling has become a teenage tourist activity, but …

Visual of The things we design end up designing us

The things we design end up designing us

"While battling the forces of nature, man has become more and more independent of physical conditions. At the same time, however, he has become more and more dependent of …

Visual of Tickle Massage Robot

Tickle Massage Robot

Tickle is a small robot that walks on the human body to generate a pleasant, tickling sensation.It has two motors and rubber feet for a good grip on the skin. When it encounters a …

Visual of Typosperma

Typosperma

Another project by Oded Ezer, Typosperma is the second experimental typo project in his 'Biotypography' series. As a paraphrase on the biotechnology definition, 'Biotypography' is …

Visual of Victoria 4.0

Victoria 4.0

Victoria has great realism, perfect imperfections, and incredible ease of use. Based on live human models she is trying to close the gap between real life and models typically …

Visual of All Is Full Of Love

All Is Full Of Love

While time seems to flow in this one direction, some people just know how to walk straight through that fourth dimension; catch it in a videoclip and throw the message into …

Visual of Apparently things are improving in Darfur?

Apparently things are improving in Darfur?

Unfortunately this stylish refugee is merely an advertising fata morgana.

Visual of Avatarian Graveyard

Avatarian Graveyard

Avatarian Graveyard supplies a service for virtual addicts – people who excessively or compulsively spend time in virtual environments – to help them reintegrate into everyday …

Visual of BicycleBot

BicycleBot

Murata Boy, is a robot capable of riding bicycles unassisted. Balancing, pedaling and directing the bicyclee, turning the bike to avoid obstacles, etc. And this is his nephew, …

Visual of Biomechanical Energy Harvesting

Biomechanical Energy Harvesting

Let's face it: every time your cellphone battery runs empty you feel amputated and you quickly run back to your house to connect to a powering-adapter. Bionic Power Inc. is now …

Visual of Bionic woman

Bionic woman

More bionic experiments can be found here .

Visual of Blobman

Blobman

This landscape is titled 'I can not help the way I feel' and was created by John Isaacs . The way in which the flesh grows, erupts and engulfs the body can be seen as a metaphor …

Visual of BlobWall

BlobWall

Who would not need a blobwall in their officegarden? This modular freestanding, indoor/outdoor wall system was designed by Greg Lynn . It is made of a low-density, recyclable, and …

Visual of Boxing the Desert

Boxing the Desert

With his Waterboxx , Pieter Hoff (The Netherlands) won the Bèta Dragons Award 2008. It is an instrument that supports plants and trees in order to survive in difficult …

Visual of Britney

Britney

Nobody in recent history was (and is) made by media like Britney Spears. This one is for you, B. Made by

Visual of Click me

Click me

Humans become web-banners. Click me! By Irina Blok.

Visual of Composting Bottle

Composting Bottle

Don't you just love that vanishing bioplastic bottle! It is our peculiar object of the week.

Visual of Corpus 2.0

Corpus 2.0

Corpus 2.0 by Marcia Nolte is a set of seven portraits illustrating how the human body could adjust itself to the design of products, including an enlarged SMS thumb (above), an …

Visual of Dashboard Tree

Dashboard Tree

What is that growing on my car dashboard? Is that a tree? Indeed, Ford and Honda's next-generation dashboard instrument clusters feature trees (a vine in Ford's case) that grow …

Visual of Design for dummies

Design for dummies

Creativity for all! Design used to be predestined to a select group of qualified brand–owning designers. That model is made redundant. At least, if it is up to Studio Ludens in …

Visual of Dying ships

Dying ships

These ships were abandoned over twenty years ago. Their owners left them to die after the Chernobyl disaster due to their high levels of radiation. One of the great ironies of the …

Visual of Enjoying Nature in the Cave

Enjoying Nature in the Cave

Now let us analyze this setup for a moment: You are looking at an avatar character inside a 3D model of a virtual reality cave, enjoying a 'natural' landscape – welcome in the …

Visual of Fake for Real: Fantasy Castle

Fake for Real: Fantasy Castle

Disney's Sleeping Beauty Castle could be the single best-loved structure in the world. Ever wondered where Walt Disney got his enchanting fairytale aesthetic? The castle, which …

Visual of Fake for Real: Man in the Mirror

Fake for Real: Man in the Mirror

Some days when we look in the mirror we like what we see, some days less so. Would it not be great to be able to tweak the image a bit? After all, it is our main manifestation to …

Visual of Fake for Real video

Fake for Real video

Video of the Fake for Real Memory Game , presented by Hendrik-Jan Grievink & Koert van Mensvoort at the Style First exhibition in the museum Mudac , Lausanne, Switzerland. …

Visual of Fun begins in 2029

Fun begins in 2029

Famous technologist and futurist Ray Kurzweil states: it's going down by 2029, so be prepared to get digital on entirely new levels. According to Kurzweil, machines will have both …

Visual of Gameboy Bricks a million years from now

Gameboy Bricks a million years from now

A million years from now that hand would probably look more evolved, but the idea is nice: What if we would mold objects of the now into stone or bricks to preserve them over time …

Visual of Genetic Map of Europe

Genetic Map of Europe

European biologists have constructed a genetic map of Europe showing the relations between its various populations. The right part of the map shows the location in Europe where …

Visual of Get wasted in Second Life

Get wasted in Second Life

Second Hype's fashion industry is large and catty enough to have supermodel divas and social scandals, so it's probably inevitable that these should be available, too: animation …

Visual of Google tracks flue spread via sick searchers

Google tracks flue spread via sick searchers

This Tuesday, search giant Google released an experimental tool that tracks the intensity and movement of the influenza virus across the United States by monitoring the number of …

Visual of Green Blues: Biofuels add to Global Warming

Green Blues: Biofuels add to Global Warming

It is official: the Green Blues has begun. Almost all bio-fuels used today cause more greenhouse gas emissions than conventional fuels if the full emissions costs of producing …

Visual of Hail Control Gun

Hail Control Gun

A single hail storm can destroy the year's harvest. For over 25 years, this gun has been used by vine and fruit growers in France, Spain, Austria and Belgium for one purpose: …

Visual of Hemp–Mote

Hemp–Mote

This weeks peculiar image gives gaming that "natural" touch: the Hemp–Mote by dhrek.com Made from 3 kinds of 100% natural hemp string on the outside, while remaining 100% …

Visual of High Heels

High Heels

Is this the plastic surgery of the future? Peculiar image by Julie Rrap .

Visual of High Performance Hip

High Performance Hip

A commercial by an orthopaedic reconstruction company introducing the next generation of joint replacements: " Highly advanced hips and knees. Engineered to meet the needs of your …

Visual of How to build yourself a night elf

How to build yourself a night elf

Artist Max Kor, built himself a World of Warcraft Night Elf from scratch. Check his tutorial for an inside peek in surreal beauty construction. We are waiting for night elves to …

Visual of Hyper Fish

Hyper Fish

While swimming in second life, India Leigh came across this cool lion fish. See also: Redefining Nemo , Augmented Fish Reality , Who wants to drive a fish? .

Visual of Organic Coca-Cola

Organic Coca-Cola

Whoever you are, whatever you do, wherever you may be. You can’t beat the real thing. It really refreshes and brings real satisfaction in every glass. It was not until America’s …

Visual of iDog

iDog

Or you could get an iDog. This electronic animal with musical sensibilities. It sits on your desk and sings along with the music you are playing. Dog haters don't need to worry; …

Visual of In Space, Nobody Can See You Litter

In Space, Nobody Can See You Litter

Between the launch of Sputnik on 4 October 1957 and 1 January 2008, approximately 4600 launches have placed some 6000 satellites into orbit, of which about 400 are travelling …

Visual of Indoor sports: the hyper-hyper-reality

Indoor sports: the hyper-hyper-reality

Always wanted to take that parachute jump from the airplane, but never dared to? Why not try an indoor sky dive? Less interesting view, but more floating time. You can jump in …

Visual of Is it a bird?

Is it a bird?

Benjamin Verdonck's Giant Nest in Rotterdam.

Visual of It came out of the Sea

It came out of the Sea

A giant, smiling Lego man has been fished out of the sea in the Dutch resort of Zandvoort. Workers at a drinks stall rescued the 2.5-metre tall model. "We saw something bobbing …

Visual of Banana Juice Box

Banana Juice Box

This Japanese Juice box is camouflaged from modern box designs and tries to convince consumers with its appealing 'natural' look. A schoolbook example of biomimicmarketing ; …

Visual of Kokon Chair

Kokon Chair

Our peculiar object of the week is the 'Kokon Chair' created by Dutch designer Jurgen Bey , who wrapped existing chairs with tight, elastic synthetic fiber resulting in a highly …

Visual of Let the Dutch bury the Carbon

Let the Dutch bury the Carbon

Too much carbon emissions warming up the planet? No problem: just bring the stuff back to where you got it from in the first place. Experts have been advising to bury carbon …

Visual of Light weeds

Light weeds

Lightweeds is a project by Simon Heijdens and currently exhibited at the MoMA - part of the Design and the Elastic Mind exhibition . The organisms - plants, weeds, trees - exist …

Visual of Million dollar burger

Million dollar burger

PETA –People for the Ethical Treatment of Animals– has posed a challenge to the world's scientific community: The first person to come up with a method to produce commercially …

Visual of Modernistic Chair

Modernistic Chair

In the category: Creativity with modernistic tree trunks . Created by the good people of Draw me a sheep , who with this project aim to explore today’s human relationship with …

Visual of Napkin sketch – Nature changes along with us

Napkin sketch – Nature changes along with us

Visual of PacMan's Skull

PacMan's Skull

PacMan's skeleton is our peculiar object of the week. It was created by Le Gentil Garcon , in collaboration with Fransois Escuilia, palaeontologist, from the comparative …

Visual of Plastic Flamingos Saved From Extinction

Plastic Flamingos Saved From Extinction

Did you know there are more plastic flamingos in the USA than real ones? Plastic flamingos are widely considered to be the stereotypical example of lawn kitsch – the American's …

Visual of Robot asimo conducts concert

Robot asimo conducts concert

At a recent Yo-Yo Ma concert at the Detroit Opera House, Honda's ASIMO robot took the stage and conducted. Blame Honda when the robots take over. Thanks Paul .

Visual of A robot that controls your remote controls

A robot that controls your remote controls

Confused with the pile of remote controls in your house? Now here is an idea: get a robot to control them. Researchers at Toshiba have developed a talking robot, named ApriPoko, …

Visual of Robotic Red Snapper

Robotic Red Snapper

Just because you're feeling paranoid, doesn't mean the fish aren't actually spying on you. Engineers at the University of Kitakyushu created an underwater survey robot that looks …

Visual of Saturn (Directors Cut)

Saturn (Directors Cut)

The struggle between the born and the made is being fought out in a wardrobe on Saturn. By: 1stavemachine.com | Related: Sixties Last

Visual of Save The Tumor

Save The Tumor

Chantal Sebire suffers from an extremely rare form of cancer (foto: AFP) Since a few centuries some we tend to consider nature as something to preserve. Hence the international …

Visual of Scientists Extract Images Directly from Brain

Scientists Extract Images Directly from Brain

(Extracted directly from Pink Tentacle , thanks!): Researchers from Japan’s ATR Computational Neuroscience Laboratories have developed new brain analysis technology that can …

Visual of Simulated Diamonds

Simulated Diamonds

That shiny sparkling stone you got from your lover... is that a diamond? Lab manufactured diamonds are  getting exceedingly good . They have the same color, clarity, cut and carat …

Visual of Sneakpreview

Sneakpreview

This week we are sneak previewing our forthcoming compilation DVD featuring the best of the Biggest Visual Power Shows at the Picnic 08 - E-art event on 24,25,26 September at …

Visual of Solar Trees

Solar Trees

Welsh designer Ross Lovegrove ('Captain Organic') placed several glowing Solar Trees in the streets of Vienna (October 2007). These solar powered streetlights could save cities …

Visual of Space Station

Space Station

If you would have shown this picture to people 50 years ago, they might have imagined it to be one of those promised 21th century space stations encircling some alien planet in …

Visual of The Blogging Houseplant

The Blogging Houseplant

Meet midori-san ,  the first blogging houseplant! Through sensors connected to the leaves of this Sweetheart Hoya reads bioelectric currents through the plant, this gives …

Visual of The Breathe Table - Visceral Interaction

The Breathe Table - Visceral Interaction

Now why is that girl so excitingly staring at a few blurry blobs on a flat screen? Is it because these blobs are connected to her breath... What? Yes that is right, you are …

Visual of The First Pregnant Man

The First Pregnant Man

At first I thought this first pregnant man was a hoax, but after I saw it on Oprah I realized it must be 'real'. Well, the pregnant man is actually a former woman who had a sex …

Visual of The Love Boat

The Love Boat

This is Petra. In 2006 she fell in love with a peddle boat designed to look like a swan and has never left its side. In winter, when swans should be flying southwards, the peddle …

Visual of The mobile evolution

The mobile evolution

In our NextNature event BVPS (May 2008), Kevin Kelly spoke of technology as the 7th kingdom of life : a form of evolution whithout the nasty side–effect of dying (Every object …

Visual of The Order Electrus

The Order Electrus

"Nature adapts, even to human actions that seem to destroy everything. The amazing power of evolution has given birth to a new species of insect. Their ideal habitats are old …

Visual of The Photoshop Beauties

The Photoshop Beauties

Usually we don't realize the hours of photoshopping spent on magazine and advertising images before publication. The raw photographic material reveals a lot about the fine craft …

Visual of The Telepresence Frame

The Telepresence Frame

The Telepresence Frame is a domestic object which utilises the fact that one's bodily functions are digitised in order to create a new form of telepresence. Allowing loved ones to …

Visual of Traffic nature

Traffic nature

Japanese scientists made people drive in circles to find out how traffic jams get born. Related: Human Swarms | Harvesting Traffic Information through GSMs |  The things we design …

Visual of When Facebook gets Physical

When Facebook gets Physical

What would it be like if the communication on a social networking site like Facebook was actually played out in everyday life? Hilarious sketch by Idiots of Ants (thanks Martijn ).

Visual of Where shoes come from

Where shoes come from

Made by Studio Smack

Visual of A plate that regulates the speed of eating

A plate that regulates the speed of eating

Many people tend to eat too fast. As a result they do not receive signals from the stomach that they are in fact full. The result can be overeating and obesity . To encounter …

Visual of Aging Barbie

Aging Barbie

You wouldn't give it to her but Barbie is already over 50 years old. The doll made her debut at the American International Toy Fair in  1959 and has been a young girls (and gays) …

Visual of Animatronic window dummy

Animatronic window dummy

What if the mannequins in the shopping windows suddenly started moving? Would you buy more, or would it just trigger your anthropomorphobic responses? Soon we will know. Momo is a …

Visual of Antenna Tree Mast Safari

Antenna Tree Mast Safari

This picture was taken in Zambia by Sarah Los (NL) while on wildlife safari . Every fairly trained "NextNature spotter" should be able to distinguish the cellphone-tree masts from …

Visual of Anthropomorphic 3d webcam

Anthropomorphic 3d webcam

This new 3D webcam with two cameras spaced approximately as far apart as human eyes is our anthropomorphic object of the week. Can you feel it, watching you? The little brother …

Visual of Augmented Phone Browsing

Augmented Phone Browsing

This video shows the first beta version of TwittARound – an augmented reality Twitter viewer on the iPhone 3Gs. It shows live tweets around your location on the horizon. Because …

Visual of Battery-Free Implantable Neural Sensor

Battery-Free Implantable Neural Sensor

The shrinking size of electronics allows for the implantation of increasingly sophisticated electronic devices in the human body, paving the way for new prosthetics and …

Visual of Beauty kit for little girls

Beauty kit for little girls

Plastic fantastic starts at an early age. Created by Pleix . Related: Photoshop Beauties , Software that ranks female beauty , Virtual Miss , Natural Breasts .

Visual of Bioluminescent Trees will Replace Streetlights?

Bioluminescent Trees will Replace Streetlights?

Most people know about light emitting organisms such as jellyfishes, fireflies and mushrooms . Some time ago, genetic engineers transferred genes responsible for the luciferin and …

Visual of Brain Scan Replaces Job Interview in 5 Years?

Brain Scan Replaces Job Interview in 5 Years?

Forget about palmistry! MRI scans for candidates in top jobs such as bank directors could soon become part of the job-application package, says Erasmus University researcher Prof …

Visual of Brainwave Binoculars

Brainwave Binoculars

The eye passes on more information to the brain than the brain will process. In that sense, the brain functions as a filter. But on the battlefield the risk of neglecting …

Visual of Ceci n'est pas une Roche

Ceci n'est pas une Roche

I went to Disneyland and all I got was this lousy rock... Via ivaniannoli.com | Related: Ceci n'es pas une Montagne | Summit of the Mount Everest On Tour | Treetrunk Trashcan | …

Visual of Clean linen toilet spray

Clean linen toilet spray

So what to think of this? A toilet spray that mimics the smell of clean linen. It is great in the beginning, yet in time your bed will smell like a toilet. Found in the futuristic …

Visual of Colalife

Colalife

Coca-Cola© succeeds in what most NGO's try to achieve: getting the goods to the poor in the 3rd world   Africa. For most people there, a Coke is easier to get and cheaper than a …

Visual of Crowdsourced drink

Crowdsourced drink

Remember the days when the flavor of a fruity drink was simply connected to an apple, orange, strawberry, kiwi, or perhaps – if you felt really exotic – an acai berry? Nowadays we …

Visual of Designing Bugs That Eat Plastic

Designing Bugs That Eat Plastic

It is a well known secret that plastic hardly breaks down and almost all of the plastic ever made still floats around somewhere . With the great pacific garbage patch now twice …

Visual of Energy Saving Chandelier

Energy Saving Chandelier

I deem you have to be over sixty to have an object with so many historical layers of media in your house. Let's analyze. We are looking at a chandelier in which the candle …

Visual of Escape of the Prairiedogs

Escape of the Prairiedogs

" It took just 10 minutes for a dozen prairie dogs to outwit the creators of the Maryland Zoo's new $500,000 habitat. Aircraft wire, poured concrete and slick plastic walls proved …

Visual of Exmovere Chariot: the wearable wheelchair

Exmovere Chariot: the wearable wheelchair

Exmovere Holdings , a biomedical engineering company, is focused on government and consumer applications for healthcare, security and mobility. This company developed Exmovere …

Visual of Eyeborg

Eyeborg

The Eyeborg Project is the work of Rob Spence, a 36 year old filmmaker residing in Toronto, Canada and Kosta Grammatis – an unemployed engineer from San Francisco, California. …

Visual of Field of Waves

Field of Waves

Parks are not nature. Parks are culture: man-made simulations of nature, carefully constructed to provide walkers, runners and mountain bikers with a recreational, yet confined – …

Visual of French Hyperbodies

French Hyperbodies

"Paris, printemps 2019: Oh Darling, you look gorgeous." Nowadays we are so used to Hollywood hyperbodies – a simulation of a body that never existed – it is good to see a …

Visual of Fresh from the Pharm

Fresh from the Pharm

Will we in the future still buy several needs according food in shops, or will we grow M&M’s ourselves? There is a lot happening on in the field of food technology , think for …

Visual of Fruit4Day

Fruit4Day

Fruit does wonders for your health. No doubt about it. It is recommended to consume two pieces of fruit each day. One.. Sorry, I've lost count? How convenient to have the two …

Visual of Future babes

Future babes

A future in which prosthetic patches prevent bodies from aging? Or a sexists view on femininity in robotics?   Either way, the question is whether they are up- or downgrades of …

Visual of How do Bacteria Communicate?

How do Bacteria Communicate?

So here we are; bragging about our discoveries and great new ways of living... meanwhile we tend to forget that we are NOT the dominant species on the surface of the earth. …

Visual of How will Michael Jackson appear in heaven?

How will Michael Jackson appear in heaven?

Our beloved King of Pop, Michael Jackson, who died tragically at the age of fifty after suffering cardiac arrest, was one of the most widely beloved entertainers and influential …

Visual of I'm loving it

I'm loving it

Sometimes you just need to settle with the surrogate. Peculiar image of the week. See also (in the baby series): Infant pillow , We are all born in a world . Thanks Hendrik-Jan .

Visual of Living Doll

Living Doll

Crying, talking, sleeping, walking... not really, but this is what Cliff Richard's concept could look like when laboratorised. "To demonstrate a new method for fabricating …

Visual of Melting polar bear reveals a metal skeleton

Melting polar bear reveals a metal skeleton

Unsure how this melting polar bear ice sculpture created by artist Mark Coreth fits in Next Nature mythology. The art piece was presented last week in Copenhagen and is sponsored …

Visual of Modernistic Meat

Modernistic Meat

This slightly uncanny piece of modernistic meat is actually not made from meat, but from wax, oil, paint polystyrene, stage blood & latex, by artist John Isaacs , who titled …

Visual of Nano snowman

Nano snowman

This snowman is 10 µm across, 1/5th the width of a human hair. The snowman was made from two tin beads used to calibrate electron microscope astigmatism. The eyes and smile were …

Visual of New Media 80.000 BC

New Media 80.000 BC

Every medium was new oneday . This point is beautifully illustrated in the movie Quest for fire ( La Guerre de feu by Jean-Jacques Annaud, 1981), a must-see for Next Nature …

Visual of No Signal

No Signal

As technology evolves, people are more and more depending on it to function properly. But the nature of technology is that it needs networks, sources, software, batteries and …

Visual of Nocturnal Life of Diurnal Birds

Nocturnal Life of Diurnal Birds

English Robins are forced to sing their song during the night. Not because they have figured out that music just sounds better in the dark, but because they can't compete with the …

Visual of Not so Happy Meals

Not so Happy Meals

This week a Brazilian prosecutor asked a judge to nationally ban toys sold with meals in fast-food outlets like McDonald's and Burger King, because it can lead children to develop …

Visual of Pelvis Rocking Chair

Pelvis Rocking Chair

It is nature, but not like we know it when chairs biomimic the pelvis. This anatomic Ruby rockingchair was designed by Pouyan Mokhtarani , Tehran (Iran). Via b oingboing.net | …

Visual of Photoshopped Billboards

Photoshopped Billboards

Nice adbust in Berlins subway. Photoshop panels were put over the image to make reassure us that nobody is actually born that beautiful. More images . See also: Photoshop Beauties …

Visual of Popolate

Popolate

Peculiar image of the week. Created by Janis Pönisch and Anne de Vries .

Visual of Project Natal: You are the Cursor

Project Natal: You are the Cursor

Today browsing and gaming is dominated by the shortcomings of machines, for machines simply do not know who is on the other end. Man needs to interact; therefore man needs to …

Visual of Real Baby Dolls

Real Baby Dolls

We already know that guys love dolls ... Now learn why some mothers can never stop playing with dolls and that cuteness is defined in the mind's eye. Image credit: Kentish Babies …

Visual of Recycling Robot Takes the Streets of Italy

Recycling Robot Takes the Streets of Italy

Let the robots do the dirty work! This real-life Wall-E Recycling robot, part of the $3.9 million DustBot research program that is trying to improve urban hygiene, collects trash …

Visual of Reprogramming Skin Cells into Stem Cells

Reprogramming Skin Cells into Stem Cells

A major breakthrough in the world of genetics: Researchers have successfully reprogrammed skin cells into stem cells. Using a technique called iPS cell reprogramming (developed in …

Visual of Rubber Duck XL

Rubber Duck XL

This gigantic rubber duck was created by artist Florentijn Hofman and is currently traveling around the world. Unsure how the over-sized bird is related to our explorations in …

Visual of Sunflowers – electric gardening

Sunflowers – electric gardening

A retail lot in Austin, Texas recently sprouted a field of solar photovoltaic sunflowers that soak up the sun’s rays to provide shade while generating a steady stream of …

Visual of The Eye of a Cyber Sapien

The Eye of a Cyber Sapien

An  earlier post  on this blog already displayed the possible future of sight using augmented contact lenses.  Researchers at MIT  take this second sight to a next level by …

Visual of The World's first Refrigerated Beach

The World's first Refrigerated Beach

Conspicuous consumption in the overdrive: The world's first refrigerated beach is to be built at a luxury hotel in the Dubai (aka the new Las Vegas) so the tourists don't burn …

Visual of Virtual Characters tortured for Science

Virtual Characters tortured for Science

In the classic Milgram Experiment conducted in the 1960s, volunteers were told by an authority figure to deliver electric shocks to another person as punishment for incorrect …

Visual of Wetware [definition]

Wetware [definition]

Though its exact definition has shifted over time, the term "wetware" and its fundamental reference to "the physical mind" has been around from the mid-1950s. In its original, …

Visual of Wild Birds Illegally Immigrating to City Zoo

Wild Birds Illegally Immigrating to City Zoo

Besides the extensive collection of animals from around the planet, the Amsterdam City Zoo Artis also houses some local wild species on its premises who immigrated into the zoo on …

Visual of Wooden Bankcard

Wooden Bankcard

Silver, gold or platinum creditcards? Expensive metals in credit card design used to have a certain luster in the past, yet today we are all (painfully) aware the mimicked …

Visual of Are Mushrooms the New Plastic?

Are Mushrooms the New Plastic?

Mushroom based plastics? Designer Eben Bayer must have eaten too much of the wondrous chanterelles perhaps? No seriously, the man is turning his vision into a reality with an …

Visual of Becoming female

Becoming female

A shot of a male body after a sex change by dutch artist and photographer Martin C. de Waal . De Waal tries to make people rethink their opinions by pushing the boundaries of …

Visual of Beware of the Virtual Squirrels

Beware of the Virtual Squirrels

Kasey McMahon and Derek Doublin demonstrate the tension between people and their environment through the eyes of its non-human inhabitants. Beware of the Virtual Squirrels ! The …

Visual of Clothes from a Can

Clothes from a Can

Frequent readers of this website might be familiar with our claim that Next Nature emerges from a fusion between the Born and the Made. But now we can add another: the fusion of …

Visual of Craig Venter unveils 'Synthetic Life'

Craig Venter unveils 'Synthetic Life'

Craig Venter announces what might be a historic milestone in the nature caused by people. For 15 years, Craig Venter and his team of scientists have tried to synthesize life from …

Visual of Cuddly Scooters

Cuddly Scooters

Why do we grow attached to things? Patricia Piccinini captured it well in this peculiar work: The Stags - 2008 (Culture becomes nature) The Nest - 2006 Thicker than Water - 2007 …

Visual of Death: An in your Face type of Business

Death: An in your Face type of Business

Everyone wants to be remembered after his or her death. Some choose to be buried, others to be cremated. The company Cremation Solutions has a new service which ensures you will …

Visual of Design Fiction – Medical Bill of the Future

Design Fiction – Medical Bill of the Future

According to this fictitious future medical bill almost every part of the human body will be repairable in 2028. Gut bacteria replacement, Bone tissue growth for skull repair, …

Visual of European Parliament goes Next Nature

European Parliament goes Next Nature

Alright the title "Making Perfect Life" ' may sound a bit 20th-century-modernistic-techno-optimistic-naive, but for the rest we are confident this conference is going to be pretty …

Visual of Experiments in the Revival of Organisms

Experiments in the Revival of Organisms

Experiments in the Revival of Organisms is a 1940 motion picture which documents Soviet research into the resuscitation of clinically dead organisms by Doctor Sergey Sergeyevich …

Visual of There’s Plenty of Room at the Bottom

There’s Plenty of Room at the Bottom

So you’re triggered by our call for products and now you’re considering to send in one, two or maybe three of your brilliant products for the Nano Supermarket? Good. Or – and this …

Visual of First man infected with computer virus

First man infected with computer virus

Doctor gets chip. Chip gets virus. Virus infects other devices... Dalek shoots doctor? Dr. Mark Gasson of Reading University implanted a RFID chip under his skin last year. It is …

Visual of From Main Street to the Mansion: Disney, Playboy and the Next Nature of Sex and Death

From Main Street to the Mansion: Disney, Playboy and the Next Nature of Sex and Death

Nature demanded that we make a choice between immortality and sex, but the Next Nature of the 21st century may not. For help, we can look back to the 20th Century, which had many …

Visual of Google Earth Alphabet

Google Earth Alphabet

Language is communication technology. As Marshall McLuhan said, the spoken word was ‘the first technology by which man was able to let go of his environment in order to grasp it …

Visual of Grapple – a Grape flavored Apple

Grapple – a Grape flavored Apple

They say “An apple a day keeps the doctor away”, but now we wonder what this keeps away, the Grapple , a hyperfruit that "Grunches like an Apple. Tastes like a Grape." The …

Visual of How to Grow an Organ

How to Grow an Organ

Buckle up for the state of the art in the fusion of the made & the born. Anthony Atala of the Wake Forest Institute for Regenerative Medicine presented footage of his …

Visual of HP Computers are Racist

HP Computers are Racist

These two co-workers found out the face tracking feature of the utterly advanced HP webcam will not recognize or track black faces. Hewlett Packard says it's because the program …

Visual of Hydrogel Heals Injured Brain & Bone-Tissue

Hydrogel Heals Injured Brain & Bone-Tissue

A new nano-particle-infused hydrogel, developed by scientists from Clemson University, should be able to heal scrambled brains and broken bones. The gel creates new blood vessels …

Visual of iBookshelf: Simulation before Extinction

iBookshelf: Simulation before Extinction

As technology progresses we constantly have to adapt ourselves to an ever changing media landscape. Designers try to smooth the changes with a ' progressive nostalgic ' strategy: …

Visual of Inkjet Bio-Printing the Skin

Inkjet Bio-Printing the Skin

In the series of bio-printer stories this inkjet-like bio-printer seems to be the most convincing product to hit the market soon. It sprays skin cells directly onto burn victims,  …

Visual of Intimacy Dress

Intimacy Dress

The Intimacy dress takes our notion personal space to a next level: the closer someone approaches, the more transparent the dress becomes. As such, the garment becomes a sort of …

Visual of Invisibility Cloak Hides Objects Visible To The Naked Eye

Invisibility Cloak Hides Objects Visible To The Naked Eye

Some years ago scientists managed to build a rudimentary invisibility cloak, which was an impressive device but it had some important limitations, not least of which was that it …

Visual of LED Religion

LED Religion

  The Catholic Church is not exactly renowned for its progressive attitude towards technological progress. Just think of the belligerent attitude the Church still has towards …

Visual of Making a Telegraph with Stone Age Tools

Making a Telegraph with Stone Age Tools

The suited guy in the video is an employee from the office of materials that goes into the wilderness to test if it would have been possible to create a fully functioning …

Visual of Matt Ridley – When Ideas have Sex

Matt Ridley – When Ideas have Sex

At TEDGlobal 2010 , author Matt Ridley argues how, throughout history, the engine of human progress has been the meeting and mating of ideas to make new ideas. According to …

Visual of Meat Stylus

Meat Stylus

“ Who wants a stylus? ” Words by Apple’s Steve Jobs when introducing the iPhone that uses a revolutionary input device: the finger. And it works wonderfully, yet in some …

Visual of Memory Helmet

Memory Helmet

Protection is the fundamental purpose of the helmet. This helmet, a conceptual design project by Seungjoo Lee , enables the storage and protection of memories. Plug in your USB to …

Visual of Nature as a Commodity

Nature as a Commodity

Nature conservation organizations – like the WWF and Greenpeace – typically present nature as a commodity that has become increasingly scarce and will be used up altogether if we …

Visual of Nature is an Agreement

Nature is an Agreement

Nature is an agreement. Just like the nude beach. Here you keep your breasts and your crotch covered, There you drop everything and act like it is the most ordinary thing in the …

Visual of Next Nature Movie #2: Being There

Next Nature Movie #2: Being There

The main character in ‘Being There’ (1979) is a simple-minded gardener named Chance, played brilliantly by Peter Sellars, who has spent all his life as a servant in the Washington …

Visual of Next Nature Movie #6: The Matrix

Next Nature Movie #6: The Matrix

In the last few decades there have been numerous films that take the struggle between mankind and its increasingly intelligent and autonomous technology as a leitmotif. Ranging …

Visual of Next Nature Movie #7 – Grizzly Man

Next Nature Movie #7 – Grizzly Man

The sad story of Timothy Treadwell is the ultimate example of the drama a naive notion of nature can bring about. Grizzly Man (2005) opens with the facts surrounding Timothy …

Visual of Next Nature Movie Top 10

Next Nature Movie Top 10

1. Quest for Fire / La Guerre du Feu (1981) 2. Being There (1979) 3. Koyaansiqatsi (1983) 4. Blade Runner (1984) 5. American Beauty (1999) 6. The Matrix (1999) 7. Grizzly Man …

Visual of Oil Diet: Recipes for Disaster

Oil Diet: Recipes for Disaster

Do you know how much oil you use per day? Neither did director John Webster. In 2005 he decided to make a documentary about oil from his own families perspective. How would it be …

Visual of Onion Pill

Onion Pill

Since the intake of medicines has become a mundane ritual nowadays, why not naturalize the interface? French artist Mathieu Lehanneur is rethinking the pill-person interface in …

Visual of Recycled Island

Recycled Island

Recycled island is a research project on the potential of realizing a habitable floating island in the Pacific Ocean made from all the plastic waste that is momentarily floating …

Visual of Robosaurus eats Cars for Breakfast

Robosaurus eats Cars for Breakfast

The Robosaurus is the only airplane eating, fire breathing robot on the planet. Pity the thing is merely build for entertainment purposes. Perhaps this thing could finally solve …

Visual of Rocky Messages

Rocky Messages

These SMS-style messages scribbled into the mountains by Belgian artist Wim Delvoye , make us so humbly aware of the discrepancy between our everyday human experience and some of …

Visual of Search Stories

Search Stories

Once upon a time humans told stories by painting on cave walls, showing plays in an amphitheater, pressing text on paper and shining light trough pieces of film. Today we tell our …

Visual of Self-healing Surfaces

Self-healing Surfaces

What if a scratch on your car door could heal itself, just like the human skin does? Engineers are working on a way to transfer the self-healing ability of the skin to surfaces …

Visual of Skin Paper

Skin Paper

Skinpaper is a speculative work by Tommaso Lanza and Vanessa Harden that explores the cross section between a living specimen and paper. "Skin paper is made of breathable …

Visual of Space Monkey

Space Monkey

During the 1960s, monkeys were sent into outer space as part of the US space exploration program. But they didn’t all return, until now. Via scaryideas.com | Related: WWF

Visual of Squamata headset dances with the Music

Squamata headset dances with the Music

Inspired by body language of animals (in particular squamates and porcupines), designer Jop Japenga created a headphone with an adaptive skin that responds to the music played on …

Visual of Squirming ‘umbilical’ phone cable

Squirming ‘umbilical’ phone cable

This umbilical cord-inspired charger cable by interactive media artist Mio I-zawa comes to life when connected to an iPhone. Don't watch the video if you are anthropomorphobic . …

Visual of Stelarc wins Prix Ars Electronica

Stelarc wins Prix Ars Electronica

Glad to announce that performance artist Stelarc – who already for some decades incorporates themes of cyborgization and other human-machine interfaces in his (very bodily) work – …

Visual of Stereotype Packaging

Stereotype Packaging

According to the World Health Organization (WHO), unhealthy diet is amongst one of the leading causes of the major non-communicable diseases. Can design encourage people to …

Visual of Sign Out Forever

Sign Out Forever

An earlier post on Next Nature learned that The Good People behind Webwill provide us with a service to extend our lives on social networks after our physical death. But what if …

Visual of The Footsticker

The Footsticker

There are many advantages of bare feet sporting: better motion control, more feeling in your feet and direct floor contact, etc. In this way you are more grounded and more aware …

Visual of The Stray Shopping Cart Project

The Stray Shopping Cart Project

"Until now, the major obstacle that has prevented people from thinking critically about stray shopping carts has been that we have not had any formalized language to differentiate …

Visual of Unlimited Urban Woods

Unlimited Urban Woods

What to do when you have a small city with limited space, and you rather turn available space into parking lots instead of parks? You turn to DUS Architects for an unlimited …

Visual of X-Ray Visions

X-Ray Visions

Anyone who ever saw an x-ray picture of himself will probably recognise the uncanny feeling of staring at your own skull or bones and being confronted by one of nature’s grim …

Visual of A bacteria of a different color

A bacteria of a different color

In 2009, undergraduates at the University of Cambridge worked with scientists and artists to engineer E. coli into E. chromi , a new type of bacteria that secretes a range of …

Visual of Afterlife for Atheists

Afterlife for Atheists

Where religions promise their believers a life after death and cryonics also needs a kind of belief in future technological development, designers James Auger and Jimmy Loizeau …

Visual of Amber Case: We are all Cyborgs Now

Amber Case: We are all Cyborgs Now

Technology is evolving us, says cyborg anthropologist Amber Case in her 8 minutes of TED . We become a screen-staring, button-clicking new version of homo sapiens, relying on …

Visual of Animals Made from Other Animals

Animals Made from Other Animals

That's no reindeer, and it's certainly no moose. It's an Irish Elk, Megaloceros giganteous , a deer that happens to be neither an elk, nor really all that Irish. What it does …

Visual of Anthropocene for Dummies

Anthropocene for Dummies

The Anthropocene is the recently proposed epoch of Earth history that, proponents say, has begun with the rise of the human species as a globally potent biogeophysical force, …

Visual of Blinky – Does what we want it to do

Blinky – Does what we want it to do

In the short movie Blinky, on a boy and his robot, director Ruari Robinson reflects on our daily dealings with technology and its risks. Alex is a child growing up in a family …

Visual of Body Manipulation and Music

Body Manipulation and Music

Lucy McRae uses spandex to deterritorialize the body. #powershow #bodyart http://bit.ly/th7KyR

Visual of Brainscan App

Brainscan App

By hooking up a commercially available EEG headset to a Nokia N900 smartphone, Jakob Eg Larsen and colleagues at the Technical University of Denmark in Kongens Lyngby have created …

Visual of Browsing the Technological Sublime

Browsing the Technological Sublime

In this video, Geert Mul uses online photos to tap into the divine presence in image search #powershow http://bit.ly/uk79b0

Visual of Catalytic Clothing

Catalytic Clothing

Catalytic Clothing is a fashionably calm technology that aims to tackle air pollution by embedding a substance in the clothing that purifies air when you wear it. The purifying …

Visual of Cheiracanthium drives a Mazda

Cheiracanthium drives a Mazda

In March, Mazda recalled 65,000 cars, not because of any structural faults in the vehicle, but because the engineers had inadvertently created the perfect habitat for a tiny …

Visual of City Planning with Bright Bacteria

City Planning with Bright Bacteria

Renegade architect and futurist  Rachel Armstrong has proposed that our cities, currently constructed of dead trees, baked mud, and refined ore, need to be coated in a layer of …

Visual of Crows crack nuts... and traffic patterns

Crows crack nuts... and traffic patterns

http://www.youtube.com/ watch?v=BGPGknpq3e0 Narrated by the incomparable David Attenborough, this footage goes to show that urban birds really are smarter . The cross-walking …

Visual of Deus Ex: The EyeBorg Documentary

Deus Ex: The EyeBorg Documentary

Back in 2009 Rob Spence, a cyborg film maker, worked together with a team of ocularists, inventors, engineering specialists on a prosthetic eye which can capture and stream video. …

Visual of Did Nature Cease to Exist in the '60s?

Did Nature Cease to Exist in the '60s?

Our historical snippet of the moment is a Canadian television fragment from 1968 featuring a debate between Norman Mailer and Marshall McLuhan on the implications of media …

Visual of Exploring the Oceans of Plastic

Exploring the Oceans of Plastic

Captain Charles Moore of the Algalita Marine Research Foundation first discovered the Great Pacific Garbage Patch – an endless floating waste of plastic trash. Now he's drawing …

Visual of Facing your Car

Facing your Car

Do cars have a face? You would be inclined to say yes immediately. And you would be right as well, because they do. Study has confirmed through a complex statistical analysis that …

Visual of Fake Plastic Bags – Made From Real Leather

Fake Plastic Bags – Made From Real Leather

Fakeness is traditionally associated with inferiority; cheap Rolexes that break in two weeks, plastic Christmas trees, leaking silicone breasts, imitation caviar... However, in a …

Visual of Information Decoration Scarf

Information Decoration Scarf

Remember the Information Decoration essay which argued our so-called information society barely employs our human bandwidth, as most of the data in our lives is presented in …

Visual of It's a plane!

It's a plane!

By nature, man is not meant to fly. But while we're at it, we may as well turn it into an experience . Charles Champion, Airbus Executive Vice President Engineering, envisions a …

Visual of Kitten Ears – Blushing 2.0

Kitten Ears – Blushing 2.0

Always wanted a pair of kitten ears to express your feelings to the world? Well, you probably never thought of that – as you have to be a Japanese genius to come up with such an …

Visual of Labradoodle

Labradoodle

Indulge in its cuteness. The Labradoodle brings us the finest blend between the labrador and the poodle. Combining sociability with beauty, they are the perfect human companion. …

Visual of Let the Algorithms Roam Free

Let the Algorithms Roam Free

In this TED talk, Kevin Slavin explains how computer algorithms are breaking free of their virtual habitats and changing the physical world to their liking. Through algorithms, …

Visual of Live a happy life!

Live a happy life!

Remember the movie Eternal Sunshine of the Spotless Mind, where Jim Carrey removes his memories of a relationship with Kate Winslet? According to researchers at the University of …

Visual of Manko & Soup  [#6]

Manko & Soup [#6]

When Nada returned as promised with a small bowl of soup in her hands, Manko was sitting upright with a grumbling stomach. Even now that Manko could see normal again, Nada's hair …

Visual of Manko & The Children [#9]

Manko & The Children [#9]

As they went down the elevator shaft, going deeper underground, neither Nada nor Manko spoke a word. To Manko it seemed to take forever. In his mind, he went over the long …

Visual of Mastering Bambi

Mastering Bambi

In the film Mastering Bambi, artists Persijn Broersen and Margit Lukacs have stripped the landscape of its cuddly, anthropomorphic characters. Over the course of the film, the …

Visual of Microbic Landscapes

Microbic Landscapes

Beautiful Google Maps shots of housing projects in southwest Florida. Probably designed to look and feel more natural than your average straight street neighborhood, they remind …

Visual of Morphing Cutlery

Morphing Cutlery

Imagine a world where the shapes of all objects around you would be able to change on the fly. Envision a future where nanotechnology and morphing become ubiquitous and blend in …

Visual of Negative Islands

Negative Islands

Recent flooding along the Mississippi River has broken records first set 70 years ago. As always, it's hard to attribute local weather to global patterns, but the heavier rainfall …

Visual of Next Nature Book Sample

Next Nature Book Sample

Try before you buy. Browse the sample excerpt of the lustrous Next Nature book containing material from chapter 1 & chapter 3. Books bricks are currently being shipped across the …

Visual of Next Nature Hands Out Performance-Enhancing Pills

Next Nature Hands Out Performance-Enhancing Pills

Recently Google slapped our site with a warning that "something's not right here!" It seems that the Drug Enforcement Agency has caught the Next Nature staff handing out baggies …

Visual of One Chicken Feeds 100 People

One Chicken Feeds 100 People

Our peculiar image of the week is not what it seems. Rather than a man with a gigantic chicken on a leash, you are looking at a normal chicken with an incredibly shrunken man …

Visual of Pregnant Avatars

Pregnant Avatars

This interview from 2008 is exemplary for a time when people started experimenting on humanizing anonymous avatars in the virtual realm. Shopping, building, going on holiday, …

Visual of Remote Kissing Device

Remote Kissing Device

Nobuhiru Takahashi, student at the Kajimoto Laboratory of the University of Electro-Communications in Chofu City, Tokyo, invented this Internet French kissing device. When a …

Visual of Resizing Daddy

Resizing Daddy

A little girl gets angry at her father, and uses her index finger and thumb to make a pinching motion . No, she's not trying to hurt him. She's using iPad sign language to say, "I …

Visual of Robot Guide Dog

Robot Guide Dog

#! Possibly the answer for blind people with cynophobia, the fear of dogs. This robot guide dog is stil a bit slow compared to the old nature version, but as technology advances …

Visual of Rule #2: Different People Anthropomorphize Differently

Rule #2: Different People Anthropomorphize Differently

For past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design,  click here.   What people experience as anthropomorphic is highly personal. Tests have …

Visual of Rule #3: Keep it ASS: Abstract, Simple and Subtle

Rule #3: Keep it ASS: Abstract, Simple and Subtle

For past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design,  click here.   Making good use of anthropomorphism isn’t easy. As you’ve probably …

Visual of Shrink

Shrink

You are what you eat, taken seriously. Shrink is a work by the artist Lawrence Malstaf . Visitors place themselves between two large, transparent plastic sheets. The air gets …

Visual of Sin free for just €1.59

Sin free for just €1.59

For just £1.19 ($1.99, €1,59) you can download an app for your iPhone which offers tips and guidelines with the sacrament, "the perfect aid for every penitent" as the description …

Visual of Social Microbial life

Social Microbial life

MyMicrobes , interestingly dubbed "Fecesbook" by ABC News , is the new social network for your gastrointestinal bacteria. For only $2,100 and a bit of poo you can become a member …

Visual of Spidergoats & Superskin

Spidergoats & Superskin

While some of us might have heard of the humorous but fictional ' spider pig ,' spidergoats are the real deal. Although you might expect to see them lounging in giant webs or …

Visual of Swallowable Parfum

Swallowable Parfum

Swallowable Parfum is a digestible scented capsule that works through your own perspiration. Once absorbed, fragrance molecules are excreted through the skin’s surface. A unique …

Visual of Technology: The 7th Kingdom of Life

Technology: The 7th Kingdom of Life

Kevin Kelly, Senior Maverick at Wired Magazine talks about the nature of technology and propose to define technology as the 7th Kingdom of Life.

Visual of The Banana Gets a Second Skin

The Banana Gets a Second Skin

We already know that bananas are  evidence of intelligent design – by  farmers, not by god.  All commercial crops have been tweaked by the hand of agriculture, but modern bananas …

Visual of The Nauga's Hyde

The Nauga's Hyde

Sometimes new technology has to bio-mimic old nature to be accepted. In the late 1960s and early 70s, Uniroyal Engineered Products invented the 'nauga' a beast that gives its name …

Visual of The Pigeon that Shat the Golden Soap

The Pigeon that Shat the Golden Soap

Ever wished you could take a shower with pigeon poop? Artist Tuur van Balen proposes changing pigeons from flying rats to cleaning agents. A speculative, specially engineered …

Visual of Theriomorphous Cyborg

Theriomorphous Cyborg

The Animal Architecture Awards have just announced the winners of their 2011 contest. Taking first place is Simone Ferracina's Theriomorphous Cyborg , a (speculative) augmented …

Visual of Typing Out Evolution

Typing Out Evolution

From the exhibit "What Machines Dream Of" in Berlin comes Life Writer , a work by Christa Sommerer and Laurent Mignonneau. As the participant types, letters are projected on a …

Visual of Virtual Offline Shopping

Virtual Offline Shopping

As the second most hardest working people on this planet, Koreans obviously dread their weekly shopping for groceries. It is therefore that Home Plus (Tesco in Europe) plastered …

Visual of Why Handwriting Must Die

Why Handwriting Must Die

Associate professor Anne Trubek argues that handwriting will soon be history , because writing words by hand is a technology that's just too slow for our times, and our minds. A …

Visual of Woodplastics

Woodplastics

Looking for a new kitchen counter-top, but can't decide between a  natural or an artificial material? Soon you might be getting both . Designer Hironori Yoshida is pioneering …

Visual of #11: Don’t Use Anthropomorphism if it Does Not Serve Any Purpose

#11: Don’t Use Anthropomorphism if it Does Not Serve Any Purpose

Part 11 of the series 11 Golden Rules of Anthropomorphism and Design Anthropomorphism can be a powerful tool in product design. But there are also risks involved that urge …

Visual of 3D Printing a New Face

3D Printing a New Face

Earlier this year, Belgian surgeons successfully performed the country's first full-face transplant using 3D printing. The operation was conducted by a medical team of Ghent …

Visual of A Computer that Nods and Waves When You Do

A Computer that Nods and Waves When You Do

Ever wish you could express yourself better over Skype? Tired of being a disconnected head-in-a-box? A team at Stanford University has rigged a Mac computer screen to shake its …

Visual of A More Realistic Mermaid

A More Realistic Mermaid

After being denied permission to reproduce the famed Little Mermaid statue from Copenhagen, the authorities of Vancouver decided to go for something more realistic.

Visual of Architect Aims to Build House From Plastic Waste

Architect Aims to Build House From Plastic Waste

Interpreting the plastics in the Earths ecosystem as building material rather than as waste.

Visual of Automotive Monsoon – Reign or Rain of the Cars?

Automotive Monsoon – Reign or Rain of the Cars?

Try it once. Go stand near a highway, close your eyes and listen carefully. Hear the sound of tires on the asphalt, hear the rhythmic ‘sshhh’, focus on this particular sound. And …

Visual of Bioinspired Robojelly Can Swim Forever

Bioinspired Robojelly Can Swim Forever

Scientists have developed a biomimetic robot that will be able to swim forever, since its artificial muscles are powered by water. And since Robojelly lives underwater, it will …

Visual of Braille 2.0

Braille 2.0

Text for blind people using the Braille alphabet has been around for some time. But instead of making separate books for the visually impaired, why not change the way we all read? …

Visual of Charging Phones by (and with) Camp Fire

Charging Phones by (and with) Camp Fire

With areas of New York still without electricity, BioLite  recently came to the rescue of Brooklynites by   setting up a charging station  with camping stoves that convert excess …

Visual of Complexity and Evolving Synthetic Soil

Complexity and Evolving Synthetic Soil

Twenty-first century society draws from a world that is less determined by objects and increasingly shaped by connectivity. The clear either/or distinctions that formerly informed …

Visual of Conservationists Turn Their Sights on Urban Habitats

Conservationists Turn Their Sights on Urban Habitats

For city-dwellers, the closest 'true wilderness' to be found is usually the weeds sprouting in abandoned lots. Snow-capped, postcard nature might be beautiful but is …

Visual of Darwinian Selection of the Cowboy Hat

Darwinian Selection of the Cowboy Hat

The standard story of the cowboy hat goes something like this: In 1865, J.B. Stetson went out west during the California gold rush. He observed that bowlers, raccoon hats, and …

Visual of Does Chocolate Milk Come From Brown Cows?

Does Chocolate Milk Come From Brown Cows?

Although chocolate milk producing cows may sound silly, scientists are seriously analyzing the feasibility of the idea. Why not add genes of cocoa and sugar to a cow, in order to create a cow that produces sweet chocolate milk?

Visual of Everything is an Event on the Skin

Everything is an Event on the Skin

wrote 19th-century scientist and philosopher Hermann von Helmholtz. It was Helmholtz who inspired body-architect Lucy McRae to create Morph?.

Visual of Featured Page #01: Hypernature

Featured Page #01: Hypernature

During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . To kick the series off, we’ll start with a spread about hypernature; the …

Visual of Featured Page #02: Google Nature

Featured Page #02: Google Nature

During the coming weeks, we will present a selection of our favourite pages from the Next Nature book . This week the second one in this series: Google Nature. Imagine you are an …

Visual of First

First "Farm"aceuticals Grown in Carrots

The United States Food and Drug Administration recently approved Elelyso, the first drug to be grown in genetically modified plant cells. Produced in carrot cells, this drug helps …

Visual of GM Bacteria Turn Carbon Dioxide into Biofuel

GM Bacteria Turn Carbon Dioxide into Biofuel

In a twist on the classic " microbes that turn shit into petrol ", researchers at MIT have developed a bacterium that turns carbon dioxide into a direct substitute for gasoline. …

Visual of Goats Replace Lawnmowers in San Francisco

Goats Replace Lawnmowers in San Francisco

They might not be as fast, but goats offer several advantages over diesel-powered lawnmowers. They're quieter, they emit fewer greenhouse gases, and they fertilize soil as they go …

Visual of Huggable Vending Machine

Huggable Vending Machine

Finally a vending machine that doesn't want you money, it wants hugs. Embrace it to get a free can of coke. Might give you rushes of anthropomorphobia too though. Via The Pop-Up …

Visual of Eating In-Vitro: Instant Meat Powder

Eating In-Vitro: Instant Meat Powder

The number one argument for eating meat: it provides nutritious proteins that cannot be entirely supplied by vegetarian alternatives. Like it or not, humans are omnivores. Meat is …

Visual of Jellyfish built from Rat Cells

Jellyfish built from Rat Cells

Another step in the fusion of the made & the born: Researchers at Harvard University managed to make an artificial jellyfish using a sheet of silicone and rat heart cells. The …

Visual of Jet Powered Barbecue

Jet Powered Barbecue

At first sight it seems plain wrong to roast your burgers on this utterly technological machine: barbecuing is supposed to be a nostalgic low-tech activity that brings us back to …

Visual of Jewels from the Ocean

Jewels from the Ocean

Designer and former fashion model Barbara de Vries was cleaning plastic litter off her favorite beach in the Bahamas, when she noticed the plastic fragments were all uniquely …

Visual of Let the Robotic Farmers feed the World

Let the Robotic Farmers feed the World

The future of farming is not to be found in further mass-industrialization nor in the return to traditional farming with man and horse power, but rather in swarms of smart, cheap robotic farmers that patiently seed, tend and harvest fields one plant at a time without the need for damaging pesticides.

Visual of Lowtech Plastic Surgery

Lowtech Plastic Surgery

So this is what you get when artists Lucyandbart practice their low-tech plastic surgery techniques on visitors of the MU gallery in Eindhoven. We are clueless on whether it was …

Visual of Lucy McRay - Swallowable Parfum

Lucy McRay - Swallowable Parfum

Know garlic? Now imagine we could make something that functions alike, but smells a lot better. That's what Swallowable parfum is about.

Visual of Macbook Pro Fragrance

Macbook Pro Fragrance

Nothing beats the factory-scent of expensive, freshly unboxed technology! Artist group Greatest Hits produced the Apple Unboxing Scent for use at an exhibition in Melbourne, where …

Visual of Mark Post - Meet the New Meat

Mark Post - Meet the New Meat

According to professor Mark Post, lab-grown meat could become the environmentally friendly alternative for breeding cows and pigs for meat consumption. Watch his talk!

Visual of Mobile Phone Avant La Lettre

Mobile Phone Avant La Lettre

Our peculiar image of the week is exemplary of our human longing for technology that intimately integrates with our body & senses. We are all cyborgs .

Visual of Mushrooms: The New Solution for our Plastic Problem?

Mushrooms: The New Solution for our Plastic Problem?

You cannot look around your local environment without seeing something made out of plastic. Almost all the stuff we buy is packaged in plastic. Since recycling packaging materials …

Visual of Nano Product: Energy Belt

Nano Product: Energy Belt

With Energy Belt, stop treating your excess fat like a liability, and instead embrace its untapped potential. Artificial protocells in the belt mimic natural  brown fat, taking …

Visual of Nano Product: Nansense

Nano Product: Nansense

For years, people have relied on harsh drugs and irritating alarms to control when they sleep and when they wake. Now, the Nansense wristwatch offers an all-natural way to …

Visual of NANO Product: The Necklace

NANO Product: The Necklace

Breast cancer is a disease that comes with feelings of helplessness and loneliness. This nanotechnological necklace allows you to regain some control regarding your disease, in …

Visual of Nanotech Bracelet Detects Allergies

Nanotech Bracelet Detects Allergies

Designed by Luc de Smet, Awear is a speculative bracelet that can detect and record the sources of allergies for children in uncontrolled environments, such as schools and …

Visual of Nanotech Water Bottle Harvests Water from the Air

Nanotech Water Bottle Harvests Water from the Air

The Namib desert gets less than a half an inch of rain per year, yet the stenocara beetle manages to survive in these punishing conditions. The beetle's secret lies in an array of …

Visual of Nature Disappears from Childrens' Books

Nature Disappears from Childrens' Books

In an analysis of Caldecott Medal winning children's books, sociologist Allen Williams recently discovered that depictions of nature  have dramatically declined  from 1938 to …

Visual of New Robot Turns Poo into Energy

New Robot Turns Poo into Energy

Though disgusting, sewage is an abundant, nutrient-rich resource. Researchers at the University of West England have taken advantage of this fact by creating  a robot that turns …

Visual of New Volvo Recognizes Shapes of Animals like Deer & Elk to Reduce Crash Impact.

New Volvo Recognizes Shapes of Animals like Deer & Elk to Reduce Crash Impact.

Volvo cars is testing a new safety system that automatically hits the brakes once an animal is detected in the vehicles vicinity. The Animal Detection System expands the range and …

Visual of Pantone SkinTone

Pantone SkinTone

Should made-to-order babies become a reality in the near future, one piece of the design puzzle has been solved now Pantone has release their SkinTone system. Indexing 110 skin …

Visual of Plastic Soup

Plastic Soup

Recipes from a post-fish world? Our peculiar image of the week was created by Nathalie Faber & Matthijs Immink.

Visual of Playing With Pigs

Playing With Pigs

Besides children and pets , it turns out that pigs are also attracted to interactive interfaces. Pig Chase is a computer game in which pigs and people can play together. The aim …

Visual of Raise Crops on the Moon with Plant-Growing Jelly

Raise Crops on the Moon with Plant-Growing Jelly

In dry areas like the desert, on mountain tops or on the moon it’s impossible to grow anything. Or is it? A rain in the desert sparks extreme plant growth from the moment the …

Visual of Robot Fridge Forces You to Smile for Food

Robot Fridge Forces You to Smile for Food

Feeling grumpy and hungry? Unfortunately, the University of Tokyo's Happiness Counter refrigerator won't open up until you give it a big smile. The concept is based on the fact …

Visual of Rule #6: Meet People’s Expectations

Rule #6: Meet People’s Expectations

For past entries and an introduction to the 11 Golden Rules of Anthropomorphism and Design, click here.   People expect many things from each other: Expect them to say hi in the …

Visual of Rural Energy: From Kerosine to LED

Rural Energy: From Kerosine to LED

While for most of us, happy blog readers, access to electricity is taken for granted, things are quite different in developing regions of the world. In India for example, over 65% …

Visual of Screw Technology

Screw Technology

In this particular piece of video art, loyal readers of nextnature.net might recognise the building as Zeche Zollverein in Germany, where we organized the Biggest Visual Power …

Visual of Seaside Swimming Pool

Seaside Swimming Pool

Always good to see a swimming pool exactly where you need it. At San Alfonso del Mar resort in Chili they know how to cater people that love nature – except for the rocks, bites …

Visual of Should I be Afraid of...

Should I be Afraid of...

For doom-mongers delight, the Berlin-based design studio Bold Futures made a handy interactive graph of the fatal disasters that might snuff us.

Visual of Surviving Progress

Surviving Progress

Montreal filmmakers Mathieu Roy and Harold Crooks’ documentary feature, Surviving Progress presents the story of human advancement and reveals the risk of running the 21st …

Visual of Swiss Army Nails

Swiss Army Nails

Functional multi-tool manicure. Comes in handy at a party where you can't find a bottle opener. Peculiar image of the week. Unfortunately, neither the human responsible for the …

Visual of That Website Smells!

That Website Smells!

Do you ever miss being able to smell the woods in an online travel journal? The odor of a new leather jacket in an online shop? Or perhaps you just couldn’t find the words in an …

Visual of The Right to Privacy

The Right to Privacy

Privacy is a right. A right given to people by telecommunications companies and social networking websites. It can be described by multiple-choice lists of settings. And it seems …

Visual of The Sound of Silence? An Aircraft Engine.

The Sound of Silence? An Aircraft Engine.

Silence is a thing of the past. Just as no place has been left untouched by climate change, there is no place on earth that is not 'polluted' by the sounds of planes, ships, and …

Visual of To Generate Electricity, Just Tap on this Virus

To Generate Electricity, Just Tap on this Virus

Is your friend impatiently tapping on her phone, or is she just charging the battery? Researchers at the Berkeley Lab have produced the first virus-powered generator that runs off …

Visual of Transfer Your Window!

Transfer Your Window!

Imagine you buy a special kind of window which you can place on your wall wherever you want, enabling you to get different views, not always looking at the same tree or house of your neighbors.

Visual of Turning Wind Farms into Seaweed Farms

Turning Wind Farms into Seaweed Farms

Closed to commercial shipping and fishing, offshore wind farms aren't put to much use besides generating clean energy. Ecofys , a Dutch sustainable consulting company, hopes to …

Visual of Using Nanoscale Wood Pulp to Replace Metal and Plastics

Using Nanoscale Wood Pulp to Replace Metal and Plastics

Nanocrystalline cellulose (NCC) sounds almost too good to be true. The same microscopic particles that help trees to stand up straight are also lightweight, non-toxic, stronger …

Visual of Welcome to the Anthropocene

Welcome to the Anthropocene

Watch human and urban life evolve in this 3-minute journey through the last 250 years of our history, starting at the beginning of the Industrial Revolution.

Visual of Why It's Time to Calm Down about

Why It's Time to Calm Down about "Invasive" GM GloFish

Is the neon green tetra GloFish soon to be the florescent, transgenic terror of America's waterways? The internet hype machine has repeated ad infinitum the Washington Post's  …

Visual of Will a Cockroach Save Your Life?

Will a Cockroach Save Your Life?

Often cockroaches aren’t people's best friends, but maybe in a few years you will be relieved when you see a cockroach. Researchers of the North Carolina State University …

Visual of “Soccket” Ball Generates Free Electricity

“Soccket” Ball Generates Free Electricity

It looks like a normal soccer ball, but Soccket has a secret: a hole for a charging cable. Designed by two Harvard students, the ball has a pendulum-like mechanism inside that …

Visual of 3D Print a New House in One Day

3D Print a New House in One Day

3D printers using concrete can now create complete houses from the ground-up.

Visual of 3Doodler, a Pen for Drawing in the Air

3Doodler, a Pen for Drawing in the Air

Draw in midair with a portable 3D printer.

Visual of

"Algae Opera" Nourishes Algae with a Singer's Breath

Are you blessed with a Maria Callas kind of voice? If, like us, you don't go beyond croaking the occasional " I want to break free" in the shower, watch out. If the artists of …

Visual of Anthropo-scene #2: The Mind's Lianas

Anthropo-scene #2: The Mind's Lianas

What are the physical forms of the noosphere?

Visual of Are We Seeing the Same Thing?

Are We Seeing the Same Thing?

A fundamental philosophical question, how do we know my blue isn't your yellow? The current human and "natural" understanding of color is fundamentally based on a …

Visual of Bored with Sex? There's a Pill for That

Bored with Sex? There's a Pill for That

Trials for new drugs hold promise for a "cure" for female boredom in the sack.

Visual of CAMOVER: Destroy All CCTV Cameras!

CAMOVER: Destroy All CCTV Cameras!

Earn points in an online game by destroying real-life CCTVs.

Visual of Carnivorous Plants Turn Vegetarian

Carnivorous Plants Turn Vegetarian

Will extended pollution cause carnivorous plants to turn to a fully vegetarian diet?

Visual of Pick Pig - Name Pig - Love Pig - Eat Pig

Pick Pig - Name Pig - Love Pig - Eat Pig

In a time of all-horse hamburgers and E. coli outbreaks, food provenance has become a huge issue. Consumers are becoming increasingly aware of the lack of traceability within the …

Visual of Clothes that Turn Heat into Electricity

Clothes that Turn Heat into Electricity

With rising energy costs and our growing arsenal of iPads, smart phones, and wearable monitors, we're always on the lookout for new ways to power our devices.  Perpetua Power , an …

Visual of Cockroach Farms Do Big Business for Food and Pharmaceuticals

Cockroach Farms Do Big Business for Food and Pharmaceuticals

Big bugs make big bucks for Chinese farmers turning to roach ranching.

Visual of Software Fakes an Active Social Life While You're on the Sofa

Software Fakes an Active Social Life While You're on the Sofa

CouchCachet promises to give you the fully-booked, in-the-know life while you are on the Sofa.

Visual of Cow Poower! Bacteria Turn Poo into Fuel

Cow Poower! Bacteria Turn Poo into Fuel

Farmers in the US are producing fuel and high-quality fertilizer from their cows' manure.

Visual of Crystalline Cityscapes for Homeless Hermit Crabs

Crystalline Cityscapes for Homeless Hermit Crabs

Globe-hopping hermit crab housing.

Visual of Deliver us from Digital Bluntness

Deliver us from Digital Bluntness

Peoples attitudes online are wholly different from their behaviours in real life

Visual of Seven Future Visions on In-Vitro Meat

Seven Future Visions on In-Vitro Meat

Before we can decide if we will ever be willing to eat in-vitro, we need to explore the food culture it will bring us.

Visual of Digital Sharing Becomes Physical

Digital Sharing Becomes Physical

The embedded "share" button in the new Playstation assumes that sharing is at the center of our existence.

Visual of Dirty Ocean

Dirty Ocean

Apparently, most action pictures of surfers have the waste photo-shopped out?

Visual of DIY Body Modification to Hack Evolution

DIY Body Modification to Hack Evolution

Biohacker Tim Cannon inserted a chip into his arm to monitor his bodily data and transmit it to an Android device.

Visual of Empathy for the Device

Empathy for the Device

Kate Darling argues that society needs to update its ethical landscape to include thinking machines.

Visual of Exploring the Offline World, if It Still Exists

Exploring the Offline World, if It Still Exists

The surprising results of a year offline in the "real" world.

Visual of Bionic Eye: Limited Vision to the Blind

Bionic Eye: Limited Vision to the Blind

A new implant lets blind people see letters, crosswalks and people.

Visual of Food Simulator to Fulfill the Desire to Eat

Food Simulator to Fulfill the Desire to Eat

Two master's students have created a speculative device to simulate the sensations of eating.

Visual of Free Solar Chargers in the Streets of NY

Free Solar Chargers in the Streets of NY

Solar chargers for everyday emergencies.

Visual of From Fast Food Packaging to Flowerpot

From Fast Food Packaging to Flowerpot

Designer Michal Marko created a biodegradable food bowl. Can you imagine this bowl being used in fast-food restaurants?

Visual of Google Birdhouse Shows Birds Their Way

Google Birdhouse Shows Birds Their Way

Putting the birds into the bird's eye view of Google Maps.

Visual of Google's Shoes Talk to Runners

Google's Shoes Talk to Runners

Need a personal trainer? Google's new sneakers fulfill the role of a human coach.

Visual of Grow Your Own - Call for Projects

Grow Your Own - Call for Projects

Science Gallery is calling synthetic biologists, bio-artists, bio-designers, amateur biotechnologists and bio-hackers to submit proposals for projects for their upcoming flagship exhibition GROW YOUR OWN.

Visual of How Food Scientists Engineer the

How Food Scientists Engineer the "Bliss Point" in Junk Food

Cheetos and other junk foods are more carefully engineered than the average bridge.

Visual of How Much is a Polar Bear Worth?

How Much is a Polar Bear Worth?

Polar bears bring only $9 million to the Canadian economy, but citizens put their collective value at $6.3 billion. Why?

Visual of Hug & Pay

Hug & Pay

The rise of digital currencies reduces the need for physical interaction and communication between people. At the same time every payment method still leans on trust. But how can …

Visual of I’ll Take A Variety of Fried Gadgets, Please

I’ll Take A Variety of Fried Gadgets, Please

Is a deep-fried iPad as unhealthy as a McDonald's meal?

Visual of Implantable Microchip Controls Appetite

Implantable Microchip Controls Appetite

By attaching to the vagus nerve, a chip can contribute to "natural" weight-loss.

Visual of Invasive Crab Restores Damaged Habitat

Invasive Crab Restores Damaged Habitat

A strange set of coincidences turn an invasive species into a hero

Visual of Jellyfish Ice Cream Glows When Licked

Jellyfish Ice Cream Glows When Licked

$220 ice cream glows thanks to synthetic bioluminescent proteins derived from jellyfish.

Visual of Join the Buckminster Fuller Challenge

Join the Buckminster Fuller Challenge

Pick up your $100,000 to materialize your revolutionary vision. This is not a spam message.

Visual of Living Among Pests – Designing the Biosynthetic City

Living Among Pests – Designing the Biosynthetic City

Joyce Hwang discusses the challenges for designers, and gains for citizens, of living in a truly biosynthetic city.

Visual of Making Fake Eggs to Beat the Real Thing

Making Fake Eggs to Beat the Real Thing

Tech experts are betting that they can make vegetarian eggs that outperform the real thing.

Visual of Modifying Milk and Glowing Livestock

Modifying Milk and Glowing Livestock

Genetically modified glowing sheep make it harder to count sheep at night.

Visual of Moments in Meat History Part III- Preservation

Moments in Meat History Part III- Preservation

The oldest evidence of cold food storage dates back to 1700 BCE.

Visual of Mothership

Mothership

A ship shipping ship, shipping shipping ships.

Visual of Mushrooms to Grow Surfboards, Shoes, and Even Your House

Mushrooms to Grow Surfboards, Shoes, and Even Your House

Mushrooms are set to replace petroleum-based packaging... and a lot of other things too.

Visual of NASA Solves the Toxic 'New Car Smell'

NASA Solves the Toxic 'New Car Smell'

A new material can stop toxic off-gassing from plastics, but the 'new car smell' is so valuable the car industry might not change.

Visual of New in Store: Volume Magazine

New in Store: Volume Magazine

New in our store: Two very next natural issues of Volume Magazine.

Visual of Next Nature TEDx Talk in Budapest

Next Nature TEDx Talk in Budapest

Indulge in the Next Nature stump speech at TEDx from Dr. Van Mensvoort

Visual of Our Electronics, 100 Years Later

Our Electronics, 100 Years Later

An artist envisions our consumer electronics in a century, moss-covered and half-decayed.

Visual of Plastic is a new material in the Earths ecosystem

Plastic is a new material in the Earths ecosystem

I gathered this hand full of tiny pieces of plastic on less than one square meter of beach in Greece (map) . Spotted with the Next Nature Spotter iPhone app .

Visual of Protocell Shoe Mends Itself

Protocell Shoe Mends Itself

The self-repairing sole is a dynamic solution to an everyday problem.

Visual of Pubic Lice (Possibly) Going Extinct Due to Brazilian Waxing

Pubic Lice (Possibly) Going Extinct Due to Brazilian Waxing

With each swipe of the razor or rip of the waxing strip, the world has unwittingly been massacring one of its most familiar species. In what may be the first extinction caused by …

Visual of

"Responsive Typography" Tracks Your Location to Automatically Resize Text

A new website changes the text's font size depending on your distance from the computer.

Visual of Robots Cooperate to Save Coral Reefs

Robots Cooperate to Save Coral Reefs

Robots use swarm intelligence to rebuild coral reefs.

Visual of Rubber Duck XL: the Bath is Over

Rubber Duck XL: the Bath is Over

The  gigantic rubber duck  created by Dutch artist  Florentijn Hofman  floated on Hong Kong's Victoria Harbour, with the island skyline in the background. The XL duck showed up in …

Visual of Serious Gamers Assist Society

Serious Gamers Assist Society

New citizen science games are bringing gamification to serious issues.

Visual of Sony's Smart Wig: Top or Flop?

Sony's Smart Wig: Top or Flop?

Sensors, a communication interface and an actuator for tactile feedback all hidden ina wig.

Visual of Sticky Notes Are The

Sticky Notes Are The "New" USB Drives

The next generation of data portability.

Visual of Swallow a Pill to Turn Your Body into a Living Password

Swallow a Pill to Turn Your Body into a Living Password

Need a password that you'll never forget and can never be stolen? Try storing it in a pill in your gut.

Visual of Swans Float through Flooded Streets

Swans Float through Flooded Streets

A raft of swans blithely adopts an artificial habitat.

Visual of The 10th Anniversary of the World's First Lab-Grown Steak

The 10th Anniversary of the World's First Lab-Grown Steak

Many people don't know that growing and cooking in vitro meat is a decade old.

Visual of The Brain Is as Complex as All the World's Digital Data

The Brain Is as Complex as All the World's Digital Data

With advances in genomics, imaging and other technology,scientists have to face the age of big data.

Visual of The First Recorded Attack on a Cyborg

The First Recorded Attack on a Cyborg

Looking back on the first recorded attack on a human cyborg.

Visual of The Hedonometer Uses Social Media to Measure Global Happiness

The Hedonometer Uses Social Media to Measure Global Happiness

Scientists are using Twitter, blogs, and news sites to categorize the global psyche.

Visual of The Sci-Fi Prehistory of

The Sci-Fi Prehistory of "Victimless" Meat

A (very) short history of a century's worth of "disembodied" meat in fiction.

Visual of The Smart Desk: Exercise While Working

The Smart Desk: Exercise While Working

A "breathing" desk that reminds you to change positions throughout the day.

Visual of Treating Mental Illness with Video Games

Treating Mental Illness with Video Games

Neurofeedback shows promises in treating a range of mental ailments.

Visual of Use a Touchscreen Without Touching it

Use a Touchscreen Without Touching it

UltraHaptics is a system for creating haptic feedback in mid-air, offering new kind of interactions with our touchscreens.

Visual of What You Feel Is What You Get - Smartphone for the Blind

What You Feel Is What You Get - Smartphone for the Blind

A revolutionary new smartphone for the blind uses a completely tactile interface.

Visual of Wipe with the World's First Transparent Toilet Paper

Wipe with the World's First Transparent Toilet Paper

New technology can make completely transparent paper.

Visual of With

With "Stealth Wear", Hide from Unmanned Drones in Style

Tired your ugly duds? Sick of surveillance drones? Does Adam Harvey have the clothing for you!

Visual of Yes Naturally: How Art Saves the World

Yes Naturally: How Art Saves the World

A new book explores who (or what) gets to define what is "natural".

Visual of 50 Years Ago Asimov Predicted WiFi, Smartphones and Today's World Features

50 Years Ago Asimov Predicted WiFi, Smartphones and Today's World Features

Isaac Asimov predicts in 1964 what the world will look like today, in 2014.

Visual of A Jewel That Stops You From Checking Your Phone

A Jewel That Stops You From Checking Your Phone

For every smartphone user to recognize, is that merely the lighting of your screen, a vibration or ring distracts you from almost every activity. Even when you are spending time …

Visual of A Registered Landscape

A Registered Landscape

Tuscany is known for its natural beauty. But only a few know that this wonderful landscape is actually a really good design work.

Visual of Anthropocene Exhibition

Anthropocene Exhibition

Next Nature Network will take part in the Deutsches Museum exhibit "Welcome to the Anthropocene: The Earth in Our Hands".

Visual of Anti-Drone Tent

Anti-Drone Tent

Anti Drone Tent is a small construction of emergency blankets that blocks infrared sensing, making it invisible to drones.

Visual of Balloon-Powered Internet For Everyone

Balloon-Powered Internet For Everyone

Project Loon by Google has the mission of providing Internet access to rural and remote areas, with a hot air balloon network.

Visual of BAT Flies High in the Sky to Make Energy

BAT Flies High in the Sky to Make Energy

Buoyant Airborne Turbine is a giant high altitude wind turbine that brings low cost energy to remote areas and off-grid sites.

Visual of Binary Code Able to Act Like DNA

Binary Code Able to Act Like DNA

There is a similarity between strings of binary and strands of organic DNA: they both carry actionable information encoded into reconfigurable symbols. Using nature’s biodiversity …

Visual of Bionic Hand with Real Sense of Touch

Bionic Hand with Real Sense of Touch

LifeHand 2: a prosthetic hand that infers the ability to feel rudimentary shapes and forms by touch.

Visual of Bionic Plants

Bionic Plants

Scientists designed a way to improve the efficiency of plants light harvesting during the photosynthesis, using nanotechnology.

Visual of Bioplastic Made of Pressed Insect Shells

Bioplastic Made of Pressed Insect Shells

Aagje Hoekstra has developed a bioplastic made of of dead beetles called Coleoptera.

Visual of Blaming Car Technology for Dumb Drivers

Blaming Car Technology for Dumb Drivers

Cars increasingly rely on technology designed to make driving easier and safer. But are these improvements creating less-skilled drivers?

Visual of BrainDriver: the Mind Controlled Car

BrainDriver: the Mind Controlled Car

Imagine you could drive your car using only your thoughts. It is now possible!

Visual of Breaking Down Plastics with Bacteria

Breaking Down Plastics with Bacteria

Two students found a way to break down plastics using soil bacteria.

Visual of Confused Wings Flapping in Electrosmog

Confused Wings Flapping in Electrosmog

Electromagnetic fields confuse European robins.

Visual of Corporate Logos Zoology

Corporate Logos Zoology

The biodiversity of corporate “species” is increasing.

Visual of Credit to Plastic

Credit to Plastic

Gold credit card? In the end it’s all plastic!

Visual of Digital Native

Digital Native

Digital natives have trouble understanding life before 24/7 online connectivity.

Visual of Divine Nature

Divine Nature

Photographer Holly Wilmeth seeks to capture the encounter between women and nature, symbolized into animal form.

Visual of DIY Wire Networks In India

DIY Wire Networks In India

Indian fragile DIY electronic infrastructure gives an insight into our complex electronic wire systems.

Visual of Electronic Make Up

Electronic Make Up

If this technique become widely accessible it could allow you to regain anonymity in webcam and facetime conversations.

Visual of Exploring the City Soundscape

Exploring the City Soundscape

Buq are electronic life forms that shift the experience of the street scape from the primarily visual to a more auditory experience.

Visual of First 3D-printed Skull implanted

First 3D-printed Skull implanted

First 3D-printed skull has been implanted on a 22 years old dutch women.

Visual of First Completely Artificial Heart Transplant

First Completely Artificial Heart Transplant

World's first self-regulating artificial heart transplanted in France.

Visual of Flight Paths Of Birds Captured On Video

Flight Paths Of Birds Captured On Video

Visualizing of the flight paths of birds.

Visual of Food To Eat With Your Eyes

Food To Eat With Your Eyes

In Japan, fake food industry represents a century of old crafting tradition and a multi billion business.

Visual of Grandma Wants Google Glass

Grandma Wants Google Glass

Everyone adapts to new technologies!

Visual of Growing the Future of Meat

Growing the Future of Meat

Outside of the limits imposed by the edges of an animal’s body, the cells can reproduce and multiply until they exhaust the nutrients and space provided, filling petri dishes and vats to grow the future of meat.

Visual of Hemihelix: A New Geometric Shape

Hemihelix: A New Geometric Shape

Rubber band distortions lead to discovery of a new shape called hemihelix.

Visual of In Vitro Celebrity Meat, for Real this Time?

In Vitro Celebrity Meat, for Real this Time?

A company is working on culturing celebrity stem cells for cannibal cuisine.

Visual of In Vitro Recipe #6: 3D Printed Marrowbone

In Vitro Recipe #6: 3D Printed Marrowbone

Lab-grown marrow bones lend meaty notes to vegetarian soups, and taste delicious when roasted and spread on toast – no stone bludgeon required.

Visual of Interview: Chloé Rutzerveld, Designer Who Wants to Grow Healthy 3D Printed Food

Interview: Chloé Rutzerveld, Designer Who Wants to Grow Healthy 3D Printed Food

Food and Concept designer, Chloé Rutzerveld, explains her 3D food printing project Edible Growth.

Visual of Learning Circuits While Playing With Clay

Learning Circuits While Playing With Clay

Kids learn the basics of electric circuits while playing with clay.

Visual of Let the Drones take care of the Biosphere

Let the Drones take care of the Biosphere

Drones are typically thought of as flying spying robots, or even worse flying spying shooting robots. But could we also employ drones for good? The people of …

Visual of Listening to Wi-Fi

Listening to Wi-Fi

Modern technologies give deaf people the ability to hear again, not only regular sounds but also the invisible Wi-Fi signals.

Visual of Living in the Forest in the 21st Century

Living in the Forest in the 21st Century

Portraits of people who live alone in the forest.

Visual of Lonely Sculpture Your Next Tinder Match?

Lonely Sculpture Your Next Tinder Match?

Tinder users beware: somewhere out there a mechanical finger is surfing the popular dating smartphone app. This could be your next match.

Visual of In Vitro Recipe #3: Magic Meatballs

In Vitro Recipe #3: Magic Meatballs

Magic meatballs playfully familiarize children with the concept of in vitro meat.

Visual of Miracles Happen… Again

Miracles Happen… Again

Miracles in the digital era.

Visual of My Device is in the Sky

My Device is in the Sky

Truly advanced technology will be light as sunshine and indistinguishable from nature.

Visual of Nano Product: Catad'Or

Nano Product: Catad'Or

Catad'Or: the allergy sensitive cutlery.

Visual of Nano Product: The Healing Game

Nano Product: The Healing Game

The Healing Game: a playful medicine.

Visual of Need to Unplug? There is an App for that

Need to Unplug? There is an App for that

At times it seems we serve our technology as much as it serves us. The OFFTIME App wants to save us from our own devices.

Visual of Now Wait, Did Tanks Have Lasers WWII?

Now Wait, Did Tanks Have Lasers WWII?

Realistic WOII movie Fury had to cater to the gaming generation with hyperrealistic Star Wars style laser shooting tanks.

Visual of Printing with Grass

Printing with Grass

This 3D Grass Printer can print a garden in any shape you can imagine

Visual of Razorius Gilletus Flexball Subspecies

Razorius Gilletus Flexball Subspecies

The latest subspecies in the Razorius line is the Razorius Gilletus Flexball. While Gillete proclaims they reinvented shaving, others argue Gillette's new razor is everything that's wrong with America.

Visual of Razorius Gilletus Gold Plastic

Razorius Gilletus Gold Plastic

Like the exorbitant feathers of the peacock, which only function is to aesthetically stand out amid its competitors, this new species of Razorius Gilletus only differs from its predecessor aesthetically.

Visual of Remote Surgery

Remote Surgery

Remote surgery is the new step towards robotic surgeons.

Visual of Retro-Futuristic Smartwatch

Retro-Futuristic Smartwatch

In 1981 the idea of what we call smartwatch was nothing more than a funny joke.

Visual of Robotic Easter Egg Decorator

Robotic Easter Egg Decorator

A robot that applies computer controlled motion to precisely decorate your Easter eggs.

Visual of Seduction Between Chatbots

Seduction Between Chatbots

Two chatbots seduce each other.

Visual of Show Dem Guts

Show Dem Guts

Sexy girls and organ meat was never a good combination to me, but the people from Black Milk Clothing that created this swimsuit seem to think it makes a pretty nice product. Am …

Visual of Smart Contact Lens Can Monitor Glucose

Smart Contact Lens Can Monitor Glucose

Smart contact lens project to monitor glucose.

Visual of Smart Tags Change Color as Food Spoils

Smart Tags Change Color as Food Spoils

Smart Tags stick to containers of food and change color when something has expired.

Visual of Solaris: Mind-Controlled Magnets

Solaris: Mind-Controlled Magnets

Solaris gives participants the power to control a pool of magnetic fluids with their brainwaves.

Visual of Spend Eternity As An Artificial Coral Reef

Spend Eternity As An Artificial Coral Reef

After death you could have your ashes made into a rock to form the base of an “eternal memorial reef” .

Visual of Super Computer Chips

Super Computer Chips

Indium gallium arsenide couldbe the material of the new super computer chips of the future.

Visual of Technological Suntan

Technological Suntan

Contemporary epidermal woes.

Visual of Technology Costs Evolution

Technology Costs Evolution

Producing an iPhone in 1991 would have cost 3,56 million of dollars.

Visual of Technology Reflexology

Technology Reflexology

People have complex relationships with their own (and other’s) bodies. In Traditional Chinese Medicine (TCM), it is believed that your feet are a map of your body and can provide …

Visual of The Bionic Kangaroo

The Bionic Kangaroo

The BionicKangaroo technologically reproducesthe unique way a kangaroo moves.

Visual of The Bottle of The Future is an Edible Blob

The Bottle of The Future is an Edible Blob

What if we could drink from a giant drop of water? The bottle of the future has the shape of a soft, hygienic, biodegradable and edible blob.

Visual of The First 3D Printed Canal House

The First 3D Printed Canal House

The first 3D printed house is a recognisable and attractive Dutch Canal House, an exhibition and building site in the heart of Amsterdam.

Visual of The Flying Car

The Flying Car

From automobile to airplane: the flying car is built to travel as easily on the road as in the sky.

Visual of The Food Pill

The Food Pill

Sweet, sour, salty, science: Food Technology!

Visual of The Ideal Phone Might Be The noPhone

The Ideal Phone Might Be The noPhone

Your next phone could be the noPhone: a technology-free alternative to any smart mobile device.

Visual of The Robotic 3D Printed Spider Dress

The Robotic 3D Printed Spider Dress

The Spider Dress is programmed to define and protect the personal space of the wearer.

Visual of The Sound of Nature

The Sound of Nature

Love the sound of nature.

Visual of Three Points in Support of In Vitro Meat

Three Points in Support of In Vitro Meat

The top three aspects why people should support cultured meat.

Visual of Touching your Unborn Child

Touching your Unborn Child

Thanks to 3D Babies and a mere $600,- you can now experience that excitement of holding your baby in your hands before he or she is born.

Visual of Urban Green

Urban Green

These pictures by photographer Jacob Gesink show how the urban green is carefully manufactured.

Visual of Using Wood to Purify Water

Using Wood to Purify Water

Researchers at the MIT institute recently discovered an amazing low-tech way to filter water.

Visual of Veggie Burger That Bleeds Like Real Meat

Veggie Burger That Bleeds Like Real Meat

Prof. Patrick Brown developed a meatless burger that look and taste like meat, made out of plant ingredients.

Visual of Virtual Reality Headset for Chickens

Virtual Reality Headset for Chickens

A virtual reality headset could give chickens the freedom to roam without the roaming.

Visual of Watch Your City at Night from Space

Watch Your City at Night from Space

Less than one millennium ago the Earth at night was all black. Today it is all glowing and blossoming.

Visual of Wearable Antenna for Health Monitoring

Wearable Antenna for Health Monitoring

Wearable multifunctional antenna made of silver nano wires to monitor recovering people.

Visual of Wearing Technology Under the Skin

Wearing Technology Under the Skin

UnderSkin is a device that would be implanted beneath the skin on your hand and charge off your body’s energy.

Visual of Weaving a Home

Weaving a Home

A lightweight and mobile structural fabric based on ancient traditions of weaving fibers.

Visual of What Bits Want

What Bits Want

Digital bits have lives. They work for us, but we totally ignore them. What do bits really want? Here are the life stories of four different bits.

Visual of What Is This Strange Device?

What Is This Strange Device?

Kids try to figure out what the "prehistoric" Walkman is and how it works.

Visual of Which Device Are You Wearing Today?

Which Device Are You Wearing Today?

2014 is the year of wearable technology.

Visual of 3D Holography: the Future of Medicine

3D Holography: the Future of Medicine

A new technology aims to provide doctors with a true hologram of organs.

Visual of 3D Printed Eyes with WiFi Connection

3D Printed Eyes with WiFi Connection

Italian research studio is working on EYE: a 3D bioprinted sight augmentation.

Visual of A Pop-Up Forest in Times Square

A Pop-Up Forest in Times Square

A new Kickstarter project aims to bring the forest into Times Square.

Visual of A Tiny Trackpad That Fits on Your Nail

A Tiny Trackpad That Fits on Your Nail

Researchers from the Massachusetts Institute of Technology have developed a tiny wireless trackpad that could easily fit on your finger nail.

Visual of Ambient City

Ambient City

How cities will function when there are more robots than people working in factories, everything is intelligently interlinked, autos drive autonomously and drones deliver the mail?

Visual of Analogue vs Digital: Horseless Carriages

Analogue vs Digital: Horseless Carriages

E-mails don’t reach you in envelopes.

Visual of Analogue vs Digital: Never Lost with GPS

Analogue vs Digital: Never Lost with GPS

Before global positioning systems, we all used maps. And they could be very annoying.

Visual of Analogue vs Digital: Phoning

Analogue vs Digital: Phoning

Remember these? If you are a digital native there is a chance you never noticed one of them.

Visual of Analogue vs Digital: Self-Driving Cars

Analogue vs Digital: Self-Driving Cars

The image on the left is a car, as we know them. It has a lot of digital technology in it already, but not nearly as much as the other one.

Visual of Analogue vs Digital: Still Antisocial

Analogue vs Digital: Still Antisocial

Some modern thinkers argue that new technology is making us antisocial.

Visual of Apple Watch Evolution

Apple Watch Evolution

In 1992, decades before the era of wearable technology, Apple produced its first watch: no apps and vintage design.

Visual of Archaeology of Media

Archaeology of Media

The Archéologies des Medias exposition turns archaic technology that was once cutting-edge into art.

Visual of Artificial Intelligence Able to Create Music

Artificial Intelligence Able to Create Music

Emily Howell is an interactive interface able to compose and perform her own pieces of music.

Visual of Technology and Emotions

Technology and Emotions

A wearable lighting device that changes color and shade according to movement, facial expressions, weather and mood.

Visual of Bionic Ants That Work Together

Bionic Ants That Work Together

These robotic ants by Festo are learning to work together, like real ants do.

Visual of Bistro In Vitro to Be Launched

Bistro In Vitro to Be Launched

Inspired by the award winning In Vitro Meat Cookbook , Next Nature Network and Submarine Channel present  Bistro In Vitro : an online design fiction documentary about the future …

Visual of Changing your Mood on Demand with Brain-Altering Wearable Technology

Changing your Mood on Demand with Brain-Altering Wearable Technology

Thync, is a new brain-altering wearable technology that promises to “shift your state of mind and conquer life” by allowing its users to change their mood whenever they need it.

Visual of Communicating with City Infrastructures

Communicating with City Infrastructures

A recent project, named GENESI, might make it possible for city infrastructures to communicate with us.

Visual of Computer Generated… Errrmm?

Computer Generated… Errrmm?

This image, generated by a computer, portrays a representation of what seems to be some kind of squirrel-meets-sea-lion-meets-slug-type of creature.

Visual of Controlling Smart Devices with the Skin

Controlling Smart Devices with the Skin

iSkin is a flexible, stretchable and visually customizable on-body touch sensor for mobile computing.

Visual of Controlling the Weather with Drones

Controlling the Weather with Drones

The Federal Aviation Administration (FAA) picked six test sites throughout the US to experiment with drone-based cloud seeding.

Visual of Converting Gestures into Concrete Action

Converting Gestures into Concrete Action

Francesca Barchiesi's glove concept allows the user to translate hand gestures into images and information.

Visual of In This Church We Only Take Credit Cards

In This Church We Only Take Credit Cards

In the Sanctuary of Caravaggio, Italy, devotees can make offerings just by credit cards.

Visual of Cybernetic Bugs

Cybernetic Bugs

Beetles, dragonflies, butterflies and bugs made from recycled deconstructed computers, smartphones and consoles.

Visual of Drone Maps Christ the Redeemer

Drone Maps Christ the Redeemer

The current technology has not been able to replicate Christ the Redeemer perfectly, until now.

Visual of Drone Racing in First Person View

Drone Racing in First Person View

Racing with a drone and some FPV goggles,

Visual of Ear-Free Headphones

Ear-Free Headphones

Using bone conduction, this device allows to hear the sound directly in the head, keeping the ears free.

Visual of Eco Currency Questions

Eco Currency Questions

Discussing the possibility to put a price-tag on nature, and what this would implicate.

Visual of Electronic Gadget Cemetery in Ghana

Electronic Gadget Cemetery in Ghana

Agbogbloshie is a former wetland that is turned into a slum and now it is full of toxic electronic waste.

Visual of Ever-Changing Sceneries with Microbots

Ever-Changing Sceneries with Microbots

Kirsten Zirngibl's illustrations depict imaginary landscapes that are formed by microbots.

Visual of Facebook's Internet Drone Unveiled

Facebook's Internet Drone Unveiled

Facebook introduced its solar-powered drone project aimed to provide internet access to rural areas.

Visual of Fast Food = Lower Test Scores

Fast Food = Lower Test Scores

The amount of fast food children eat may be linked to how well they do in school, a study suggests.

Visual of Feeding the World with Insects

Feeding the World with Insects

Should we make a next step in what we serve at the table? What about insects? Would you give them a try?

Visual of First Bionic Rose with Electronic Circuits

First Bionic Rose with Electronic Circuits

For the first time, researchers at the University of Linkoping , Sweden, have succeeded in establishing organic circuits within living plants. They combined electronics with the …

Visual of First Entirely Transparent Solar Panel Could Transform our Cities

First Entirely Transparent Solar Panel Could Transform our Cities

Our constant need of new, cleaner energy led a Michigan State University research group to conceive a fully transparent solar panel that could replace ordinary windows.

Visual of First Puppies Born by In Vitro Fertilization

First Puppies Born by In Vitro Fertilization

Thanks to the work of researchers at Cornell University (USA), for the first time a litter of puppies was born entirely from in vitro fertilization.

Visual of Genetic Modification Could Prevent TB

Genetic Modification Could Prevent TB

It was announced this week that genetic modification allowed scientists to produce cattle resistant to tuberculosis.

Visual of Googles Natural Tracking Technology

Googles Natural Tracking Technology

We may soon all be making natural gestures to interact with our digital devices.

Visual of Google's Smart Interactive Clothing

Google's Smart Interactive Clothing

Project Jacquard makes it possible to weave touch and gesture interactivity into any textile.

Visual of Heart Tissue Grown with Spider Silk

Heart Tissue Grown with Spider Silk

It might be possible to grow a new heart in labs using spider silk.

Visual of Hyperform: the Future of 3D Printing

Hyperform: the Future of 3D Printing

"However, while 3D printers are becoming increasingly accessible and capable of rivalling the quality of professional equipment, they are still inherently limited by a small print …

Visual of The Ice Cream That Doesn't Melt

The Ice Cream That Doesn't Melt

Researchers discovered a protein that can be used to produce the first ice cream that melts more slowly that the normal products on the market today.

Visual of Implanting Chips into Employees

Implanting Chips into Employees

An he hi-tech Swedish office block implanted a microchip under the employees’ hand skin.

Visual of In Vitro Meat Godfather Dies at Age of 91

In Vitro Meat Godfather Dies at Age of 91

Dutch researcher and entrepreneur, Willem van Eelen, has died in Amsterdam. For more than half a century, Van Eelen relentlessly researched and promoted In Vitro Meat.

Visual of Intelligent Bikini Tells You How to Tan

Intelligent Bikini Tells You How to Tan

Think you've had enough sun? Ask your bikini!

Visual of Intimate Technology Evening at Droog

Intimate Technology Evening at Droog

Droog Foundation and Next Nature Network invites you to join the conversation about Intimate Technology: April 23, in Amsterdam.

Visual of Jewelry Harvests Energy from Veins

Jewelry Harvests Energy from Veins

Naomi Kizhner designed jewelry that can theoretically harvest energy from the body of the person wearing it.

Visual of Junk Food or Tobacco?

Junk Food or Tobacco?

An article about the future position of junk food.

Visual of Possibilities for Drones in Performing Arts

Possibilities for Drones in Performing Arts

Japanese fashion brand Buyma created this video with a wink, wherein drones play a crucial role.

Visual of Knotty Objects Summit @ MIT

Knotty Objects Summit @ MIT

The Knotty Object summit promises to be a paradise of anti-disciplinary delight. The event held at the renowned MIT Media Lab gathers designers, scientists, engineers and writers …

Visual of Let Strangers Cheer You up on Twitter

Let Strangers Cheer You up on Twitter

There is now a new application that allows random people to cheer you up on Twitter.

Visual of Mark Zuckerberg Discovers 'Books'

Mark Zuckerberg Discovers 'Books'

Books allow you to fully explore a topic and immerse yourself in a deeper way than most media today.

Visual of Marketing the Oceans

Marketing the Oceans

Eco-friendly fashion is in vogue, evidenced by terms like “recycled-material” and “sustainable manufacturing” battered around as selling points for everything from sheets to …

Visual of Meet the Hospital of the Future

Meet the Hospital of the Future

With its 656 beds, this hospital offers unconventional and leading computerized assistance for all sorts of patients.

Visual of Mini's Augmented Reality Driving Goggles

Mini's Augmented Reality Driving Goggles

The popular car brand is working on augmented reality goggles that enhance the driving experience.

Visual of Modafinil Boosts Your Brain

Modafinil Boosts Your Brain

A pill that makes you smarter without causing harmful side-effects? Modafinil might be this “smart-drug”.

Visual of Modern Times Emergency Kit

Modern Times Emergency Kit

In these modern times a traditional first aid kit won't do anymore. As the world around us innovates, our needs in case of an emergency change as well.

Visual of Is That You Mother Nature?

Is That You Mother Nature?

Is that Mother Nature showing herself in that tree?

Visual of MyWebwill Dead Before its Subscribers

MyWebwill Dead Before its Subscribers

The company MyWebwill helped you to manage your digital afterlife. Unfortunately for its subscribers the company itself has now deceased.

Visual of Nasa's Projections on Global Warming

Nasa's Projections on Global Warming

Researchers at Nasa's Center for Climate Simulation (NCCS) in Maryland can deploy a supercomputer called the "Discover".

Visual of Algorithm Tells You How to Dress

Algorithm Tells You How to Dress

What should I wear today? The answer to one of life’s big questions could came from an algorithm created to solve all your fashion problems.

Visual of New Friends? Let Social Textiles Help You

New Friends? Let Social Textiles Help You

A group of students at the MIT Media Lab are working on an electronic textile that might help us interact with people more easily.

Visual of First Testings of Google's Project Loon Announced

First Testings of Google's Project Loon Announced

Google plans to connect more than 100 million people in a cheap, new and sustainable way, in a territory where only one person on three has access to the Internet.

Visual of Permanent Eye-Color Change

Permanent Eye-Color Change

A new laser surgery can permanently turn eyes from brown to blue.

Visual of Robot Swans Monitor Water Quality

Robot Swans Monitor Water Quality

The National University of Singapore released a group of robot swans in the Pandan Reservoir to swim around and keep an eye on water quality.

Visual of Seconds for Sale: Domestication of Time

Seconds for Sale: Domestication of Time

Time Ingot is a solid piece of lead alloy, its mass can slow down time in the immediate vicinity.

Visual of Self-Driving Cars Practice Kids Recognition

Self-Driving Cars Practice Kids Recognition

This year's Halloween, Google asked children from the neighborhood to come by in their spooky outfits and play around the self-driving cars.

Visual of Seowoo and her Pink Things

Seowoo and her Pink Things

Nowadays the average teenager has more personal pink belongings than an emperor one thousand years ago

Visual of Sexy Car – From Russia with Love

Sexy Car – From Russia with Love

Humans cannot have intercourse with cars or replicate with them, so why would we find cars sexy anyhow?

Visual of Sharing Your Newborn's Heartbeat

Sharing Your Newborn's Heartbeat

These parents use the Apple Watch to share their newborn child's heartbeats with friends and family.

Visual of Solar Eclipse May Impact Power Supply Due to Increased Use of Solar Panels

Solar Eclipse May Impact Power Supply Due to Increased Use of Solar Panels

Solar eclipse may impact power supply due to increased use of solar panels

Visual of Solar Tree That Provides Electricity

Solar Tree That Provides Electricity

A tree, made with 3D printed leaves that contain solar cells.

Visual of Speculative Sensing at WDCD 2015

Speculative Sensing at WDCD 2015

On may 21st, Next Nature Network art director Hendrik-Jan Grievink  will host a workshop around the idea of Speculative Sensing: exploring the potential of senses found in nature …

Visual of Bacteria and Drones: New Ways to Collect Samples

Bacteria and Drones: New Ways to Collect Samples

While a hipster-drink bacteria are hunting space organisms, robots are catching whale snot in the open ocean.

Visual of The Candle of the Future

The Candle of the Future

My New Flame uses LED technology to faithfully recreate the experience of light from the ancient past

Visual of The Drone Circus

The Drone Circus

The first ever circus consisting entirely of drones is coming to Amsterdam. This fall the Amsterdam Arena will host a choreographed airshow using nothing but drones combined with …

Visual of The Face of Litter

The Face of Litter

Hong Kong is using DNA analysis to publicly shame litterbugs

Visual of The Plastic Problem #1: Biobased and Biodegradable Plastic

The Plastic Problem #1: Biobased and Biodegradable Plastic

What are then the actions to foster for an effective sustainability? A series of articles will try to point the plastic poblem.

Visual of The World’s Largest Indoor Farm

The World’s Largest Indoor Farm

The world’s largest indoor farm in Japan is 100 times more productive than traditional agriculture.

Visual of Using Shrimp Shell to Produce Bioplastics

Using Shrimp Shell to Produce Bioplastics

Researchers Fernandez and Ingber imitated chitin in order to produce durable, biodegradable plastics.

Visual of Talkable Vegetables

Talkable Vegetables

Breaking the silence, vegetables in a Japanese supermarket start to talk to the customers.

Visual of Solutions to Virtual Reality's Big Problem

Solutions to Virtual Reality's Big Problem

If you experience virtual reality sickness, here some solutions for you.

Visual of Wasps Inspire Robotic Needle for Surgery

Wasps Inspire Robotic Needle for Surgery

The Wood-Boring Wasp inspired scientists to create a new robotic needle which will be used in brain surgery.

Visual of Wearable Device For Tomato Lovers

Wearable Device For Tomato Lovers

The Wearable Tomato Project consists in a robot that dispenses tomatoes.

Visual of Welcome to the Hearth of the Sun

Welcome to the Hearth of the Sun

Solarium, a video installation by NASA’s Solar Dynamics Observatory (SDO), puts visitors in the hearth of the sun.

Visual of Let the WiFi Angels app soundtrack your holidays!

Let the WiFi Angels app soundtrack your holidays!

he WiFi Angels app lets you sense electromagnetic radiations by turning the WiFi networks around you into a celestial choir.

Visual of Wireless Controlled Mouse, the Animal!

Wireless Controlled Mouse, the Animal!

A remote-controlled LED chip can make a mouse walk in circles.

Visual of 72h Offline Challenge for Teenagers

72h Offline Challenge for Teenagers

Around 100 Polish teenagers aged between 12 and 18 agreed to withstand 72 hours totally offline: no phone, no computer, no TV. What were the results?

Visual of The Advent of Connected Toys

The Advent of Connected Toys

It is the era of smart toys, but they certainly raise difficult questions for parents.

Visual of Architecture on Mars

Architecture on Mars

The future anticipates 3D printed homes on Mars.

Visual of Are These the Headphones of the Future?

Are These the Headphones of the Future?

No matter which brand is going to rule the wireless headphones scene, it's time to get used to have a computer in our ear that we never need to take out. Until it may grow into it someday!

Visual of Australia Moves Too Fast for GPS

Australia Moves Too Fast for GPS

The entire continent of Australia has shifted and that's a problem for GPS, meteorologists, automated cars and even drones.

Visual of Plastic-Eating Bacteria Are Coming

Plastic-Eating Bacteria Are Coming

The bacteria that degrades and assimilates plastic.

Visual of The First Beauty Contest Judged by AI

The First Beauty Contest Judged by AI

The first beauty contest judged by complex algorithms has sparked controversy after biased results.

Visual of Begging Ghetto Blasters Hack the System

Begging Ghetto Blasters Hack the System

Begging ghetto blasters in Utrecht are making you question poverty.

Visual of

"Biomimicry", the Documentary

Biomimicry is a documentary on the topic of how life and biology can be the mentors for our own innovation in the world.

Visual of Breaking Language Barriers

Breaking Language Barriers

We have witnessed significant progresses in the field of real-time translation, and this new wearable translator, called ili, sums up perfectly this essence.

Visual of No-Waste Architecture From Seawater

No-Waste Architecture From Seawater

The Salt Project created an additional ecosystem to revive desertified lands.

Visual of Bye Bye BlackBerry

Bye Bye BlackBerry

BlackBerry has just confirmed that it will no longer create its own phones, marking the end of an era for the once dominant leader of the smartphone market.

Visual of Cars Are Ready to Recognize Us

Cars Are Ready to Recognize Us

We already recognize faces in our cars, now it is time for our cars to recognize our faces.

Visual of Coming Soon: Video Face Hacking for All

Coming Soon: Video Face Hacking for All

team of computer scientists at the universities of Germany and California has created what they call photoshoping videos in real time.

Visual of A Cryptocurrency Helping to Cure Cancer

A Cryptocurrency Helping to Cure Cancer

Part two of a ten part series exploring the design of an invisible technology: money.

Visual of

"Death School" to Learn Love Life Again

At Hyowon Healing Centre in Seoul you can experience the emotional cost of a suicide during "Death School" classes.

Visual of Designer Creates Water Bottles from Algae

Designer Creates Water Bottles from Algae

Icelandic Product Design student Ari Jónsson has used red algae powder and water to create a biodegradable water bottle.

Visual of Banana by Design

Banana by Design

If you compare the supermarket banana with the original wild banana the differences in size, look and taste are striking.

Visual of Diamond Batteries from Nuclear Waste

Diamond Batteries from Nuclear Waste

Researchers are turning diamonds into batteries.

Visual of The Digital Life Project

The Digital Life Project

Researchers are creating accurate 3D models of living organisms to preserve the heritage of life on Earth.

Visual of Disney-Themed Prosthetics for Children

Disney-Themed Prosthetics for Children

Open Bionics is helping children in need for bionic hands. With Iron Man, Frozen, or Star Wars-themed prosthetics, their fantasies become reality.

Visual of Doctors Used VR to Save a Baby's Life

Doctors Used VR to Save a Baby's Life

Google Cardboard was used by a cardiologist to train for a very risky heart surgery on a four months baby.

Visual of Driverless Taxi Pods

Driverless Taxi Pods

Driverless Taxi Pods pilot in suburb of New Delhi.

Visual of Drones in Agriculture

Drones in Agriculture

Here's a look at how drones can and will impact the agriculture and farming industry.

Visual of Earth Next to the Sun Makes Us Modest

Earth Next to the Sun Makes Us Modest

The realization that the volume of the Earth would fit over a million times in the volume of the Sun kind of makes you modest. No, we are not the Masters of the Universe.

Visual of Eating Plastic or Krill: a Smelly Story for Birds

Eating Plastic or Krill: a Smelly Story for Birds

Seabirds eat floating plastic debris because it smells like food, study finds.

Visual of EcoHelmet: Foldable, Recyclable and Cheap

EcoHelmet: Foldable, Recyclable and Cheap

The new recyclable, foldable and affordable bike helmet can change city bike sharing for good.

Visual of Facebook Provides a Suicide Prevention Tool

Facebook Provides a Suicide Prevention Tool

Facebook provides a new tool for suicide prevention

Visual of A Piece of Cake for Your Dog

A Piece of Cake for Your Dog

Farming introduction changed dog's digestive system.

Visual of A Film to Double the Shelf-Life of Food

A Film to Double the Shelf-Life of Food

The eco-friendly food packaging material able to improve food safety, conservation and quality.

Visual of Fake-for-Real: Who Is Lil Miquela?

Fake-for-Real: Who Is Lil Miquela?

This Instagram model makes her fans wondering whether she is fake or real.

Visual of France Says Adieu to Plastic Tableware

France Says Adieu to Plastic Tableware

First they banned plastic bags all over the country in July, now they released a new regulation: starting from 2020, no plastic cups, plates and cutlery can be distributed in France.

Visual of Safe Driving Rewarded with Free Coffee

Safe Driving Rewarded with Free Coffee

As part of a new traffic safety initiative, a car manufacturer, a telecommunications operator, and a coffee chain have joined forces to develop a new app designed to promote safer driving.

Visual of Future of Food: Eating From the Ditch

Future of Food: Eating From the Ditch

For years scientist and farmers are researching the possibilities of eating duckweed, shoveling it out of the ditches onto our plates. This proteinrich plants can be used in animal fodders or be eaten by humans.

Visual of Geography Class via Smartphone

Geography Class via Smartphone

A new Google Maps app is designed to get kids exploring the Himalayas without having to actually go outside.

Visual of Getting Rid of Plastic in the Oceans

Getting Rid of Plastic in the Oceans

The Ocean Cleanup Foundation’s prototype floating barrier wants to clean the oceans water.

Visual of Good Air Quality? You Get Free WiFi

Good Air Quality? You Get Free WiFi

These birdhouses in Amsterdam share free Internet whenever the air quality improves.

Visual of Goodbye Password, Hello Selfie!

Goodbye Password, Hello Selfie!

Companies try a new, more secure payment system using selfies.

Visual of Google Sheep View

Google Sheep View

The Faroe Islands invented Google Sheep View 360.

Visual of Growing Drones From Chemicals

Growing Drones From Chemicals

Researchers are experimenting with a new technology that would be able to grow drones from chemical compounds.

Visual of Harvesting Water from Thin Air

Harvesting Water from Thin Air

Scientists in Harvard University have designed a new material inspired by organisms, such as cacti, that can effectively harvest water from thin air.

Visual of Body hair helps animals stay clean – and could inspire self-cleaning technologies

Body hair helps animals stay clean – and could inspire self-cleaning technologies

Watch a fly land on the kitchen table, and the first thing it does is clean itself, very, very carefully. Although we can’t see it, the animal’s surface is covered with dust, …

Visual of Hyperloop Set to Change Mass Transit

Hyperloop Set to Change Mass Transit

The Hyperloop is a future transportation means that is safer, faster, and cheaper than current forms of mass transit.

Visual of Iconic Buildings in Untouched Lands

Iconic Buildings in Untouched Lands

Anton Repponen's project places iconic NY buildings in organic, untouched environments to put them in the spotlight.

Visual of Designer Govert Flint applies motion to everyday life

Designer Govert Flint applies motion to everyday life

Interview with Govert Flint, designer, architect and self-taught artist.

Visual of Let's Laugh at Robots!

Let's Laugh at Robots!

Welcome to the world of robot fails.

Visual of Let's Talk About Virtue Signalling

Let's Talk About Virtue Signalling

With virtue signalling, the joys of moral superiority are just one click away!

Visual of Meet the Buddy Drone

Meet the Buddy Drone

Meet the Buddy Drone: it protects your from danger and helps you with everyday tasks, but most of all it's a friend for life!

Visual of Turning Contact Lenses into Screens

Turning Contact Lenses into Screens

A polymer film coating can turn contact lenses into computer screens.

Visual of Meet the Farmer Drone

Meet the Farmer Drone

The Farmer Drone is a hardworking drone that ploughs land, grows crops and milks the cows, all on the same day.

Visual of Meet the Queen Bee Drone

Meet the Queen Bee Drone

The Queen Bee Drone helps solving the bee crisis of the last decade, not intruding, just bringing help and assistance.

Visual of Meet the Vaccinator Drone

Meet the Vaccinator Drone

The Vaccinator Drone will provide you with the medicine you need.

Visual of Meet the Weather Drone

Meet the Weather Drone

The Weather Drone controls the weather, it makes sure the sun will shine on your birthday, or that the rain will fall during a period of drought.

Visual of Meet the WiFi Drone

Meet the WiFi Drone

This is the WiFi drone, a useful companion that perfectly blend into our environment while providing us with information and connectivity.

Visual of Morality of an Autonomous Car

Morality of an Autonomous Car

When an autonomous car has to make a decision, will self-interest or the public good predominate?

Visual of Tangible Money in Digital Currency Era

Tangible Money in Digital Currency Era

The Scrip, a new universal cash device is bringing back the old metallic sparkle of the money and mixing it with today’s technology in order to fill the deficiencies of our credit and debit cards.

Visual of Shark Drones Clean up the Port of Rotterdam

Shark Drones Clean up the Port of Rotterdam

In the port of Rotterdam you might be able to cross a floating Waste Shark: a robot able to collect up to 500 kilos of trash.

Visual of VR Days Europe: Next Nature Habitat

VR Days Europe: Next Nature Habitat

Next Nature Habitat premiered at VR Days Europe in Amsterdam last weekend.

Visual of What Is Next Nature? #16

What Is Next Nature? #16

Feeling lonely while surrounded with people

Visual of Your Next Sneakers Are Made of Algae

Your Next Sneakers Are Made of Algae

An ecofriendly alternative to plastic lies on the surface of waste streams.

Visual of Plastic Pod Beetles

Plastic Pod Beetles

Artist Alex Aebi' s collection of insects made of recycled plastic pods show us an alternative way in which this waste can inhabit our natural world.

Visual of Who Owns the Map?

Who Owns the Map?

In their pursuit of mapping the physical world online, mapping services simultaneously shape our understanding of it too.

Visual of Payment by Thumb

Payment by Thumb

Australian biohacker Meow-Ludo Meow Meow implanted a chip in his thumb to make contactless payments.

Visual of Flip-Flop Selfie

Flip-Flop Selfie

These two boys use the nap of their flip-flop as a camera to take an imaginary selfie. Still, their selfie went viral and it became our peculiar image of the week.

Visual of Using Nanobots to Treat Depression

Using Nanobots to Treat Depression

A team of scientists has developed a way to deliver drugs into our body using nanobots as vehicles and our toughts as controllers.

Visual of Preventing Data Leaks with Smell

Preventing Data Leaks with Smell

The Smell of Data alerts Internet users in any case of data leakage and communicates digital hazards by means of smell.

Visual of Bionic Prosthetic Arm with Personal Drone

Bionic Prosthetic Arm with Personal Drone

Why would you stick to an elbow, a wrist and five fingers if you could make anything? This guy got a game-inspired bionic arm.

Visual of New Diets for Cows Can Stop Gas Emissions

New Diets for Cows Can Stop Gas Emissions

Yearly 90 million metric tonnes of methane are burped and farted into the atmosphere by cattle with effects on climate change. Researchers are looking for ways to change the cow's diet, feeding it oregano, seaweed and super grass.

Visual of Rainforests Regrowth Boosts CO2 Capture

Rainforests Regrowth Boosts CO2 Capture

Newly grown rainforests can absorb 11 times as much carbon from the atmosphere as old-growth forests, a study has shown.

Visual of How Rare Is Virtual Gold?

How Rare Is Virtual Gold?

Part one of a ten part series exploring the design of an invisible technology: money.

Visual of Re-introducing Extinct Species

Re-introducing Extinct Species

Extinct European bisons are being reintroduced in parks. But what makes a national park?

Visual of ReGen, the Autarchic Off-Grid Village

ReGen, the Autarchic Off-Grid Village

Utopian off-grid ReGen Village produces all of its own food and energy is being implemented in Almere.

Visual of Reversing Evolution with a Legless Mouse

Reversing Evolution with a Legless Mouse

At a lab in Berkeley, California, there’s a mouse with no legs. Its head, torso, and tail are normal. It just lacks limbs. It didn’t lose those limbs; it just never grew them originally.

Visual of Robot Breaks Rubik's Cube World Record

Robot Breaks Rubik's Cube World Record

Watch this robot solving the Rubik's Cube in 1.047 second.

Visual of This Robot will Grow Food in Your Backyard

This Robot will Grow Food in Your Backyard

FarmBot Genesis is humanity's first open-source CNC farming machine designed for at-home automated food production.

Visual of This Robotic Stingray is Alive

This Robotic Stingray is Alive

By way of reverse engineering and taking heart cells from a rat, researchers at Harvard University have designed a miniature robotic stingray that is alive.

Visual of Self-Driving Cars Are Here to Stay

Self-Driving Cars Are Here to Stay

The first time you switch on your self-driving car, punch in your coordinates and cruise off to the soulless thrum of an electric motor you’ve got to wonder: does this thing know what it’s doing?

Visual of Solar Energy Day and Night

Solar Energy Day and Night

Special balloons able to catch the rays of the sun from above the clouds, producing clean energy day and night thanks to the help of a fuel cell.

Visual of Solar-Powered Donkeys to Stay Online

Solar-Powered Donkeys to Stay Online

Turkish shepherds are installing solar panels on their donkeys to stay connected.

Visual of A Step Further in the Race Against AI

A Step Further in the Race Against AI

Today, we all have superpowers. It may not seem like it because we are attached to our physical devices to use our powers, but with a Neural Lace that may soon change.

Visual of A System that Predicts Crime

A System that Predicts Crime

An experiment tries to prevent crime by identifying aggressive behavior with new surveillance technology before actual violence is used.

Visual of A Tablet for the Visually Impaired People

A Tablet for the Visually Impaired People

U.S. researchers are working on an affordable braille tablet for blind people.

Visual of Talking Contact Lenses

Talking Contact Lenses

Researchers at University of Washington have introduced a new wireless communication method that allows small wearable devices to ‘talk’ to everyday devices.

Visual of Your Teaching Assistant Is a Robot

Your Teaching Assistant Is a Robot

Jill Watson has been performing as teaching assistant for 5 months, but she is not a real person, and students didn't notice.

Visual of A Temporary Tattoo That Heals

A Temporary Tattoo That Heals

Moving tattoos from purely aesthetic crave to a healing method thanks to nanotechnology.

Visual of Rio 2016: the Olympic (Green) Abyss

Rio 2016: the Olympic (Green) Abyss

Last week the Olympic women’s diving pool at the Maria Lenk Aquatics Centre mysteriously turned swampy green overnight.

Visual of The Wordless Language

The Wordless Language

Emoji are taking our communication to a faster, simpler level.

Visual of Time Is a Universal Currency

Time Is a Universal Currency

The principle behind a time based currency is usually very simple: one hour of work equals a unit of time.

Visual of Our Tribal Genes Affect Politics

Our Tribal Genes Affect Politics

What if the cause of our politic choice was in our evolution, hidden deep in our genes and digging up our tribal instincts?

Visual of Turning Leaves into Batteries

Turning Leaves into Batteries

Other than decompose and give nutrition to the soil, leaves can be used to store energy, becoming the raw material of batteries.

Visual of A Robotic Suit to Update Your Granny

A Robotic Suit to Update Your Granny

The elderly may toss their walkers for this robotic suit.

Visual of Men Pregnancy: Reality or Science-fiction?

Men Pregnancy: Reality or Science-fiction?

The first uterus transplant in the United States raises the question: could uterus transplants allow men to get pregnant too?

Visual of VR Surgery and Live Stream Operations

VR Surgery and Live Stream Operations

There is a new breakthrough coming from the operating room: an app, called MDLinking, that connects 8.5 million doctors world wide.

Visual of Web Training Collar

Web Training Collar

Jasper van Loenen developed a wearable that sends a corrective electrostatic shock to its wearer when visiting an unprotected website.

Visual of What Is the Selfie Elbow?

What Is the Selfie Elbow?

The advent of digital communications media is bringing along some health conditions.

Visual of Scientists Connected a Brain to a Tablet

Scientists Connected a Brain to a Tablet

Severely paralyzed woman controls a tablet with her brain.

Visual of The World's First Invisible Train

The World's First Invisible Train

Japanese architect Kazuyo Sejima is designing the world's first invisible train.

Visual of 1978 - World’s First ‘Test Tube Baby’ Born

1978 - World’s First ‘Test Tube Baby’ Born

In 1978, the world's first test-tube baby was born, her name is Louise Brown.

Visual of 1996 - First Artificial Womb Experimented

1996 - First Artificial Womb Experimented

In 1996, Yoshinori Kuwabara at Juntendo University in Tokyo incubated a premature goat fetus by using extrauterine fetal incubation.

Visual of 3D Print Your Pizza in Six Minutes

3D Print Your Pizza in Six Minutes

Meet the commercial 3D pizza printer that takes your order via a smartphone app.

Visual of AI Draws New Worlds from Its Artificial Memory

AI Draws New Worlds from Its Artificial Memory

An AI draws streets and spaces stitching together its artificial memories of real places.

Visual of AI & VR Impact on Architects and Engineers

AI & VR Impact on Architects and Engineers

Future workspace, human interaction and unique experiences: here’s how artificial intelligence and VR impact on architects and engineers.

Visual of Air Pollution Mask for Kids

Air Pollution Mask for Kids

Danish design studio Kilo created an air pollution mask suitable for kids aged six and up.

Visual of One Day of Air Traffic

One Day of Air Traffic

Mike Kelly shows the entire day of traffic, in just one image.

Visual of Animal Guided Mediation

Animal Guided Mediation

Animal Meditation uses meditation guiding sounds to to enable user to feel as if he is an animal.

Visual of Animal Tsunami Alerts from Space

Animal Tsunami Alerts from Space

Global data about animal movements are indispensable in our today international networked world to understand how to safe human health and wildlife simultaneously.

Visual of What You Should Know About Artificial Intelligence Changing Jobs

What You Should Know About Artificial Intelligence Changing Jobs

It should come as no surprise that artificial intelligence naturally extends into the way we work. Let's look at how AI changes the way we relate to work.

Visual of Bacteria Use Electronic Messaging

Bacteria Use Electronic Messaging

Bacteria use electronic messaging system to recruit new workers.

Visual of Become an Emoji Translator

Become an Emoji Translator

Emoji translator wanted! London firm is looking for an emoji translator, take the test to find out if you're good enough.

Visual of Bionic Leaf Helps Vegetables to Grow

Bionic Leaf Helps Vegetables to Grow

Bionic leaf fertilizes crops to make them weigh 150 percent more

Visual of The New Way to Boost Creativity

The New Way to Boost Creativity

Danish company develops device to stimulate creativity.

Visual of Brainwaves as Password

Brainwaves as Password

Researchers have found a way to use our brainwave as a verification of our identity.

Visual of Cyborg Dragonfly for Special Service

Cyborg Dragonfly for Special Service

A Biomedical solutions company is developing a system for insects to wear, allowing engineers to steer it remotely.

Visual of Designer babies: the kids of the future?

Designer babies: the kids of the future?

What if you had the choice of sparing your child from diseases and disorders such as Alzheimer’s disease, heart disease or autism?

Visual of Drone Hits Crash Test Dummy for Your Safety

Drone Hits Crash Test Dummy for Your Safety

Researchers at Virginia Tech are studying the risk of injury from a drone collision by hitting a crash test dummy in the head.

Visual of ECO Coin Award 2017 Nominations Open

ECO Coin Award 2017 Nominations Open

The nominations for the ECO coin Award 2017 are now officially open. Let us know who you think deserves to earn the award.

Visual of ECO Coin Award Interviews: Ritsert Mans

ECO Coin Award Interviews: Ritsert Mans

We asked Ritsert Mans, our second ECO coin award nominee about his bike, the technology that fuels it and his hopes for the future.

Visual of ECO Coin Award Interviews: Sandra Rey

ECO Coin Award Interviews: Sandra Rey

We asked Sandra Rey, our third ECO Coin Award nominee, about her company Glowee and her hopes for illuminating the future in a more sustainable way.

Visual of The End of Air-Conditioning

The End of Air-Conditioning

New heat-reflective material signs the end of air-conditioning use.

Visual of Experience Death with VR

Experience Death with VR

Virtual reality experiment tries to help people frightened of death with outer-body experience.

Visual of A Fake City for Real Self-Driving Cars

A Fake City for Real Self-Driving Cars

Uber built a fake city called Almono to train self-driving cars. This town is full of fake houses, mannequins and chaotic intersections.

Visual of Fighting Plastic Waste Together

Fighting Plastic Waste Together

Eco Coin Award winner Dave Hakkens is upgrading his Precious Plastic recycling machines, and you can help him do it!

Visual of The Future of Firefighting

The Future of Firefighting

Firefighters can see through smoke with new thermal mask.

Visual of HUBOT: Meet the Focused Assembly Worker

HUBOT: Meet the Focused Assembly Worker

As a focused assembly worker, you are a real go-getter thanks to your smart tools. Wearing smart factory goggles and using a transparent LED screen, these give you direct …

Visual of How to Fool a Neural Network

How to Fool a Neural Network

A neural network helps computers with image recognition. It is usually tough to fool. But one group of researchers has found a way to reliably trick it.

Visual of Fungal Futures: the Mushrooms Utopia

Fungal Futures: the Mushrooms Utopia

Exhibition Fungal Futures: design with mushrooms.

Visual of Gene Therapy Cures Chronic Disease

Gene Therapy Cures Chronic Disease

Gene therapy can cure up to 200 different diseases and the list is growing.

Visual of Google Cars Can Now Sniff Out Pollution

Google Cars Can Now Sniff Out Pollution

Google cars can now measure urban air quality and collect data to create interactive maps with the most detailed views of pollution patterns ever created.

Visual of Greenhouse for Space Colonies

Greenhouse for Space Colonies

Researchers from Arizona and NASA unveiled a plan to sustainably provide food in space, growing it in an inflatable greenhouse.

Visual of Next Nature Habitat VR Wins Sweden VR Award

Next Nature Habitat VR Wins Sweden VR Award

Our Next Nature Habitat VR experience has won the Sweden International Virtual Reality Award in the category Best 360 Video!

Visual of Helix, the App Store for Your Genome

Helix, the App Store for Your Genome

Startup Helix launched an online hub where you can digitally explore your genetic code by downloading different apps on your computer or smartphone.

Visual of After Horsepower Comes Robotpower?

After Horsepower Comes Robotpower?

We fear being replaced by robots. They have the potential to be smarter, stronger and more hardworking than us, but so do horses.

Visual of HUBOT: Meet the Exoskeleton Mover

HUBOT: Meet the Exoskeleton Mover

A job from HUBOT: as an exoskeleton mover, you wear a motorized exoskeleton suit that gives you the muscular power of a gorilla.

Visual of HUBOT: Meet the Home Healthcare Professional

HUBOT: Meet the Home Healthcare Professional

The home healthcare professional is one of the 16 positions from HUBOT, the job agency for people and robots.

Visual of HUBOT: Meet the Air Traffic Security Worker

HUBOT: Meet the Air Traffic Security Worker

As air traffic security you make sure that birds stay away from the airport using your eagle drone. With an accessory console, you fly the quadcopter from the sideline to scare …

Visual of HUBOT: Meet the Blind Traffic Regulator

HUBOT: Meet the Blind Traffic Regulator

A visual impairment does not have to be confining and futile when it comes to traffic control. As a blind traffic regulator, you wear a haptic suit that translates the traffic …

Visual of HUBOT: Meet the Data Waiter

HUBOT: Meet the Data Waiter

As a data waiter you are working at the Tinder restaurant. Upon arrival, visitors log in with their social media account. An intelligent algorithm matches the guests based on …

Visual of HUBOT: Meet the Farm Director

HUBOT: Meet the Farm Director

Games are often played to escape a boring daily reality, but they can also teach us to take control over the land as farmers do. As a farm director you work in a gamified …

Visual of HUBOT: Meet the Remote Savior

HUBOT: Meet the Remote Savior

When giving first aid, all kinds of emotions are in play. Thus it is important for the victim of an accident to receive emotional assistance and to be mentally supported during an …

Visual of HUBOT: Meet the Supersmart Handyman

HUBOT: Meet the Supersmart Handyman

Don’t worry, a handyman doesn’t have to be a bookworm. You rather work with your hands than sitting in the library. And yet, you often need to read the manuals of the broken …

Visual of Internship at Next Nature Network

Internship at Next Nature Network

To all students! It's that time of the year again. We have six wonderful intern positions opening up in February 2018. Six! From editorial talent to design heroes to marketing …

Visual of Intimate Technology S01E01: All My Clothes

Intimate Technology S01E01: All My Clothes

This movie titled "All My Clothes" reminds us of a more straightforward example of intimate technology: the clothes we wear every day.

Visual of Intimate Technology S01E02: Misbehaving (Ro)bots

Intimate Technology S01E02: Misbehaving (Ro)bots

"Misbehaving (Ro)bots" asks whether technology could hope to replicate these small bothersome quirks that instill a feeling of intimacy.

Visual of Intimate Technology Series on NNN

Intimate Technology Series on NNN

We called upon artists, filmmakers and film enthusiasts around the world to create a one-minute videos for the intimate technology series.

Visual of Kangaroos Confuse Self-Driving Cars

Kangaroos Confuse Self-Driving Cars

Volvo's driverless car system has trouble recognizing kangaroos because it gets confused by the hopping of the marsupial.

Visual of Lazy Worker Ants

Lazy Worker Ants

A study reveals that about 40% of "worker" ants spend most of their days doing nothing, but those lazy ants make themselves useful in unexpected ways.

Visual of iPhones Are Happy to See Us

iPhones Are Happy to See Us

What if you could unlock your phone by simply looking at the camera? According to Apple, this is precisely how the iPhone X will work. But how secure is it?

Visual of Do a Next Nature Workshop!

Do a Next Nature Workshop!

NNN organizes workshops using a physical Pyramid of Technology as conceptual tool.

Visual of NNN Is Hiring: Managing Director

NNN Is Hiring: Managing Director

NNN is looking for a Managing Director to join our office in Amsterdam.

Visual of One Minute on the Internet

One Minute on the Internet

With the rise of modernity, we have domesticated ourselves with new technology: discover how the world spends one minute on the Internet.

Visual of Call for Videos: Intimate Technology

Call for Videos: Intimate Technology

Next Nature Network is curating the One Minutes series for September 2017.

Visual of Pay with Your Face

Pay with Your Face

Face-detecting systems in China now authorize payments, provide access to facilities, and track down criminals.

Visual of Plants + Science = Meat!

Plants + Science = Meat!

What if you could have the taste of a juicy, sizzling burger without the destructive impact of using animals for meat? That is what Impossible Foods wants to do with its new burger.

Visual of Print Your House in a Day!

Print Your House in a Day!

A Russian construction firm prints houses in 24 hours on site with their mobile 3D printer.

Visual of Read the Entire Artificial Womb Series

Read the Entire Artificial Womb Series

We published a timeline series to explore medical, cultural and technological developments in relation to the ectogenesis concept.

Visual of Robot Librarians Instruct Young Generations

Robot Librarians Instruct Young Generations

The Dutch province Gelderland-South uses two educational robots to increase kids' knowledge on such a technology.

Visual of FarmVille Turns into Real-Life Agriculture

FarmVille Turns into Real-Life Agriculture

A Japanese Start up brings Farmville back into real life by letting players grow physical food.

Visual of Your First AI Friend for Life

Your First AI Friend for Life

Replika is your friend for life. He is 100% AI chatbot that you “raise” by chatting with it.

Visual of Robo-Bee Pollinated a Japanese Lily

Robo-Bee Pollinated a Japanese Lily

A video of a robotic bee pollinating a flower (looking more like Loopin' Louie spinning off the board game and hitting a flower) recently caught our attention. What at first sight …

Visual of Dubai Employs First Robotic Police Officer

Dubai Employs First Robotic Police Officer

The first robotic officer will soon report for duty in Dubai.

Visual of Robotic Pillow Breathes to Help You Sleep

Robotic Pillow Breathes to Help You Sleep

A smart, huggable bed partner, who also improves your sleep quality. Sounds great, right? Soon, you might be able to order one yourself: Somnox is a soft robotic pillow that gently breathes as you hold it.

Visual of Rothko in Salts

Rothko in Salts

The multiplication of bacteria "paints" this lake with peculiar colours. Tints vary along magenta, green and yellow, giving it Rothko-like appearance.

Visual of GM Self-Destroying Moths

GM Self-Destroying Moths

Open-air tests of self-destructing moths mark a new frontier for GMOs.

Visual of Selfie Time with Your Dead Beloved One

Selfie Time with Your Dead Beloved One

Forever by your side. Elrois a South Korean firm developed an app that allows you to engage with your dead friends lovers or idols.

Visual of Sexy Cyborg Sports Her Prosthetic Limb

Sexy Cyborg Sports Her Prosthetic Limb

The Brazilian model Paola Antonini uses her Instagram to show off her prosthetic limb.

Visual of HUBOT: Meet the Singing Package Deliverer

HUBOT: Meet the Singing Package Deliverer

You did not make it to the Idols final, but you can sing very well and you love to make people happy. As a singing package deliverer, you deliver packages with a personal song. …

Visual of Smart Fabric Might Be the Key to the Future

Smart Fabric Might Be the Key to the Future

Researchers designed a smart fabric able to encode data readable by a magnetometer, like the one in your phone, without electronics or batteries.

Visual of Smartphones Will Soon Be a Thing of the Past

Smartphones Will Soon Be a Thing of the Past

Smartphones have become almost a part of who we are. According to tech industry experts, however, the smartphone's days are numbered and that number is lower than you might expect.

Visual of The Smell of Global Economy

The Smell of Global Economy

The Pollution Pods installation replicates the smell and air quality of five different urban environments, forming the smell of a global economy.

Visual of Drones Are Coloring Your Summer

Drones Are Coloring Your Summer

Looking for a summer book? Wherever your vacation takes you, our drones coloring book What’s Flying There? should be on your holiday packing list!

Visual of Chat with Plants in the Botanical Garden

Chat with Plants in the Botanical Garden

Exploring methods to better connect people to the natural world, Waag Society, in collaboration with the Dutch Botanical Gardens Association, have developed an app that allows visitors to talk with plants.

Visual of Robotic Tarzan Controls Crops

Robotic Tarzan Controls Crops

A robot inspired by a sloth was developed in order to control crops growing in our fields.

Visual of Your Smartphone Is Your New Eye Doctor

Your Smartphone Is Your New Eye Doctor

The EyeQue personal vision tracker is a smartphone app that allows you to test your eyes from the comfort of your couch.

Visual of Tinder for Orangutans

Tinder for Orangutans

The Apenheul primate park in Apeldoorn, the Netherlands, has launched a four-year experiment to study how the primates make their mating choices.

Visual of A Virtual Counselor for Mental Health

A Virtual Counselor for Mental Health

A Facebook chatbot that offers interactive cognitive behavioral therapy. It’s called Woebot and it's your personal virtual counselor.

Visual of Visit the Garden of Eden

Visit the Garden of Eden

Discover the Next Nature Habitat VR and explore four future environments we might live in someday.

Visual of A Voice Mask to Protect Your Privacy

A Voice Mask to Protect Your Privacy

Introducing world's first voice mask designed to protect your privacy.

Visual of The Water-Cleaning Bike

The Water-Cleaning Bike

How about a peddling ride accompanied by the sound of babbling water, with the awareness that what you are leaving behind is nothing else but clean water?

Visual of Plastic-Eating Worm Can Help Ease Pollution

Plastic-Eating Worm Can Help Ease Pollution

A recently discovered plastic eating worm could be used to safely digest our massive plastic waste.

Visual of World’s First Lab-Grown Chicken Is Here

World’s First Lab-Grown Chicken Is Here

Memphis Meats reveals world’s first lab-grown chicken.

Visual of Your Virtual Midwife Is Here

Your Virtual Midwife Is Here

An external device that helps you conceive, carry and raise a child. Too scary? Or extremely useful? It's up to you to decide, your virtual midwife is here!

Visual of A full course cabbage meal to discuss the problem of agricultural over-abundance

A full course cabbage meal to discuss the problem of agricultural over-abundance

Last night we were invited to celebrate the plenty at the third edition of the Neo-Futurist Dinner series at Mediamatic in Amsterdam. This time, the night was hosted by Dutch …

Visual of AR City: Paving the Way for Augmented Reality Navigation

AR City: Paving the Way for Augmented Reality Navigation

Augmented reality applications are a promising alternative to GPS. At least that is what Blippar’s AR City app claims to be.

Visual of Envisioning the future of artificial biological reproduction in Mexico

Envisioning the future of artificial biological reproduction in Mexico

The debate on the future of artificial biological reproduction is moving to Mexico. C Minds, an impact innovation agency that believes in ‘a 4th Industrial Revolution that brings …

Visual of What an artificial womb may look like in the future

What an artificial womb may look like in the future

In the future, artificial wombs could replace incubators as they mimic the natural environment of the female uterus. But what will these devices look like?

Visual of Bali goes offline for 24 hours to celebrate the Hindu New Year

Bali goes offline for 24 hours to celebrate the Hindu New Year

If you've been dreaming of disconnecting and ridding your day of digital distractions, there's an island destination that would love to have you this weekend. Tonight, in one of …

Visual of Next Nature Network x Border Sessions: <br> Calling for festival bloggers!

Next Nature Network x Border Sessions:
Calling for festival bloggers!

Calling all bloggers! We’d love to have you on board for the 2018 Border Sessions festival in The Hague (NL). Join our team for behind-the-scenes access to festival events. To …

Visual of Turning surplus bread into craft beer

Turning surplus bread into craft beer

Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …

Visual of Here's all you need to know about the future of the ECO Coin (and how it came about)

Here's all you need to know about the future of the ECO Coin (and how it came about)

Today is Earth Day! This means that we think about the relationship between man, nature and technology, as technology is becoming a nature of its own. Acknowledged in 192 …

Visual of Ermi van Oers wants to bring  living light to your living room

Ermi van Oers wants to bring living light to your living room

The Living Light harnesses plant energy to provide light. We spoke to its designer, Ermi van Oers, to find out more about the unique product.

Visual of HUBOT: Meet the Cybercrime Detective

HUBOT: Meet the Cybercrime Detective

As a cybercrime detective, you search for suspicious patterns that indicate crime in the digital domain.

Visual of HUBOT: Meet the Digital Detox Dietitian

HUBOT: Meet the Digital Detox Dietitian

As a digital detox dietitian, you know exactly how much digital technology your client needs and you give professional advice with a personal approach.

Visual of HUBOT: Meet the Walker Inspector

HUBOT: Meet the Walker Inspector

While many people consider a rollator as a sign of decay, you as a rollator inspector are just part of the headway! The walker inspector measures air quality, particulate matter …

Visual of HUBOT: Meet the Street Knitter

HUBOT: Meet the Street Knitter

Bricklayer, a physically heavy occupation, becomes a lot more bearable with the street-knitting robot. The street knitter is a job from HUBOT.

Visual of Interview: Huub Ehlhardt on the evolution of products

Interview: Huub Ehlhardt on the evolution of products

"To understand why a product is the way it is today, you need to learn about its evolutionary background." Meet Huub Ehlhardt, an engineer with a PhD in product design . Huub …

Visual of Interview: Jeremy Bailenson on his latest book

Interview: Jeremy Bailenson on his latest book "Experience on Demand"

Virtual reality has come a long way. Like most technological leaps, it’s had a huge push from the entertainment industry, but current applications span a wide range of social and …

Visual of Next Nature Gift Guide 2018

Next Nature Gift Guide 2018

The season of giving has come and to make sure you can find the perfect gift for your loved ones we have brought together a collection of Next Nature inspired goodies. Whether you …

Visual of Researchers are developing a device that can edit brain activity

Researchers are developing a device that can edit brain activity

Neuroscientists at the University of California Berkely are building a device that’ll hack our brains so we can ‘edit’ what we feel and remember. It looks like we’ve drawn “ Total …

Visual of Robo Wunderkind is a modular robot even a five-year-old can program

Robo Wunderkind is a modular robot even a five-year-old can program

Meet the Robo Wunderkind, a new breed of smart toys that introduces children to the basics of coding and robotics in a playful way. Advanced technologies are increasingly embedded …

Visual of Chernobyl goes green: The ambitious plan to reclaim a nuclear disaster site

Chernobyl goes green: The ambitious plan to reclaim a nuclear disaster site

Chernobyl is famous as the site of the worst nuclear power accidents in history. The 1986 disaster has come to represent the perils of nuclear energy, much as Hiroshima represents …

Visual of The Story of Money: Bits

The Story of Money: Bits

The story of money: an accessible roadmap from prehistory to digital age, from cows to credit, from gold mining to bitcoin mining. The final episode: bits.

Visual of Technology and Sports: Nutrigenomics

Technology and Sports: Nutrigenomics

We’ve been told since grade school that what we eat is important, but we’ve all been told to eat the same sort of healthy things. This isn’t bad, but with the up-and-coming …

Visual of The Ocean Cleanup heads for the Pacific

The Ocean Cleanup heads for the Pacific

The Ocean Cleanup claims its device could cut the size of the Great Pacific Garbage Patch in half in five years.

Visual of 'Thrillification' is thrill about getting notifications

'Thrillification' is thrill about getting notifications

Checking for new notifications has become a habit that is hard to resist. For some users of social networks it is a kind of an impulse. When receiving and opening notifications, …

Visual of 3D-printing food waste into tasty products

3D-printing food waste into tasty products

Globally, humans produce enough food to feed 10 billion people (we are only 7 billion now) yet somehow we waste a third of this. Food waste is one of the biggest climate …

Visual of The Forgotten Plan to Coat Utah's Delicate Arch with Plastic

The Forgotten Plan to Coat Utah's Delicate Arch with Plastic

Arches National Park, located in Utah, is home to some of America's most beautiful rock formations. The most famous of them, Delicate Arch, has always been, well, pretty delicate. So much so that back in the 1940s, park rangers hatched a plan to preserve the natural monument - by coating it in plastic.

Visual of Here’s what manufacturing enhanced with virtual reality will look like

Here’s what manufacturing enhanced with virtual reality will look like

Robots are coming for our jobs. Virtual reality is coming to make the jobs that remain easier to accomplish. All of the world’s manufacturing sectors are in the process of …

Visual of China's state news agency has unveiled a virtual newsreader

China's state news agency has unveiled a virtual newsreader

Don’t adjust your TV set, that’s just a new computer-generated news anchor working out the bugs. Xinhua, a Chinese state-run media company, and Sogou, a Beijing-based search …

Visual of How to bingewatch the Intimate Technology series

How to bingewatch the Intimate Technology series

Technology is coming closer to us. In the form of decades old headphones or state-of-art devices. It has always been a part of our lives and this only seems to develop further: …

Visual of Why digital detoxes are a solution looking for a problem

Why digital detoxes are a solution looking for a problem

With New Year’s resolutions in full swing, many people may have chosen to cut down on their tech use – or even give it up altogether. The  growing popularity of such “digital …

Visual of How technology bridges the generational communication gap

How technology bridges the generational communication gap

Emoji, Skype, Selfies - can these communication technologies close the generation gap? In part, yes! Young people are teaching senior citizens how to use technology, and it’s …

Visual of How to biofabricate leather

How to biofabricate leather

Leather is one of the oldest and most versatile materials in the world. It’s a supple, tough, relatively strong and durable material and it’s relatively impermeable, yet …

Visual of The Pyramid of Technology: How will technology enchant us?

The Pyramid of Technology: How will technology enchant us?

This question is an excerpt from the Pyramid of Technology toolkit Take a mundane object from your house. Now ask yourself: How will this particular technology enchant me? …

Visual of The path towards solar democracy with Marjan van Aubel

The path towards solar democracy with Marjan van Aubel

Solar cells are often considered an eyesore, used for their sustainability yet not for their beauty. Installed on roofs or in solar parks, they take up precious space. Well that’s …

Visual of Discover the art of the living at Centre Pompidou

Discover the art of the living at Centre Pompidou

Go forward to nature at the La Fabrique du Vivant (the Factory of Life), the newly opened exhibition at the Centre Pompidou in Paris. Exhibiting the recent works of fifty …

Visual of The Next Nature gift guide 2019

The Next Nature gift guide 2019

Whether you're in need of a holiday gift for your techie spouse or tech-adverse grandpa, the truth is, your loved ones deserve better than a generic gift card. Now we understand …

Visual of Pack your bags: Next Nature is going to China

Pack your bags: Next Nature is going to China

To our Chinese friends (and beyond)! From 2 November 2019 to 1 February 2020, we'll be crossing the globe for a large showcase at the OCT Art and Design Gallery in Shenzhen, …

Visual of Next Nature went to China!

Next Nature went to China!

We are proud to invite you to our largest showcase (so far), currently on display at OCT Art & Design in Shenzhen, China. Spanning across three floors, with a total surface of …

Visual of Taco futures: In vitro meat in Mexico City

Taco futures: In vitro meat in Mexico City

Our In Vitro Meat Cookbook has inspired many people around the world. Just recently, we had the BBC over at our headquarters to see what makes us thick. This idea of in vitro meat …

Visual of Watch the BBC report on world's first artificial womb

Watch the BBC report on world's first artificial womb

Now that the team of researchers at the Eindhoven University of Technology (whom we previously collaborated with to design a prototype for an artificial womb ) has been awarded a …

Visual of The Next Nature guide to Transmediale 2019

The Next Nature guide to Transmediale 2019

Berlin is kicking off its cultural season with the not-to-miss 23th installment of Transmediale . This year the digital art/culture festival focuses on how feelings are made into …

Visual of Build an organisation that lasts by creating a superorganism

Build an organisation that lasts by creating a superorganism

For the past 25 years, I’ve studied everything from baboon cooperation in Ethiopia and orca whale innovation in the Bering Sea, to the Argentine ant invasion in my kitchen, and my …

Visual of Meatable: from stem cells to pork chops

Meatable: from stem cells to pork chops

The food chain has always worked roughly like this: sunlight feeds plants. Plants feed insects. Insects and plants feed animals. Plants and animals feed people. Then …

Visual of How fungi can help create a green construction industry

How fungi can help create a green construction industry

The world of fungi has attracted a lot of interest and seems to be becoming very fashionable of late. A new exhibition at Somerset House in London, for example, is dedicated to …

Visual of Marjan van Aubel wins ECO Coin Award

Marjan van Aubel wins ECO Coin Award

Each year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honor them with our ECO Coin Award . We …

Visual of 9 creatives in biotech you need to know right now

9 creatives in biotech you need to know right now

The field of biofabrication is still new to most people. As founder and CEO of Biofabricate, Suzanne Lee shared with us this exciting online event series Creatives in Biotech . If …

Visual of Author Jenny Kleeman is meeting the people creating our future

Author Jenny Kleeman is meeting the people creating our future

Meet Jenny Kleeman , journalist and documentary-maker. Sex Robots & Vegan Meat is her first book for anyone interested in, well, sex robots, vegan meat, out of body birth bags …

Visual of Have you thought about your social media death?

Have you thought about your social media death?

Recently, Twitter announced it would be clearing all inactive accounts in an effort to free up dormant usernames and prevent the risk of old accounts being hacked. The new policy …

Visual of The Invention of Morel is a techno-lovestory from the future

The Invention of Morel is a techno-lovestory from the future

Octavio Paz says calls  The Invention of Morel , “ without exaggeration… a perfect novel. ” According to Borges, “ to classify  [it]  as perfect is neither an …

Visual of How a giant robot learns its true nature

How a giant robot learns its true nature

At first glance, the premise of the film 'The Iron Giant' (1999) seems to be a total failure. An animation film set in the United States in 1957; while the Russian satellite …

Visual of This app allows you to talk to quarantined people around the world

This app allows you to talk to quarantined people around the world

Loneliness is one of the silent serial killers during the pandemic. Therefore Next Nature provides you the tip to pick up your phone.  Artists Danielle Baskin and Max Hawkin …

Visual of This exhibition explores love in the internet age

This exhibition explores love in the internet age

Data Dating is an exhibition that explores what it means to find romance in the internet age. Love it or hate it, technology has transformed the way we date. So, how are digital …

Visual of This artist carried 99 smartphones and caused a virtual traffic jam

This artist carried 99 smartphones and caused a virtual traffic jam

“ Google choose the fastest route to home.” Today, drivers are better informed about routes and traffic than ever before . Using 'mapping apps', drivers can see traffic before …

Visual of Blind woman sees with new implant and plays video game sent straight to her brain

Blind woman sees with new implant and plays video game sent straight to her brain

It’s been over a decade since artificial retinas first began helping the blind see. But for many people, whose blindness originates beyond the retina, the technology falls short. …

Visual of This electronic skin enhances our virtual tactile perception

This electronic skin enhances our virtual tactile perception

From mouse, to stylus, to finger: our virtual tactile perception has changed a lot over the years, just like our overall virtual experience. With new developments our virtual …

Visual of Elephants are geodesigners

Elephants are geodesigners

Imagine you’re in a hot air balloon flying over an African savanna in the late growing season. Below, herds of elephants, zebras, wildebeests and rhinos roam a mosaic landscape …

Visual of Fish-inspired soft robot takes a deep dive

Fish-inspired soft robot takes a deep dive

The deepest regions of the oceans still remain one of the least explored areas on Earth, despite their considerable scientific interest and the richness of lifeforms inhabiting …

Visual of 5 unusual technologies for harvesting water in dry areas

5 unusual technologies for harvesting water in dry areas

Water scarcity is among the top five global risks affecting people’s wellbeing. In water-scarce areas, the situation is grim. Conventional sources like snowfall, rainfall, river …

Visual of This podcast aims to help design better food systems

This podcast aims to help design better food systems

The podcast Food by Design was created by Sarah Codraro and Sandeep Pahuja, and is hosted by Sandeep. According to the makers "Our food system is not 'broken'. It’s working …

Visual of Future cities: why we need to reimagine the look of urban landscapes

Future cities: why we need to reimagine the look of urban landscapes

In imagining future urban landsapes, we need to answer questions about what can be sustained and what cannot, where cities can be located and where they cannot.

Visual of Lab or nature: scientists are debating the origins of COVID-19

Lab or nature: scientists are debating the origins of COVID-19

We need to talk about COVID-19. Again (or, still). One of the main questions about SARS-CoV-2, the virus that causes COVID-19, has for a while been about its origins. Most viruses …

Visual of Leonardo DiCaprio is investing in future meat startups

Leonardo DiCaprio is investing in future meat startups

Globally, humanity consumes almost 350 million tons of meat a year. In the next 10 years, this number is expected to increase by a significant percentage. Scientists believe that …

Visual of Max Liboiron: pollution is colonialism

Max Liboiron: pollution is colonialism

We now live in a world where plastics are becoming a part of our marine ecosystems. As a result, we strive hard to clean the plastics from our oceans. Dr. Max Liboiron ( Michif …

Visual of Reproducing robots

Reproducing robots

When we think of robots, we typically do not think of small cellular organisms made with embryonic cells from frogs. However, this is exactly what the joint teams at University of …

Visual of Roman Krznaric contemplates on becoming a good ancestor

Roman Krznaric contemplates on becoming a good ancestor

Roman Krznaric's ultimate guide to radically change our perception of time and become good grand-grandparents

Visual of The Internet of Mycelium

The Internet of Mycelium

A lot of the ground we live on is polluted. More than a third of our soils are moderately or heavily degraded; heavy metals such as lead are increasingly found in urban soils, …

Visual of Working with microbes to clean up electronic waste

Working with microbes to clean up electronic waste

If you were to stack up all the electronic waste produced annually around the world it would weigh as much as all the commercial aircrafts ever produced, or 5,000 Eiffel towers. …

Visual of Exploring public spaces, landmarks and landscapes in Beneath the Surface expo

Exploring public spaces, landmarks and landscapes in Beneath the Surface expo

The ‘Beneath the Surface’ exhibition organized by Taiwan Designers’ Web at the Chiayi Art Museum teaches us about unconventional connections, past and future.

Visual of Visit the Embassy of Food conference during DDW22

Visit the Embassy of Food conference during DDW22

Will there still be a supermarket as we know it today in 2050?

Visual of Emma van der Leest wins ECO Coin Award 2022

Emma van der Leest wins ECO Coin Award 2022

Each year we search the globe for people and projects that have outstandingly contributed to make this planet a more sustainable place and honour them with our  ECO Coin …

Visual of The long history of the metaverse

The long history of the metaverse

Many aspects of the current metaverse were already familiar 143 years ago.

Visual of Personalise your gut health with Microbiota To Go

Personalise your gut health with Microbiota To Go

In the supermarket of the future, part of the Embassy of Food at Dutch Design Week, designer Merle Bergers will present her project Microbiota To Go.

Visual of Next Generation: Emptying Out with Natasja Bökkerink

Next Generation: Emptying Out with Natasja Bökkerink

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of Next Generation: (Un)learning Time By Light with Valentine Maurice

Next Generation: (Un)learning Time By Light with Valentine Maurice

This story is part of  Next Generation , a series in which we give young makers a platform to showcase their work. Your work here?  Get in touch  and plot your …

Visual of The carbon footprint of space tourism

The carbon footprint of space tourism

The commercial race to get tourists to space is heating up between Virgin Group founder Sir Richard Branson and former Amazon CEO Jeff Bezos. On Sunday 11 July, Branson ascended …

Visual of From Megabytes to CO2

From Megabytes to CO2

Thijs Biersteker has designed an art installation that shows the carbon dioxide emission of the internet.

Visual of The Solar Biennale brings new perspectives on the energy of the sun

The Solar Biennale brings new perspectives on the energy of the sun

The sun lies at the heart of our solar system, providing life-giving light, heat and energy to Earth. The sun always gives, without asking for anything in return. In the …

Visual of What's solar geoeneering and why is it controversial?

What's solar geoeneering and why is it controversial?

A report from 2021 from the National Academies of Sciences, Engineering and Medicine tackles a controversial question : Is solar geoengineering – an approach designed to cool the …

Visual of Bluehouses are the new greenhouses

Bluehouses are the new greenhouses

Fishfarming , or aquaculture has been the fastest growing food-sector for decades. This is nothing to be surprised about: fishing as a practice has been in existence since the …

Visual of A Dutch startup is saving the banana from extinction

A Dutch startup is saving the banana from extinction

There is a banana crisis happening right now. Our beloved yellow fruits are being threatened with extinction due to a fungal infection called Panama disease, which can wipe out …

Visual of A shoebox of fractal flowers

A shoebox of fractal flowers

It's not every day that someone walks into your office with a shoebox, and even more rare when that shoebox contains a potential future.

Visual of Paco Rabanne's AI-designed perfume can connect with your phone while making you smell sexier

Paco Rabanne's AI-designed perfume can connect with your phone while making you smell sexier

Paco Rabanne already positioned himself as a cutting-edge designer by establishing his reputation as one of the trailblazers during the space age movement of the 1960s. With his …

Visual of Saving the oceans by sinking a 1980's superyacht

Saving the oceans by sinking a 1980's superyacht

Sunshine, cocktails, and the lap of luxury; a yacht usually doesn’t seem to symbolize sustainability or charity. But this one might save the ocean.

Visual of Gigantic lab-grown mammoth meatball feeds an entire family

Gigantic lab-grown mammoth meatball feeds an entire family

Researchers used genetic information from an extinct mammoth to create a lab-grown meatball.

Visual of Meat the future: the Netherlands might soon become a global hub for in vitro meat

Meat the future: the Netherlands might soon become a global hub for in vitro meat

Remember when we created a little petition back in 2018 in the hope to legalise the tasting of in vitro meat? About 4000 of you agreed with us and signed it. If you were one of …

Visual of All aboard the world's first hydrogen passenger train!

All aboard the world's first hydrogen passenger train!

As the world is trying to keep carbon emissions under control, humans are also looking for viable carbon-neutral transportation options. The people from French rolling stock …

Visual of This vending machine gives out health advice in exchange for your personal data

This vending machine gives out health advice in exchange for your personal data

Your biggest wealth is health, but what it the costs you your anonymity? This vending machine gives you nutritional advice based on the information you give it.

Visual of Cleaning water with magnets

Cleaning water with magnets

What if we could clean our water with magnets? Wageningen University & Research, introduces the Magnetic Adsorption-Desorption (MAD) project.

Visual of Food after flood: what's on the menu when sea levels rise?

Food after flood: what's on the menu when sea levels rise?

As sea levels climb, coastal communities brace for floods and erosion. Artist Allie Wist asked herself: what will we eat in a flood-filled future?

Visual of Obese mice are losing weight without breaking a sweat

Obese mice are losing weight without breaking a sweat

Bye-bye gym membership, hello losing pounds. Scientists have found a new drug that helped obese mice lose weight.

Visual of Mindful Messaging

Mindful Messaging

How often do you send meaningless messages that only distract others? It's time for mindful messaging.

Visual of Using bacteria to create self-fired and biologically glazed ceramics

Using bacteria to create self-fired and biologically glazed ceramics

Embracing nature's ingenuity, designer Nicole Chrysikou harnesses the power of bacteria for her pottery practices.

Visual of Furniture futures

Furniture futures

Wondering how next natural furniture may change your way of life? Will we feed our lamps? Grow chairs? Talk with our tables?

Visual of Nature Loves Technology

Nature Loves Technology

We interviewed William Myers and Emma van der Leest, curators of Nature Loves Technology, our exhibition at Floriade 2022

Visual of Future Festive Feast

Future Festive Feast

As the year is coming to a close, many of us are preparing our homes and dinner tables for a festive meal.

Visual of Enter Spa Sybarite: the luxury wellness center of our dreams and nightmares

Enter Spa Sybarite: the luxury wellness center of our dreams and nightmares

In conversation with film director Joshua Ashish Dawson about the future of wellness, climate anxiety and healthy cynicism India-born, Los Angeles-based film director Joshua …